Application of gene ZmNAL1.1 in regulating growth period of maize

Abstract

The present invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the use of the gene ZmNAL1.1 in regulating maize growth periods. This gene, located on maize chromosome 2, can delay the tasseling, silking, and pollen shedding stages of maize by reducing its expression level. The difference in flowering time between transgenic and wild-type materials is due to editing of the gene's coding region, resulting in a decrease in the level of the protein encoded by the gene. This invention provides a new genetic resource for improving maize flowering time.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology and specifically relates to the application of gene ZmNAL1.1 in regulating the growth period of corn. The gene of the present invention is located on the second chromosome of corn and controls important agricultural traits of corn, such as tasseling, silking and pollen shedding. Background Art

[0002] The transition from vegetative to reproductive growth in maize is a critical period in its growth and development. This transition not only directly determines the flowering period of the plant but is also closely linked to reproductive development, thus influencing yield. Therefore, flowering period is a key target trait in maize breeding and production. Furthermore, in agricultural production, flowering period is closely linked to both late-maturing and early-maturing maize traits. Research on flowering period regulation is of great significance for molecular breeding, genetic improvement of maize growth stages, and germplasm resource innovation.

[0003] Flowering is a crucial physiological change for plants, transitioning most plants from vegetative growth (stem and leaf production) to reproductive growth (inflorescence production). It's a crucial developmental transition in the plant life cycle and plays a crucial role throughout the entire growth and development cycle. Flowering is influenced by both the plant's own genetic factors and external environmental factors. Under these influences, florigen is transported from the leaves to the stem apex via conducting tissues, stimulating the formation of the apical meristem and inducing floral induction. Flowering traits generally include tasseling, pollen shedding, and silking, and are crucial traits in crop evolution and adaptation. They not only influence corn's adaptability to growing regions and resistance to various stresses, but also significantly impact multiple traits such as yield and quality. Discovering the key genes controlling corn flowering and better understanding the mechanisms regulating flowering are crucial for breeding, screening, and improving new corn varieties suitable for cultivation in different ecological zones.

[0004] In light of this, this study used genetic methods to isolate a gene, ZmNAL1.1, located on maize chromosome 2, that controls flowering time. This gene encodes a trypsin-like serine protease. Phenotypic and molecular biological analyses of transgenic materials confirmed the gene's biological function in controlling traits such as tasseling, silking, and pollen shedding. The genetic transformation of ZmNAL1.1 could provide genetic resources and theoretical support for maize breeding. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of gene ZmNAL1.1 in regulating the flowering period of corn. The amino acid sequence encoded by the gene is shown in SEQ ID NO.3.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] Application of the maize gene ZmNAL1.1 in improving the growth period of maize, wherein the protein encoded by the gene is shown in SEQ ID NO.3;

[0008] The above-mentioned application, preferably the application includes using conventional methods in the art to reduce the expression level of the corn gene ZmNA L1.1 in corn, or not express it in corn to delay the growth period of corn, the conventional methods including CRISPR editing, mutation, knockout or silencing of the gene ZmNAL1.1;

[0009] For the application described above, when using CRISPR editing, the gRNAs are: gRNA1: GAGCTTGTTGATAAGTTGTGTGG; and gRNA2: GTACAAGTAAATCTTGAGGGGGG.

[0010] In the above application, the growth period includes: corn tasseling period, corn silking period and / or corn pollen shedding period. Compared with the prior art, the present invention has the following advantages:

[0011] The present invention cloned and confirmed a gene ZmNAL1.1 that controls the reproductive period in corn, and confirmed the relationship between the tasseling period, silking period, and pollen shedding period and the expression level of ZmNAL1.1. By reducing its expression level, the tasseling period, silking period, and pollen shedding period of corn can be delayed. The difference in flowering period between transgenic materials and wild-type materials is due to the editing of the gene coding region, which causes the protein level encoded by the gene to decrease. In terms of mechanism of action, it is believed that this gene regulates the expression of downstream genes by affecting the histone modification level (acetylation level) of downstream floral transition-related genes, ultimately affecting the activity (size) of the corn apical meristem (SAM), affecting the flowering period traits of corn such as tasseling, silking, and pollen shedding. Therefore, the present invention provides a new gene resource for improving the flowering period of corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of the phenotype of maize ZmNAL1.1 gene knockout material.

[0013] Among them: A is a schematic diagram of the phenotype of the maize ZmNAL1.1 gene knockout material, from left to right respectively: the wild-type families WT-1, WT-2, and WT-3 obtained by separating three transgenic heterozygous plants, and the three ZmNAL1.1 gene-edited families cr-nal1.1-1, cr-nal1.1-2, and cr-nal1.1-3; B is a schematic diagram of the investigation of the three maize ZmNAL1.1 gene knockout line materials during the tasseling period; C is a schematic diagram of the investigation of the three maize ZmNAL1.1 gene knockout line materials during the pollen shedding period; D is a schematic diagram of the investigation of the three maize ZmNAL1.1 gene knockout line materials during the silking period.

[0014] Figure 2 This is an analysis diagram of the expression pattern of maize ZmNAL1.1;

[0015] Among them: A: Expression analysis of ZmNAL1.1 in seven tissues including root (Root), leaf (Leaf), 1 cm long female ear (1cm Ear), 3-5 cm long female ear (3-5cm Ear) and stem apical meristem (SAM), among which it was highly expressed in the stem apical meristem (SAM); B: Expression site of ZmNAL1.1 in maize SAM tissue. In situ hybridization results showed that ZmNAL1.1 was specifically expressed in the leaf primordium adjacent to the stem apical meristem.

[0016] Figure 3 Schematic diagram of the phenotype of the stem apical meristem (SAM) of maize ZmNAL1.1 gene knockout materials;

[0017] Among them: A is the image of the SAM tissue in WT-1 and cr-nal1.1-1 among the maize ZmNAL1.1 gene knockout materials after transparent treatment; B is the comparison of the SAM tissue of WT-1 and cr-nal1.1-1 materials in terms of width, height, area and volume; C is the image of the SAM tissue in WT-2 and cr-nal1.1-2 among the maize ZmNAL1.1 gene knockout materials after transparent treatment; B is the comparison of the SAM tissue of WT-2 and cr-nal1.1-2 materials in terms of width, height, area and volume.

[0018] Figure 4 Schematic diagram of the analysis of ZmNAL1.1 transcriptional activity in maize;

[0019] Among them: A is the yeast self-activation experiment diagram of maize ZmNAL1.1; B is the yeast diagram of maize ZmNAL1.1 protein truncation. Figure 5 Schematic diagram of the CPB-ZmUbi-hspCas9 vector.

[0020] Figure 6 Schematic diagram of the pGBKT7 vector. DETAILED DESCRIPTION

[0021] The following examples further define the present invention. Based on the following description and examples, those skilled in the art can determine the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make appropriate improvements and modifications to the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all from commercial channels or published materials.

[0022] Example 1: ZmNAL1.1 cloning

[0023] Total DNA was extracted from leaves of the inbred line KN5585. Primers 02323-F and 02323-R were designed based on the maize B73 genome reference sequence (National Crop Germplasm Center) (primer names and sequences are shown in Table 1). The Zm NAL1.1 gene was amplified by PCR in KN55B5 and resequenced. The complete nucleotide sequence of the Zm NAL1.1 gene was obtained (shown in SEQ ID NO. 1). The CDS sequence is shown in SEQ ID NO. 2, encoding the protein shown in SEQ ID NO. 3.

[0024] Total DNA from plant leaves was extracted using the CTAB method, and the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by 34 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s, and finally extension at 72°C for 5 min.

[0025] The PCR amplification system is:

[0026]

[0027]

[0028] Table 1. Primers used in the present invention and their sequences

[0029]

[0030] Example 2: Genetic transformation of ZmNAL1.1 in maize

[0031] The genetic transformation for knockout of the ZmNAL1.1 gene utilized the full-length CDS sequence of ZmNAL1.1 from the transgenic recipient material KN5585 (shown in SEQ ID NO. 2) as the target gene. Gene target design was performed using the website http: / / cbi.hzau.edu.cn / crispr / , ultimately generating two guide RNAs. Two target primers, Target-1F and Target-2F, were designed using the two guide RNA sequences. The first and second ZmU6 promoters were amplified using pU6F1 and pU6R, and pU6F2 and pU6R. The first and second Target+sgRNA fragments were amplified using Target-1F and gRR0, and Target-2F and gRR1, respectively. Overlapping pU6F1 and gRR0, and pU6F2 and gRR1, resulted in the amplification of the ZmU6-Target1-sgRNA and ZmU6-Target2-sgRNA fragments. These fragments were then homologously recombined into the HindIII-digested CPB-ZmUbi-hspCas9 vector. ( Figure 4 , primer sequences are shown in Table 1, Primer ID is 2). The resulting clones were then sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, Primer ID is 3) to confirm that the gene was linked to the vector. The correctly cloned plasmid was then transformed into the maize inbred line KN5585 via Agrobacterium-mediated genetic transformation (genetic transformation was performed by the Life Science Technology Center of China National Seed Group Co., Ltd.).

[0032] Three maize transformation events were obtained based on the KN5585 background, including WT-1, WT-2, WT-3 and cr-nal1.1-1, cr-nal1.1-2, cr-nal1.1-3 ( Figure 1 In the spring of 2022, the phenotypic values ​​of maize at the tasseling, silking, and pollen shedding stages were investigated. The results showed that compared with WT-1, the tasseling, silking, and pollen shedding of cr-nal1.1-1 were delayed by 6-7 days; compared with WT-2, the tasseling, silking, and pollen shedding of cr-nal1.1-2 were delayed by 4-5 days; and compared with WT-3, the tasseling, silking, and pollen shedding of cr-nal1.1-3 were delayed by 2-3 days ( Figure 1 Based on the above results, it was shown that reducing the expression of ZmNA L1.1 significantly delayed the tasseling, silking, and pollen shedding stages of maize, indicating that ZmNA L1.1 positively regulates the growth period of maize.

[0033] Example 3: Expression analysis of ZmNAL1.1

[0034] Total RNA was extracted from different tissues of B73 seedlings, including roots, stems, leaves, stem apical meristem (SAM), tassels, and 1 cm and 3-5 cm panicles. TRIZOL reagent was used to extract total RNA and reverse transcribed into cDNA. Quantitative PCR analysis was performed using cDNA as a template and gene-specific primers (Table 1, primer ID 4). The ZmNAL1.1 gene was expressed at the highest level in the SAM ( Figure 2 At the same time, we used RNA in situ hybridization to verify the specific expression pattern of ZmNAL1.1 in 14d SAM tissue, and found that it was expressed in leaf primordia adjacent to the SAM ( Figure 2 Middle B, primer sequence is shown in Table 1, primer ID is 5); it is speculated that this gene is highly expressed mainly in maize SAM tissue, affecting the floral transition of maize.

[0035] Example 4: Phenotypic Observation of ZmNAL1.1 Knockout Line SAM

[0036] The SAM tissues of two wild-type (WT-1, WT-2) and knockout materials (cr-nal1.1-1, cr-nal1.1-2) ZmNAL1.1 that had been planted for 18 days were sliced ​​and placed in PFA fixative overnight. Mix with 50%, 70%, 85%, and 100% gradient alcohol for 1 hour each time in a 4°C refrigerator. After rinsing once with a mixture of 50% alcohol and 50% methyl salicylate, store in 100% methyl salicylate solution for a long time, and then observe the SAM tissue. The results showed that the SAM in the two knockout lines was smaller than that of the wild type, and its length, height, area and volume were significantly reduced ( Figure 3 ).

[0037] Example 5: Analysis of ZmNAL1.1 transcriptional activity

[0038] The full-length CDS of ZmNAL1.1 was amplified from young spikelet tissue of B73 material and recombined into the pGBKT7 vector ( Figure 6 ), spread on yeast culture plates (SD / -Trp), and culture at 30℃ for 2-3 days. Its gradient dilution was spread on SD-3(-Trp / -His / -Ade) and SD-3(-Trp / -His / -Ade)+Xa-gal yeast culture plates, cultured at 30℃ for 2-3 days, and the growth of colonies was observed. The pGBKT7 vector was used as a negative control. The results showed that ZmNAL1.1 has transcriptional activation activity ( Figure 4In order to further identify the transcriptional activation region, the protein sequence of ZmNAL1.1 was truncated and connected to the pGBKT7 vector according to the functional domain region of ZmNAL1.1, and then spread on yeast culture plates (SD / -Trp). Then, the yeast colonies were gradiently diluted and spread on SD-3 (-Trp / -His / -Ade) and SD-3 (-Trp / -His / -Ade) + Xa-gal yeast culture plates, cultured at 30℃ for 2-3 days, and the growth of the colonies was observed. The results showed that the G region of ZmNAL1.1 is its activation region AD ( Figure 4 Middle B).

Claims

1. Corn Genes ZmNAL1.1 The application of the gene in improving the growth period of corn is shown in SEQ ID NO.

3. The improvement is to reduce the growth period of corn genes. ZmNAL1.1 The expression level in corn, or no expression in corn, thereby delaying the growth period of corn.

2. The use according to claim 1, wherein the growth period is: corn tasseling stage, corn silking stage, or corn pollen shedding stage.

3. The application according to claim 1, wherein the application process is to introduce the corn gene into the ZmNAL1.1 CRISPR editing to delay corn's reproductive period.

4. The use according to claim 3, wherein when CRISPR editing is used, the gRNAs are: gRNA1: GAGCTTGTTGATAAGTTGTGTGG; and gRNA2: GTACAAGTAAATCTTGAGGGGGG.

Images