Transaminase mutant, encoding gene and application thereof
By site-directed mutagenesis of Bacillus megaterium transaminase BM-ATA, the catalytic activity and stereoselectivity were enhanced, solving the problem of low synthesis efficiency of (S)-1-(3-methoxyphenyl)ethylamine in the existing technology, and realizing the preparation of chiral intermediates of rivastigmine at high efficiency and low cost.
Patent Information
- Application Number
- CN202310344498.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-03
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2043-04-03
AI Technical Summary
The lack of an efficient transaminase for synthesizing (S)-1-(3-methoxyphenyl)ethylamine in existing technologies results in high cost and low efficiency in the preparation of chiral intermediates of rivastigmine.
By site-directed mutagenesis of the transaminase BM-ATA derived from Bacillus megaterium, various transaminase mutants were obtained to enhance their catalytic activity and stereoselectivity. Specifically, the mutants were mutated at amino acid positions 295, 387, and 436. Corresponding codon mutations were performed on the encoding genes, and recombinant expression vectors were constructed and expressed in Escherichia coli.
The preparation of high-optical-purity (S)-1-(3-methoxyphenyl)ethylamine was achieved, with significantly improved enzyme activity, high product yield, and reduced production costs, showing good prospects for industrial application.
Smart Images

Figure CN116334022B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, in particular to a transaminase mutant for the modification of a transaminase from Bacillus megaterium, a coding gene and an application thereof in the preparation of (S)-1-(3-methoxyphenyl)ethylamine. BACKGROUND
[0002] Rivastigmine belongs to the third generation of drugs that improve the function of the cholinergic system. It increases the function of cholinergic neurons in the brain by inhibiting acetylcholinesterase, thereby improving the cognitive function of Alzheimer's disease patients. It can also inhibit butyrylcholinesterase to exert a dual inhibitory effect, and is used for the treatment of mild to moderate Parkinson's dementia. (S)-1-(3-methoxyphenyl)ethylamine is one of the key chiral intermediates for the synthesis of rivastigmine.
[0003] Currently, the preparation of rivastigmine chiral intermediates mainly includes chemical method and biological catalysis method. The chemical method mainly includes asymmetric induction synthesis using chiral catalysts, such as (salen)Mn(III), titanium tetraisopropylate, etc. in Chinese patent documents CN111362814A, CN101481335A, etc. for asymmetric induction synthesis of rivastigmine chiral intermediates; or using a specific resolution system to resolve racemic amine or alcohol intermediates to obtain key chiral amine or chiral alcohol intermediates, and then through subsequent conversion to obtain S configuration rivastigmine product, such as Chinese patent documents CN114804989A, CN113461554A, CN104151176A. Although the reagents used in the chemical resolution method are relatively inexpensive, only half of the racemate can be utilized, and the other configuration is wasted, resulting in high cost and large amount of waste.
[0004] The use of biological catalysis method can obtain corresponding high stereoselectivity product in one step, reduce the use of chiral inducers in asymmetric induction synthesis method, simplify the operation process, reduce the production cost, and improve the atom economy. Transaminase can transfer amino group from donor to acceptor by using cofactor pyridoxal phosphate, and has high stereoselectivity and wide substrate spectrum. Chinese patent document CN115807046A uses a Vibrio fluvialis transaminase Vf-ω-ATA to participate in the preparation of another rivastigmine chiral intermediate 3S-(1-aminoethyl)phenyl ethyl(methyl)carbamate, and good results are obtained. However, there is no natural transaminase that can efficiently synthesize (S)-1-(3-methoxyphenyl)ethylamine. Therefore, it is a problem to be solved by those skilled in the art to develop transaminase with high catalytic activity and strong stereoselectivity for the synthesis of (S)-1-(3-methoxyphenyl)ethylamine. SUMMARY
[0005] The application aims to provide a transaminase with high catalytic activity and strong stereoselectivity for preparing (S)-1-(3-methoxyphenyl)ethylamine with high optical purity, meeting the requirements of industrial production.
[0006] To achieve the above-mentioned object, the application adopts the following technical scheme:
[0007] The application obtains a transaminase mutant by site-directed mutagenesis on the coding gene (SEQ ID NO. 16) of the transaminase BM-ATA from Bacillus megaterium. The transaminase mutant is a mutant obtained by amino acid mutation of the transaminase from Bacillus megaterium with the amino acid sequence shown in SEQ ID NO. 1, wherein the site of the amino acid mutation is at least one of the 295th, 387th and 436th positions, or a combination of the 242nd position and at least one of the 295th, 387th and 436th positions, and the threonine at the 295th position is mutated into cysteine, the leucine at the 387th position is mutated into alanine, the valine at the 436th position is mutated into alanine, and the alanine at the 242nd position is mutated into valine.
[0008] Specifically, the threonine at the 295th position is mutated into cysteine BmATA-T295C, and the amino acid sequence is shown in SEQ ID NO. 2;
[0009] The mutant BmATA-L387A in which the leucine at the 387th position is mutated into alanine has the amino acid sequence shown in SEQ ID NO. 3;
[0010] The mutant BmATA-V436A in which the valine at the 436th position is mutated into alanine has the amino acid sequence shown in SEQ ID NO. 4;
[0011] The mutant BmATA-A242V / T295C in which the alanine at the 242nd position is mutated into valine and the threonine at the 295th position is mutated into cysteine has the amino acid sequence shown in SEQ ID NO. 5;
[0012] The mutant BmATA-A242V / L387A in which the alanine at the 242nd position is mutated into valine and the leucine at the 387th position is mutated into alanine has the amino acid sequence shown in SEQ ID NO. 6;
[0013] The mutant BmATA-A242V / V436A in which the alanine at the 242nd position is mutated into valine and the valine at the 436th position is mutated into alanine has the amino acid sequence shown in SEQ ID NO. 7;
[0014] a mutant BmATA-T295C / L387A in which the threonine at position 295 is mutated to cysteine and the leucine at position 387 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 8;
[0015] a mutant BmATA-T295C / V436A in which the threonine at position 295 is mutated to cysteine and the valine at position 436 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 9;
[0016] a mutant BmATA-L387A / V436A in which the leucine at position 387 is mutated to alanine and the valine at position 436 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 10;
[0017] a mutant BmATA-A242V / T295C / L387A in which the alanine at position 242 is mutated to valine, the threonine at position 295 is mutated to cysteine and the leucine at position 387 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 11;
[0018] a mutant BmATA-A242V / T295C / V436A in which the alanine at position 242 is mutated to valine, the threonine at position 295 is mutated to cysteine and the valine at position 436 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 12;
[0019] a mutant BmATA-A242V / L387A / V436A in which the alanine at position 242 is mutated to valine, the leucine at position 387 is mutated to alanine and the valine at position 436 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 13;
[0020] a mutant BmATA-T295C / L387A / V436A in which the threonine at position 295 is mutated to cysteine, the leucine at position 387 is mutated to alanine and the valine at position 436 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 14;
[0021] a mutant BmATA-A242V / T295C / L387A / V436A in which the alanine at position 242 is mutated to valine, the threonine at position 295 is mutated to cysteine, the leucine at position 387 is mutated to alanine and the valine at position 436 is mutated to alanine, the amino acid sequence of which is shown as SEQ ID NO. 15.
[0022] Studies have shown that the catalytic activity of the above transaminase mutants is significantly improved compared to the wild-type transaminase.
[0023] Conservative substitution forms, forms with one or several amino acids added or deleted, amino-terminal truncated forms, carboxy-terminal truncated forms of other amino acid sites of the transaminase mutant are also included in the scope of the present application.
[0024] The present application also provides coding genes for encoding the transaminase mutant, which are obtained by mutating codons encoding corresponding amino acids based on the nucleotide sequence shown in SEQ ID NO. 16. Specifically, T295C is the mutation of the codon ACC encoding the 295th threonine into the codon TGC encoding cysteine, L387A is the mutation of the codon CTG encoding the 387th leucine into the codon GCG encoding alanine, V436A is the mutation of the codon GTT encoding the 436th valine into the codon GCG encoding alanine, and A242V is the mutation of the codon GCA encoding the 242nd alanine into the codon GTG encoding valine.
[0025] The present application also provides a recombinant expression vector containing the coding gene encoding the amino acid sequence of the transaminase mutant. Preferably, the recombinant expression vector takes pET30a as the vector plasmid.
[0026] The present application also provides a genetically engineered bacterium containing the recombinant expression vector, which is used for producing the transaminase mutant. The recombinant vector is transformed into a host cell to obtain a recombinant genetically engineered bacterium, and the host cell can be various conventional host cells in the art. As a preferred, the host bacterium of the genetically engineered bacterium is E. coli BL21.
[0027] The present application also provides a method for constructing the transaminase mutant, which comprises the following steps:
[0028] (1) designing site-directed mutation primers, taking a plasmid carrying a coding gene of transaminase from Bacillus megaterium as a template, and performing reverse PCR to obtain a single-site mutation product in which the 295th T is mutated to C or the 387th L is mutated to A or the 436th V is mutated to A;
[0029] (2) taking the single-site mutation product as a template, performing reverse PCR using the site-directed mutation primers to obtain a double-site mutation product, or using primers for mutating the 242nd A to V to obtain a double-site mutation product; taking the double-site mutation product as a template, performing reverse PCR using the site-directed mutation primers to obtain a triple-site mutation product; taking the triple-site mutation product as a template, performing reverse PCR using the site-directed mutation primers to obtain a quadruple-site mutation product;
[0030] (3) transforming the unit point mutation product, double site mutation product, three site mutation product or four site mutation product to a host bacterium, screening to obtain a transaminase mutant expression strain, inducing expression, and obtaining the transaminase mutant.
[0031] Primer required for mutating T at position 295 to C:
[0032] T295C-F: 5'-CAGCCGGATATTATTTGCATGGGTAAAGGTCTGAG-3';
[0033] T295C-R: 5'-CTCAGACCTTTACCCATGCAAATAATATCCGGCTG-3';
[0034] Primer required for mutating L at position 387 to A:
[0035] L387A-F: 5'-GATGGTTATGGCCTGGCGTGGATTGTTGATATTGTG-3';
[0036] L387A-R: 5'-CACAATATCAACAATCCACGCCAGGCCATAACCATC-3';
[0037] Primer required for mutating V at position 436 to A:
[0038] V436A-F: 5'-GATTGGTGGTGCGATGCCGAATACCATGCG-3';
[0039] V436A-R: 5'-CGCATGGTATTCGGCATCGCACCACCAATC-3';
[0040] Primer required for mutating A at position 242 to V:
[0041] A242V-F: 5'-GAAGTTAGCCAGGGTGTGGGTAGCGCAATG-3';
[0042] A242V-R: 5'-CATTGCGCTACCCACACCCTGGCTAACTTC-3'.
[0043] Preferably, the original carrier of the recombinant plasmid is pET30a; and the host bacterium is E. coli BL21.
[0044] Another object of the present application is to provide the use of the transaminase mutant in the preparation of (S)-1-(3-methoxyphenyl)ethylamine, which comprises asymmetrically catalyzing the amination of 3-methoxyacetophenone to form (S)-1-(3-methoxyphenyl)ethylamine under the condition of adding amine donor.
[0045] The transaminase mutant provided by the present application asymmetrically catalyzes the amination of 3-methoxyacetophenone to form (S)-1-(3-methoxyphenyl)ethylamine with high optical purity (e.e.>99%) under the condition of adding amine donor, which has good prospects for industrial application.
[0046] The use comprises: using the wet bacteria obtained by centrifugation of the fermentation culture of the engineering bacteria containing the gene encoding the transaminase mutant, the wet bacteria immobilized cells, the enzyme extracted from the wet bacteria after ultrasonic disruption or the immobilized enzyme as the catalyst, using (S)-α-methylbenzylamine and pyridoxal phosphate as the external reagents, using 3-methoxyacetophenone as the substrate, using the buffer solution containing organic solvent and having a pH value of ≤8 as the reaction medium, reacting at 25-37°C and 150-300rpm, and then separating and purifying the reaction solution to obtain (S)-1-(3-methoxyphenyl)ethylamine.
[0047] The transaminase mutant provided by the present application can be used in the form of whole cells of engineering bacteria, in the form of crude enzyme without purification, or in the form of partially purified or completely purified enzyme. The transaminase mutant provided by the present application can also be made into a biocatalyst in the form of immobilized enzyme or immobilized cells by using the immobilization technology known in the art.
[0048] Preferably, the amount of catalyst in the reaction system is 20-100g / L based on the weight of wet bacteria, wherein the water content of the wet bacteria is 70-90%. More preferably, the amount of catalyst is 50g / L.
[0049] Preferably, the concentration of substrate in the reaction system is 1-8g / L, more preferably 3g / L.
[0050] Preferably, the concentration of (S)-α-methylbenzylamine in the reaction system is 4-35g / L, more preferably 12g / L.
[0051] Preferably, the concentration of pyridoxal phosphate in the reaction system is 0.2-0.4g / L, more preferably 0.25g / L.
[0052] Preferably, the pH buffer solution is a phosphate buffer, i.e. NaH2PO4-Na2HPO4 buffer, which has a buffer pH value of 7.0-8.0, further preferably 7.4-7.6, more preferably 7.5.
[0053] Preferably, the organic solvent is isopropyl alcohol or dimethyl sulfoxide, and the volume fraction of the organic solvent in the pH buffer solution is 8-12%, more preferably 10%.
[0054] The addition concentration of each raw material, such as the wet bacterial cells, the substrate, (S)-alpha-methylbenzylamine and pyridoxal phosphate, is calculated based on 1 L of the pH buffer solution.
[0055] Preferably, the reaction temperature is 30°C.
[0056] The reaction time is 3-6 h, preferably 4 h.
[0057] Preferably, the shaking rate is 220 rpm.
[0058] Preferably, the wet bacterial cells are E. coli BL21 / pET30a-BmATA-T295C / L387A / V436A. The yield of (S)-1-(3-methoxyphenyl)ethylamine produced by the mutant can reach 75.22%, which is 19 times that of the wild-type transaminase under the same catalytic conditions, and the optical purity ee s is 98%.
[0059] The fermentation culture method is as follows: the recombinant engineering bacteria are inoculated into LB liquid medium containing kanamycin (final concentration of 50 μg / mL) and are shaken and cultured at 37°C for 18 h; the seed liquid is inoculated into fresh LB liquid medium containing kanamycin (final concentration of 50 μg / mL) at a volume ratio of 1%, and is shaken and cultured at 37°C and 220 rpm until the bacterial cells reach OD 600 of 0.6; isopropyl-beta-D-thiogalactopyranoside (IPTG) is added at a final concentration of 0.1 mM, and the induction culture is carried out at 25°C and 220 rpm for 16 h; and the bacterial cells are collected by centrifugation at 4°C and 3500 rpm for 10 min.
[0060] The present application has the following beneficial effects:
[0061] (1) The transaminase mutant provided by the present application has higher enzyme activity than the wild-type transaminase, and can be used to prepare (S)-1-(3-methoxyphenyl)ethylamine with 3-methoxyphenylacetone as the substrate, with high yield of the product and no by-product produced.
[0062] (2) The present application uses the transaminase mutant as a chiral intermediate biocatalyst for rivastigmine, so that the high-optical-purity chiral product is more economical and simple to obtain, and the production method has the advantages of simple operation and low cost, greatly reduces the production cost, and has good industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0063] Figure 1 is a plasmid map of the recombinant mutant.
[0064] Figure 2 Liquid chromatogram of product (S / R)-1-(3-methoxyphenyl) ethylamine standard, E. coli BL21 blank control, product of reaction of transaminase BM-ATA and substrate 3-methoxyphenylacetophenone. DETAILED DESCRIPTION
[0065] The application will be further described in conjunction with specific examples. The following examples are only used to illustrate the application, and are not intended to limit the scope of the application. Modifications or replacements of the method, steps or conditions of the application, without departing from the spirit and essence of the application, all belong to the scope of the application.
[0066] Unless otherwise specified, the raw materials used in the application can be purchased from the market or commonly used in the art. Unless otherwise specified, the methods in the following examples are conventional methods in the art. Nucleic acids are written from left to right in the 5' to 3' direction, and amino acid sequences are written from left to right in the amino-terminal to carboxy-terminal direction.
[0067] Example 1: Construction of engineering bacteria capable of expressing each mutant
[0068] 1. According to the 5g0a (Bacillus megaterium-derived transaminase, www.rcsb.org / structure / 5G0A) protein amino acid sequence in the PDB protein library, the corresponding coding gene was synthesized by Shanghai Jeery Bioengineering Co., Ltd., wherein the his tag at the end of the 5g0a amino acid sequence was removed, i.e., the end sequence was changed from EWQALEHHHHHH to EWQ*. The amino acid sequence of the wild-type Bacillus megaterium-derived transaminase is shown in SEQ ID NO. 1, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 16. Then, using plasmid pET30a as a vector, a recombinant plasmid pET30a containing the coding gene was obtained by conventional preparation operation, and the recombinant plasmid was transformed into E. coli BL21 to obtain an engineering recombinant strain of wild-type transaminase. The recombinant strain was activated on an LB plate containing 1‰ kanamycin (Kan) resistance, and cultured at 37°C for 18h. A single colony was picked up in a 50mL LB conical flask containing the same 1‰ kanamycin resistance, and cultured at 37°C, 220rpm until the OD 600 was about 0.6, and the plasmid was extracted according to the plasmid miniprep kit instructions.
[0069] 2. Construction of transaminase single-site 295, 387, 436 mutants
[0070] The plasmid extracted in step 1 was used as a template to construct the mutant plasmid using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, United States). The threonine (T) at position 295, the leucine (L) at position 387, and the valine (V) at position 436 in the wild-type amino acid sequence were mutated by site-directed mutagenesis, and the corresponding primers were designed as shown in Table 1.
[0071] Table 1. Mutation primers
[0072] Primer Sequence (5'-3') A242V-F: GAAGTTAGCCAGGGTGTGGGTAGCGCAATG A242V-R: CATTGCGCTACCCACACCCTGGCTAACTTC T295C-F: CAGCCGGATATTATTTGCATGGGTAAAGGTCTGAG T295C-R: CTCAGACCTTTACCCATGCAAATAATATCCGGCTG L387A-F: GATGGTTATGGCCTGGCGTGGATTGTTGATATTGTG L387A-R: CACAATATCAACAATCCACGCCAGGCCATAACCATC V436A-F: GATTGGTGGTGCGATGCCGAATACCATGCG V436A-R: CGCATGGTATTCGGCATCGCACCACCAATC
[0073] The mutant plasmid constructed above was transformed into E. coli BL21 competent cells, mixed and placed on ice for 25 min. After the end, the E. coli BL21 competent cells were placed in a temperature of 42°C for 90 s, then placed on ice for 5 min. Then 1 mL of LB medium was added, and the cells were cultured at 37°C for 50 min. After the end, the cells were centrifuged at 12000 rpm for 1 min. 100 μL of supernatant was resuspended with bacteria, and then plated on LB plates containing 1‰ kanamycin, and cultured in a 37°C incubator for 18 h.
[0074] A single colony was picked from the plate and placed in a test tube containing 5 mL of LB medium. After 8 h of culture, 1 mL was taken for sequencing. The remaining bacterial solution was added with an equal volume of 40% glycerol solution, and stored in a -80°C refrigerator for standby use.
[0075] The transaminase mutant engineering bacteria E. coli BL21 / pET30a-BmATA-T295C, E. coli BL21 / pET30a-BmATA-L387A, and E. coli BL21 / pET30a-BmATA-V436A were obtained, respectively. The sequencing results showed that the codon ACC encoding threonine (T) at position 295 was mutated to the codon TGC encoding cysteine (C); the codon CTG encoding leucine (L) at position 387 was mutated to the codon GCG encoding alanine (A); and the codon GTT encoding valine (V) at position 436 was mutated to the codon GCG encoding alanine (A). The amino acid sequences of the mutants T295C, L387A, and V436A were SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, respectively.
[0076] 3. Construction of transaminase combination mutants
[0077] The pET30a-BmATA-T295C, pET30a-BmATA-L387A and pET30a-BmATA-V436A constructed in step 2 were used as templates, and the point mutation kit was used to complete the construction of the mutant plasmid, and the method was the same as above.
[0078] The sequencing results correctly obtained the transaminase mutant engineering bacteria E. coli BL21 / pET30a-BmATA-A242V / T295C, E. coli BL21 / pET30a-BmATA-A242V / L387A, E. coli BL21 / pET30a-BmATA-A242V / V436A, E. coli BL21 / pET30a-BmATA-T295C / L387A, E. coli BL21 / pET30a-BmATA-T295C / V436A, E. coli BL21 / pET30a-BmATA-L387A / V436A, and the corresponding amino acid sequences were SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10. The sequencing results showed that the codon GCA encoding alanine (A) at position 242 was mutated to the codon GTG encoding valine (V); the codon GTT encoding valine (V) at position 436 was mutated to the codon GCG encoding alanine (A).
[0079] Further, the above-mentioned plasmid was used as a template to obtain the transaminase mutant engineering bacteria E. coli BL21 / pET30a-BmATA-A242V / T295C / L387A, E. coli BL21 / pET30a-BmATA-A242V / T295C / V436A, E. coli BL21 / pET30a-BmATA-A242V / L387A / V436A, E. coli BL21 / pET30a-BmATA-T295C / L387A / V436A, E. coli BL21 / pET30a-BmATA-A242V / T295C / L387A / V436A, and the corresponding amino acid sequences were SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15.
[0080] Example 2: Induced expression of each mutant
[0081] The engineered bacteria expressing wild enzyme and the engineered bacteria expressing each mutant were inoculated into 5 mL LB liquid medium tubes containing 50 μg / mL kanamycin, respectively, and incubated at 37°C for 18 h. Then, 1% (v / v) of the inoculum was inoculated into 50 mL LB medium containing 50 μg / mL kanamycin, and incubated at 37°C, 220 rpm, until the bacterial concentration reached OD 600 about 0.6, and then 0.1 mmol / L IPTG was added, and the bacteria were induced at 25°C, 220 rpm for 16 h. The wet bacteria were collected by centrifugation at 4°C, 3500 rpm for 10 min, and the wet bacteria of the engineered bacteria expressing wild enzyme and the engineered bacteria expressing each mutant were obtained, respectively.
[0082] Example 3: Preparation of (S)-1-(3-methoxyphenyl)ethylamine by each mutant at a substrate concentration of 3 g / L
[0083] A reaction solution was prepared by mixing 12 g / L (S)-a-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 3 g / L 3-methoxyphenylacetophenone, and 10% isopropanol in a NaH2PO4-Na2HPO4 buffer having a pH of 7.5.
[0084] The wet bacteria of each mutant obtained in Example 2 were resuspended in the reaction solution to have a wet bacteria content of 50 g / L, and the reaction system solution was prepared. 1 mL of the reaction system solution was placed in a constant temperature shaker at 37°C, 220 rpm, and reacted for 4 h. After the reaction, the product was extracted with ethyl acetate and centrifuged, and then vacuum rotary evaporated at 35°C for 1.5 h. Subsequently, the product was redissolved in a liquid mobile phase (1.0 M aqueous perchloric acid solution).
[0085] The yield and ee value were determined by high performance liquid chromatography (HPLC) analysis, and the liquid chromatogram of (S / R)-1-(3-methoxyphenyl)ethylamine standard is shown in FIG. 1. Figure 2 The ee value and yield of the product were measured as shown in Table 2. s
[0086] Table 2. ee value and yield of (S)-1-(3-methoxyphenyl)ethylamine prepared by each mutant s
[0087] Product ee s Values Yield Wild-type BmATA >99% 3.96% Mutant BmATA-T295C 96% 7.39% Mutant BmATA-L387A >99% 14.5% Mutant BmATA-V436A >99% 4.28% Mutant BmATA-A242V / T295C >99% 32.15% Mutant BmATA-A242V / L387A >99% 24.34% Mutant BmATA-A242V / V436A >99% 34.42% Mutant BmATA-T295C / L387A 98% 17.4% Mutant BmATA-T295C / V436A 95% 9.43% Mutant BmATA-L387A / V436A >99% 36.91% Mutant BmATA-A242V / T295C / L387A >99% 55.07% Mutant BmATA-A242V / T295C / V436A 96% 42.73% Mutant BmATA-A242V / L387A / V436A >99% 29.01% Mutant BmATA-T295C / L387A / V436A >99% 75.22% Mutant BmATA-A242V / T295C / L387A / V436A 95% 42.02%
[0088] Example 4: Preparation of (S)-1-(3-methoxyphenyl)ethylamine by mutant T295C / L387A / V436A at a substrate concentration of 6 g / L
[0089] The reaction solution was prepared by using 24 g / L (S)-a-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 6 g / L 3-methoxyacetophenone, 10% isopropyl alcohol, and 0.25 g / L NaH2PO4-Na2HPO4 buffer solution with pH of 7.5.
[0090] The obtained mutant T295C / L387A / V436A wet bacteria were resuspended in the reaction solution to obtain a solution with a wet bacteria content of 50 g / L, which was prepared as the reaction system solution. 1 mL of the reaction system solution was placed in a 37°C constant temperature shaker at 220 rpm for 4 h. After the reaction, the solution was extracted with ethyl acetate and centrifuged, and then vacuum rotary evaporation was performed at 35°C for 1.5 h, followed by redissolution with a liquid phase (high chloride acid aqueous solution with pH of 1.0).
[0091] The yield and ee value were determined by high performance liquid chromatography (HPLC) analysis, and the liquid chromatogram of the (S / R)-1-(3-methoxyphenyl)ethylamine standard is shown in Figure 2 The final ee value was measured to be 98%, and the yield was 61.5%. s
[0092] Experimental result analysis: Compared with the wild type, the transaminase BM-ATA mutant provided by the application has better catalytic activity. The concentration of the chiral amine catalyzed by the BM-ATA mutant is 1-8 g / L, the highest space-time yield can reach 22.3 g / L / day, the ee value is 98%, and the optical purity is high. The catalyst is easy to prepare, the reaction conditions are mild, the substrate adaptability is wide, the environment is friendly, the asymmetric amination reaction of the potential chiral ketone can be efficiently catalyzed, and the application has good industrial application and development prospects. s
[0093] The basic principles, main features and advantages of the application are shown and described above. Those skilled in the art should understand that the above examples do not limit the application in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the application.
Claims
1. A transaminase mutant, characterized in that, The transaminase mutant is a mutant of a transaminase from Bacillus megaterium with an amino acid sequence as shown in SEQ ID NO. 1, wherein the amino acid mutation is at least one of positions 295, 387, 436, or a combination of position 242 and at least one of positions 295, 387, 436, and wherein the threonine at position 295 is mutated to cysteine, the leucine at position 387 is mutated to alanine, the valine at position 436 is mutated to alanine, and the alanine at position 242 is mutated to valine.
2. The transaminase mutant of claim 1, wherein, The amino acid sequence of the transaminase mutant is shown in any one of SEQ ID NO. 2-15.
3. A transaminase mutant gene, wherein the amino acid sequence of the mutant gene is represented by SEQ ID NO: 1, and the mutant gene is represented by SEQ ID NO:
2. The transaminase mutant gene is used for encoding the transaminase mutant of claim 1 or 2.
4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises a coding gene encoding the amino acid sequence of the transaminase mutant of claim 1 or 2.
5. The recombinant expression vector of claim 4, wherein, The recombinant expression vector uses pET30a as the vector plasmid.
6. A genetically engineered bacterium for producing the transaminase mutant according to claim 1 or 2, characterized by, The genetically engineered bacteria comprise the recombinant expression vector of claim 4 or 5.
7. The genetically engineered bacteria as described in claim 6, characterized in that, The host bacteria are E. coli BL21.
8. Use of a transaminase mutant according to claim 1 or 2 for the preparation of (S)-1-(3-methoxyphenyl)ethylamine, characterized in that, The application comprises asymmetric catalytic amination of 3-methoxyacetophenone to generate (S)-1-(3-methoxyphenyl)ethylamine under the condition of adding an amine donor.
9. Use according to claim 8, wherein the compound is ###0002### The application comprises using the wet bacteria obtained by centrifugation of the fermentation culture of the genetically engineered bacteria containing the transaminase mutant coding gene, the wet bacteria immobilized cells, the enzyme extracted after ultrasonic disruption of the wet bacteria, or the immobilized enzyme as the catalyst, using 3-methoxyacetophenone as the substrate, using a buffer with pH≤8 containing an organic solvent as the reaction medium, using (S)-α-methylbenzylamine and pyridoxal phosphate as the external reagents, and using 25-37℃ and 150-300rpm as the reaction conditions, and after the reaction, separating and purifying the reaction solution to obtain (S)-1-(3-methoxyphenyl)ethylamine.
10. Use according to claim 9, wherein In the reaction system, the concentration of the substrate is 1-8g / L, the concentration of (S)-α-methylbenzylamine is 4-35g / L, the concentration of pyridoxal phosphate is 0.2-0.4g / L, the organic solvent is isopropyl alcohol or dimethyl sulfoxide, the volume fraction is 8-12%, and the amount of the catalyst is 20-100g / L based on the weight of the wet bacteria, wherein the water content of the wet bacteria is 70-90%.
Citation Information
Patent Citations
Rivastigmine intermediate preparation
CN101481335A
Chiral intermediate of rivastigmine, and preparation method thereof
CN104151176A
Synthetic method of rivastigmine chiral intermediate
CN111362814A
Rivastigmine intermediate purification method
CN113461554A
Purification method and racemization recycling of rivastigmine key chiral intermediate
CN114804989A