Preparation and application of a zebrafish strain lacking intestinal chitin membrane

Abstract

This invention relates to the preparation and application of a chitin-membrane-deficient zebrafish strain. The invention obtains a zebrafish strain with a completely absent intestinal chitin membrane by knocking out the chs1 gene. The nucleotide sequence of the CRISPR / Cas9-based sgRNA of the knocked-out zebrafish chs1 gene is shown in SEQ ID NO: 18, and the nucleotide sequence targeting the chs1 gene is shown in SEQ ID NO: 1. The chitin-membrane-deficient zebrafish strain of this invention can be used for research on intestinal chitin membranes, intestinal digestion and absorption, intestinal flora, intestinal epithelial renewal and aging, and intestinal immune function. It can also be used to study the mechanisms of damage to the intestine caused by harmful substances, including but not limited to pathogenic microorganisms, microplastics, and heavy metals. Furthermore, it can serve as an ideal small intestinal model for studying mammalian small intestinal diseases.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the preparation and application of a zebrafish strain lacking intestinal chitin membrane. Background Technology

[0002] In insects, chitin-based membrane structures, known as perifecal membranes, partition the entire digestive process, optimizing intestinal nutrient absorption. Simultaneously, the intestinal chitinous membrane defends against bacterial and viral invasions, blocks toxins, and helps maintain intestinal immunity, playing a crucial role in protecting and maintaining normal intestinal function. Therefore, many agricultural pesticides target perifecal membranes to kill pests. However, when these agricultural pollutants enter the aquatic environment, they can affect the chitinous membrane in the intestines of bony fish, thus harming fish health. The chitinous membrane partitions the intestinal epithelium and its surface mucus layer from digested matter in the external environment. Similar to the polysaccharide mucus layer of mammals, it provides different ecological niches for microbial colonization, thus influencing intestinal microbial homeostasis. Furthermore, as a physical barrier on the intestinal surface, the chitinous membrane blocks microplastics, heavy metals, and various pollutants from entering the fish body through the intestinal epithelium, maintaining epithelial cell homeostasis and reducing negative physiological impacts on the fish's intestines.

[0003] The chs1 (chitin synthase 1) gene is located on chromosome 13 of zebrafish, and its protein is specifically responsible for the synthesis of the chitin membrane in the zebrafish intestine. Chitin-based membranous protective barriers exist in the intestines of various insects, as well as in sea squirts, cephalochordates like amphioxus, and bony fish. Furthermore, in zebrafish, the chitin membrane is crucial for maintaining intestinal digestive function, intestinal epithelial cell homeostasis, and mucosal immunity.

[0004] The CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats system / CRISPR-associated 9) system is a tool widely used in the field of gene editing in recent years. It originates from an immune mechanism in bacteria and archaea that defends against viral or other exogenous DNA invasion. This system is simple in structure, highly efficient, and can specifically target and partially or completely delete a segment of a gene sequence, thus disrupting downstream physiological activities such as transcription and translation, thereby achieving gene function loss.

[0005] Currently, the function of the chitin membrane in the animal gut, especially in vertebrates, remains unclear. One key reason is the lack of an animal model that genetically completely lacks the chitin membrane. Previous studies could only temporarily disrupt the chitin membrane by knocking down or inhibiting it, thus limiting experiments to short periods and preventing observation of the long-term effects of this structure's absence on the gut. No animal model of intestinal chitin membrane deficiency has yet been established. Zebrafish, as a classic model organism, offers advantages such as simple genetic manipulation, high reproductive efficiency, and clear genomic information. A chitin membrane-deficient model can be constructed through gene editing to study the effects of the chitin membrane on the fish gut. Although Chinese invention patent CN110402893A discloses the preparation and application of an Nrf2 gene-deficient zebrafish mutant, and also discloses the use of CRISPR / Cas9 technology and specific target sites to knock out the nrf2 gene to construct an Nrf2 gene-deficient zebrafish mutant, the target gene is the nrf2 gene. For the chs1 gene, it is not obvious which sgRNA can successfully knock out the zebrafish chs1 gene and obtain an effective mutation. Therefore, it is essential to conduct research on knocking out the chs1 gene to obtain a chitin-complete deletion model. Summary of the Invention

[0006] The objective of this invention is to solve the technical problem of the lack of animal models with genetic deletion of intestinal chitin membrane, and to provide a method for preparing and applying a zebrafish strain with a genetically completely missing intestinal chitin membrane.

[0007] This invention provides a method and its application for obtaining a zebrafish strain with a genetic deletion of the intestinal chitin membrane by knocking out the chs1 gene.

[0008] The purpose of this invention is to provide a zebrafish strain with a complete absence of intestinal chitin membrane, obtained by knocking out the chs1 gene.

[0009] The present invention also aims to provide the application of the zebrafish strain as a model for studying chitin membrane function, as an animal model for studying gut microbiota, as an animal model for studying intestinal immune function, as an animal model for studying intestinal epithelial cell renewal and aging, as an animal model for studying intestinal digestion and absorption function, and as an animal model for studying small intestinal diseases.

[0010] Another objective of this invention is to provide an sgRNA for constructing the zebrafish strain.

[0011] Another objective of this invention is to provide a target site for constructing the zebrafish strain.

[0012] Another objective of this invention is to provide a method for constructing the zebrafish strain.

[0013] This invention demonstrates that the chitin membrane of zebrafish intestines is synthesized by the chs1 gene. By knocking out the chs1 gene, a zebrafish strain completely lacking an intestinal chitin membrane was obtained. The absence of a chitin membrane in zebrafish leads to a series of significant intestinal physiological changes: the intestine loses two radial septa, the gut microbiota loses its normal ecological niche, significantly reduces the intestine's ability to restrict and compress ingested food, slows the movement of ingested food in the intestine, significantly reduces intestinal digestion and absorption, accelerates the damage, renewal, and aging of the intestinal epithelium, and results in the loss of important immune and physical barriers, making it difficult to prevent ingested food, including but not limited to pathogenic microorganisms and microplastics, from invading the intestinal mucosa. The zebrafish intestine without a chitin membrane also structurally resembles the small intestine structure of humans and other mammals. Therefore, zebrafish strains lacking intestinal chitin membranes can be used to study the function of chitin membranes, intestinal digestion and absorption, intestinal flora, intestinal epithelial renewal and aging, intestinal immune system, and the harmful effects of harmful substances, including but not limited to pathogenic microorganisms, microplastics and heavy metals, on the intestines. They can also serve as an ideal small intestinal model for studying mammalian intestinal diseases.

[0014] Zebrafish are stomachless fish, allowing for direct stimulation or infection experiments of the intestines via gavage. The composition of zebrafish intestinal cells is similar to that of mammalian small intestinal cells, and their surface mucosa also contains intestinal mucosal antibodies similar to mammalian immunoglobulin A (IgA), such as immunoglobulin Z (IgZ). This invention, by eliminating the chitinous membrane, leaves a sparse mucus layer on the surface of the zebrafish intestine, achieving similarity to the mammalian small intestine in structure, cells, and mucosal immune system, thus possessing the potential of a rare animal model for studying small intestinal diseases.

[0015] The present invention aims to provide the first animal model of genetic deletion of chitin membrane.

[0016] This invention aims to construct a chs1 gene-deleted zebrafish strain, using chs1 gene knockout zebrafish as a model for studying the effects of pollutants such as microplastic particles and heavy metals in water on the digestive system of fish. The constructed zebrafish model lacking the intestinal chitin membrane can serve as a research model for various small intestinal diseases in mammals, including but not limited to ① classic inflammatory bowel disease (IBD), including Crohn's disease and ulcerative colitis, as well as non-classical enteritis, including allergic enteritis; ② acute enteritis, viral diarrhea, cholera, etc. caused by various viral or bacterial infections.

[0017] The above-mentioned objectives of the present invention are achieved through the following technical means:

[0018] This invention designs a specific sgRNA target site for the chs1 gene, with the sgRNA knockout site located in exon 2. Using specific upstream and downstream primers, a DNA fragment with the structure T7 promoter-target site sequence-sgRNA scaffold is amplified from the 19T-SCFgR vector, and the sgRNA is obtained through in vitro transcription. Cas9 mRNA was obtained through in vitro transcription. A mixture of sgRNA and Cas9 mRNA was microinjected into one-cell stage zebrafish zygotes. After culturing for 3–5 days, genomic DNA was extracted, and PCR amplification was performed using specific upstream and downstream primers. The effectiveness of chs1 gene knockout was detected by sequencing. Simultaneously, the tail fin genome of sexually mature zebrafish was amplified, and F0 chimeras with the chs1 gene deletion were screened. These chimeras were then crossed with wild-type zebrafish to obtain F1 heterozygous zebrafish. The genotypes of the F1 heterozygous zebrafish were identified, and F2 zebrafish with the same genotype were self-crossed to obtain F2 zebrafish. After sexual maturity, homozygotes were identified, which were the chs1 gene deletion zebrafish. To prevent low fertility and deformities caused by multiple generations of self-crossing, some homozygotes were testcrossed with wild-type zebrafish to obtain heterozygous zebrafish with different genetic backgrounds.

[0019] A stable, heritable zebrafish strain with complete absence of the intestinal chitin membrane was obtained by knocking out the chs1 gene.

[0020] The zebrafish strain was used as an animal model for studying the function of the intestinal chitin membrane.

[0021] The zebrafish strain lost two radial intestinal septa, resulting in the gut microbiota losing its normal ecological niche. Therefore, it can be used as an animal model for studying gut microbiota. The zebrafish strain is used as an animal model for studying gut microbiota.

[0022] The zebrafish strain lacks a chitinous membrane and radial intestinal septum, resulting in the loss of important immune and physical barriers in the intestine. This makes it difficult to prevent ingested food substances, including but not limited to pathogenic microorganisms and microplastics, from invading the intestinal mucosa. Therefore, it can be used as an animal model for studying intestinal immune function. This invention seeks to protect the use of the zebrafish strain as an animal model for studying intestinal immune function.

[0023] The zebrafish strain lacks the chitinous membrane, radial intestinal septum, and related barriers, which affects intestinal epithelial homeostasis, accelerates intestinal epithelial damage, renewal, and aging, and can induce age-dependent intestinal atrophy. Therefore, it can be used as an animal model for studying intestinal epithelial cell renewal and aging. This invention seeks protection for the use of the zebrafish strain as an animal model for studying intestinal epithelial cell renewal and aging.

[0024] The zebrafish strain lacks a chitinous membrane, which not only causes the loss of radial intestinal septa and affects intestinal epithelial homeostasis, but also results in the loss of the ability to restrict and compress ingested food, slowing down the movement of ingested food in the intestine and significantly affecting intestinal digestion and absorption, leading to slow growth. Therefore, it can be used as an animal model for studying intestinal digestion and absorption. This invention seeks protection for the use of the zebrafish strain as an animal model for studying intestinal digestion and absorption.

[0025] The zebrafish strain described herein lacks a stomach and chitin membrane but retains normal levels of collagen expression. Therefore, the intestine of this zebrafish strain is structurally closer to the small intestine structure of humans and other mammals, making it an ideal model for studying intestinal diseases, including but not limited to intestinal autoimmune diseases (such as allergies), infectious diseases, and cancer. This invention seeks to protect the use of the zebrafish strain as an animal model for studying small intestinal diseases.

[0026] All of the above applications are within the protection scope of this invention.

[0027] Preferably, the chitin membrane function includes the functions of the intestinal chitin membrane in the intestinal mucosal immunity, nutrient absorption, growth and development of farmed fish.

[0028] An sgRNA for constructing the zebrafish strain, the nucleotide sequence of which is shown in SEQ ID NO: 18.

[0029] A target site for constructing the zebrafish strain, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0030] A method for constructing the zebrafish strain, comprising knocking out the chs1 gene using CRISPR / Cas9 technology and the sgRNA.

[0031] Preferably, the method includes the following steps:

[0032] S1. Using the target site as the target, a DNA fragment with the structure T7 promoter-target site sequence-sgRNA scaffold is amplified using primer pairs with nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 13, and the sgRNA is obtained by in vitro transcription; the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 15.

[0033] S2. Cas9 mRNA was obtained through in vitro transcription;

[0034] S3. Mix the sgRNA obtained in step S1 with the Cas9 mRNA obtained in step S2, and microinject the mixture into zebrafish fertilized eggs at the one-cell stage.

[0035] S4. After the fish have been cultured to sexual maturity, F0 generation chimeras with the chs1 gene deletion type are selected. The F0 generation chimeras are crossed with wild-type zebrafish to obtain F1 generation heterozygous zebrafish. The genotype of the heterozygous zebrafish is identified. The F1 generation heterozygous zebrafish with the same genotype are self-crossed to obtain F2 generation zebrafish. Homozygotes are identified, and the result is obtained.

[0036] Preferably, in step S2, the Cas9 mRNA is Cas9-β-goblin mRNA or Cas9-nanos mRNA.

[0037] Preferably, in step S3, the final concentration of sgRNA in the mixture is 150 ng / μl.

[0038] Preferably, in step S3, the final concentration of Cas9 mRNA in the mixture is 250 ng / μl.

[0039] Preferably, in step S4, F0 generation chimeras with chs1 gene deletion are screened using primers with nucleotide sequences as shown in SEQ ID NO: 6 and SEQ ID NO: 7.

[0040] Preferably, to prevent adverse effects such as low fertility and deformities caused by multiple generations of self-pollination, some homozygous zebrafish are selected for test crosses with wild-type zebrafish to obtain heterozygous zebrafish with different genetic backgrounds.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] This invention utilizes the chs1 gene, designs specific target sites, successfully knocks out the chs1 gene in zebrafish and obtains effective mutations, thereby successfully constructing a zebrafish strain completely lacking the intestinal chitin membrane. The constructed zebrafish strain lacking the intestinal chitin membrane can be used for intestinal chitin membrane research, intestinal digestion and absorption research, intestinal flora research, intestinal epithelial renewal and aging research, intestinal immune function research, and can also be used to study the damage mechanisms of harmful substances, including but not limited to pathogenic microorganisms, microplastics and heavy metals, to the intestine. It can also serve as an ideal small intestinal model for studying small intestinal diseases in mammals. Attached Figure Description

[0043] Figure 1 This is a schematic diagram of the location of the chs1 gene on the genome and the sgS1Ⅱ target site on the chs1 gene in Example 1 of the present invention. The boxes represent exons, the broken lines represent introns, the red boxes represent the gene sequences corresponding to the key synthase domain chitin_synth_2, the sequences shown in the figure are the sequences of sgS1Ⅱ on the genome, the blue represents the target site, and the orange represents the PAM (pre-spacer adjacent motif) site.

[0044] Figure 2 This is a plasmid map of the 19T-SCFgR vector in Example 2 of the present invention, and a flowchart of PCR amplification and in vitro transcription using the 19T-SCFgR vector.

[0045] Figure 3 This is an agarose gel electrophoresis image of sgRNA in Example 2 of the present invention, where lane 1 represents sgS1Ⅰ-sgRNA; lane 2 represents sgS1Ⅱ-sgRNA; and lane 3 represents sgS1Ⅲ-sgRNA.

[0046] Figure 4 The image shows an agarose gel electrophoresis diagram of Cas9-β-globulin mRNA and Cas9-nanos mRNA in Example 3 of this invention. Lane 1 represents the Wide Range DNA Marker (100-6000bp), lane 2 represents Cas9-β-goblin mRNA, lane 3 represents the Wide Range DNA Marker (100-6000bp), and lane 4 represents Cas9-nanos mRNA.

[0047] Figure 5 This is an electrophoresis image of the PCR products in Example 4 of the present invention on a 1% agarose gel, where lanes 1 and 3 represent the DS2000 marker, lane 2 represents the sgS1Ⅰ target site, lane 4 represents the sgS1Ⅱ target site, and lane 5 represents the sgS1Ⅲ target site.

[0048] Figure 6 This is a comparison of the sequencing peak diagrams of the PCR products of mutant and wild-type zebrafish in Example 4 of the present invention.

[0049] Figure 7 This is a sequencing peak diagram of genomic target sites in the F0 generation embryo sample of Example 5 of the present invention. The orange underline represents the PAM site, and the blue underline represents the sgRNA sequence.

[0050] Figure 8 This is a sequencing peak diagram of the F0 generation adult fish genome target sites in Example 5 of the present invention, where numbers 1 to 10 represent 10 samples.

[0051] Figure 9 The results of F1 generation sequencing in Example 5 of this invention are shown. The green sequence is the sgS1Ⅱ target site sequence in wild type. null indicates no mutation. The number of deleted (-) or inserted (+) bases for each type of mutation is marked in parentheses. The percentage is the proportion of the number of mutations of this type detected.

[0052] Figure 10 The images show the staining results of the chitin membrane in the intestines of wild-type and mutant larvae in Example 5 of this invention. The bright field image shows the morphology of the larvae under bright field conditions, and the red fluorescence image shows the fluorescence pattern stained with SNAP-CBD fusion protein. The tubular red fluorescence shown is the chitin membrane signal located in the larvae's intestine.

[0053] Figure 11 The values ​​represent the expression levels of representative differentially expressed genes in Example 6 of this invention, where A represents digestion-related genes, B represents cell cycle-related genes, and C represents immune-related genes. Each column represents an individual, and the color in each cell corresponds to the expression level of the gene in that column in the sample. The redder the color, the higher the expression level, and the bluer the color, the lower the expression level.

[0054] Figure 12 The body size of the zebrafish in the mutant and wild types in Example 6 of this invention is the closest to the average body length of the group to which the fish belongs. One male and one female fish are taken from each type.

[0055] Figure 13 The above are the staining results of the gastric blister portions of wild-type and mutant zebrafish in Example 6 of this invention. The blue color is Alcian blue staining dye, which shows the distribution of acidic mucopolysaccharides; the red color is nuclear solid red dye, which shows the location of epithelial cells.

[0056] Figure 14 This is the experimental result of the zebrafish survival rate within 10 days after stimulation with mixed Vibrio bacteria in Example 6 of the present invention.

[0057] Figure 15The figure shows the differences in microbial diversity in Example 7 of this invention. The Ace index, Chao1 index, and Faith_pd index are commonly used values ​​for calculating and measuring species richness and evenness.

[0058] Figure 16 The image shows the trajectory of 6μm polystyrene microbeads in wild-type and mutant larvae in Example 8 of this invention. The white arrows indicate the locations of the microbeads embedded in the intestinal villi.

[0059] Figure 17 The images show the staining results of tissue sections of mucus from the intestines of adult zebrafish and the small intestine of mice in Example 9 of this invention. The blue color represents Alcian blue dye, indicating the location of the mucus; the red color represents nuclear solid red dye, indicating the location of the epithelial cells. Detailed Implementation

[0060] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0061] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0062] Example 1: CRISPR / Cas9 gene knockout target site and amplification primer design

[0063] 1. Method

[0064] The gene sequence number (ENSDARG00000068515) of the zebrafish chs1 gene was searched in the Ensembl database (http: / / asia.ensembl.org / index.html). CRISPR / Cas9 target sites targeting the chs1 gene were designed using the CRISPRscan online design tool (www.crisprscan.org / ). The nucleotide sequence of the target site, named sgS1Ⅱ, is GCGGAAGGCGATCTGGAGCACGG (SEQ ID NO: 1). The software score for sgS1Ⅱ is 89.

[0065] The other two target sites for the chs1 gene with higher scores were named sgS1Ⅰ and sgS1Ⅲ, and their corresponding nucleotide sequences are shown in Table 1. The software score for sgS1Ⅰ was 91, and the software score for sgS1Ⅲ was 88. The nucleotide sequence of target site sgS1Ⅰ is GTTGGTGTAGGCGTCCGAGGCGG (SEQ ID NO: 2); the nucleotide sequence of target site sgS1Ⅲ is GAGGACGCTGGTGGCGCCGCAGG (SEQ ID NO: 3).

[0066] Target-specific primers are located approximately 200 bp upstream and downstream of the target site in the genome, preferably within intron regions, for subsequent PCR amplification and target site sequencing to identify the genotype.

[0067] Sequences were amplified from wild-type zebrafish genomic DNA using specific primers to determine the correctness of sequences near the target site.

[0068] The specific primers for the target sites sgS1Ⅰ, sgS1Ⅱ, and sgS1Ⅲ are:

[0069] sgS1ⅠF: GAGGTTTAGTGAAGGCGGCTCA (SEQ ID NO: 4),

[0070] sgS1ⅠR: CAGCAGGTCCAGGGTGTTGG (SEQ ID NO: 5);

[0071] sgS1ⅡF:GGGCAGTTCTTTGTATTATCTT (SEQ ID NO: 6),

[0072] sgS1ⅡR:GGTTCTCCCACCAGTTCAGG (SEQ ID NO: 7);

[0073] sgS1ⅢF: ATGCTGACTGATTTAAGAGC (SEQ ID NO: 8),

[0074] sgS1IIIR: TCTGACTGCTGCTTTATTTTA (SEQ ID NO: 9).

[0075] Specific primers for target sites sgS1Ⅰ, sgS1Ⅱ, and sgS1Ⅲ were used to amplify and sequence the target sites sgS1Ⅰ, sgS1Ⅱ, and sgS1Ⅲ, respectively. The sequencing results were consistent with the sequences provided in the Ensembl database, indicating that the target sites were correctly identified.

[0076] The diagram showing the location of the chs1 gene in the genome and the target site of sgS1II on the chs1 gene is shown below. Figure 1 As shown, the boxes represent exons, the broken lines represent introns, the red boxes represent the gene sequences corresponding to the key synthase domain chitin_synth_2, the sequences shown in the figure are the sgS1Ⅱ sequences on the genome, the blue ones represent target sites, and the orange ones represent PAM (pre-spacer adjacent motif) sites.

[0077] Example 2: Synthesis of sgRNA

[0078] 1. Specific upstream primers containing the target sites sgS1Ⅰ, sgS1Ⅱ, and sgS1Ⅲ of Example 1 were designed, along with universal downstream primers containing specific sgRNA scaffolds.

[0079] Upstream primer (sgS1Ⅰ target site):

[0080] 5'-taatacgactcactataGGTGGTGTAGGCGTCCGAGGgttttagagctagaa-3' (SEQ ID NO: 10)

[0081] Upstream primer (sgS1Ⅱ target site):

[0082] 5'-taatacgactcactataGGGGAAGGCGATCTGGAGCAgttttagagctagaa-3' (SEQ ID NO: 11)

[0083] Upstream primer (sgS1Ⅲ target site):

[0084] 5'-taatacgactcactataGGGGACGCTGGTGGCGCCGCgttttagagctagaa-3' (SEQ ID NO: 12)

[0085] Downstream universal primers:

[0086] 5'-AGCACCGACTCGGTGCCACT-3' (SEQ ID NO: 13)

[0087] Using the indicated upstream and downstream primers, a DNA fragment with the structure T7 promoter-target site sequence-sgRNA scaffold was obtained from the 19T-SCFgR vector containing the sgRNA scaffold structural sequence by PCR amplification.

[0088] The DNA fragment sequence corresponding to the sgS1Ⅰ target site is as follows:

[0089] taatacgactcactataGGTGGTGTAGGCGTCCGAGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctt (SEQ ID NO: 14),

[0090] The DNA fragment sequence corresponding to the sgS1Ⅱ target site is as follows:

[0091] taatacgactcactataGGGGAAGGCGATCTGGAGCAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctt (SEQ ID NO: 15),

[0092] The DNA fragment sequence corresponding to the sgS1Ⅲ target site is as follows:

[0093] taatacgactcactataGGGGACGCTGGTGGCGCCGCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctt (SEQ ID NO: 16).

[0094] After purifying and recovering the DNA fragments, sgS1Ⅰ-sgRNA, sgS1Ⅱ-sgRNA, and sgS1Ⅲ-sgRNA targeting the chs1 gene were obtained using an in vitro transcription kit (Epicentre Biotechnologies, AmpliScribe T7-flash transcription kits), and then cryopreserved.

[0095] The nucleotide sequence of sgS1Ⅰ-sgRNA is as follows:

[0096] GGTGGTGTAGGCGTCCGAGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctt (SEQ ID NO: 17);

[0097] The nucleotide sequence of sgS1Ⅱ-sgRNA is as follows:

[0098] GGGGAAGGCGATCTGGAGCAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctt (SEQ ID NO: 18);

[0099] The nucleotide sequence of sgS1Ⅲ-sgRNA is as follows: GGGGACGCTGGTGGCGCCGCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctt (SEQ ID NO: 19).

[0100] The plasmid map of the 19T-SCFgR vector and the flowchart of PCR amplification and in vitro transcription using the 19T-SCFgR vector are shown below. Figure 2 As shown.

[0101] Three sgRNAs synthesized in vitro—sgS1Ⅰ-sgRNA, sgS1Ⅱ-sgRNA, and sgS1Ⅲ-sgRNA—were detected by electrophoresis on a 1% agarose gel. The agarose gel electrophoresis image of the sgRNAs is shown below. Figure 3 As shown, lane 1 represents sgS1Ⅰ-sgRNA; lane 2 represents sgS1Ⅱ-sgRNA; and lane 3 represents sgS1Ⅲ-sgRNA.

[0102] Figure 3 The results showed that the lengths of the three sgRNAs were all between 100 and 250 bp, and the bands were single and non-diffuse, indicating that they had not been degraded and could be used.

[0103] Example 3: Synthesis of Cas9-β-goblin mRNA and Cas9-nanos mRNA

[0104] Plasmids pT3TS-nCas9n and pCS2-nCas9n-nanos 3'UTR were linearized using XbaI and NotI restriction endonucleases, respectively. After purification with magnetic beads, Cas9-β-goblin mRNA and Cas9-nanos mRNA were synthesized using an in vitro transcription kit (Invitrogen, mMESSAGE mMACHINE transcription kit). The two Cas9 mRNAs synthesized in vitro (Cas9-β-goblin mRNA and Cas9-nanos mRNA) were detected by 1% agarose gel electrophoresis. The agarose gel electrophoresis images of Cas9-β-globulin mRNA and Cas9-nanos mRNA are shown below. Figure 4 As shown, lane 1 represents the Wide Range DNA Marker (100–6000 bp), lane 2 represents Cas9-β-goblin mRNA; lane 3 represents the Wide Range DNA Marker (100–6000 bp), and lane 4 represents Cas9-nanos mRNA.

[0105] Figure 4 The results showed that the total length of Cas9-β-globulin mRNA and Cas9-nanos mRNA was 3000-4000 bp, which was correct in length and the mRNA was intact and usable.

[0106] Example 4: sgRNA Activity Detection

[0107] The Cas9-β-goblin mRNA synthesized in Example 3 was mixed separately with the sgRNAs (sgS1Ⅰ-sgRNA, sgS1Ⅱ-sgRNA, and sgS1Ⅲ-sgRNA) synthesized in Example 2. Phenol red dye was added as a non-toxic indicator. The final concentration of Cas9-β-goblin mRNA in the mixture was 250 ng / μl, and the final concentration of sgRNA was 150 ng / μl. The resulting mixture was microinjected into zebrafish fertilized eggs (embryos) at the one-cell stage (single-cell stage). After injecting a mixture approximately one-fifth the diameter of the embryo, the injection was stopped. The injected zebrafish embryos were transferred to a 28.5℃ constant temperature incubator for culture, with a light cycle of 14 hours of daylight and 10 hours of darkness.

[0108] Five days after injection, once the injected embryos had developed to the larval stage, genomic DNA was extracted. Five to ten larvae were grouped together, and 100 μl of 100 mM NaOH was added. The mixture was heated at 95°C for 15 minutes, followed by the addition of 30 μl of 1 M Tris-HCl. After vortexing, genomic DNA was obtained. The group injected with the mixture served as the mutation experimental group, while wild-type zebrafish not injected with the mixture were cultured and had their genomic DNA extracted using the same methods, serving as the wild-type control group.

[0109] Using the extracted genomic DNA as a template, PCR amplification was performed using the specific primers for the target site in Example 1 (amplification conditions: 95℃, 3 min; (95℃, 15 s; 60℃, 15 s; 72℃, 35 s), 35 cycles; 72℃, 10 min). A portion of the PCR product was examined on a 1% agarose gel to confirm the presence of bands. The remaining PCR products were then sent to a sequencing company (Sangon Biotech (Shanghai) Co., Ltd.) for sequencing. The peak pattern of the sequencing results was used to determine whether the sgRNA could produce an effective mutation.

[0110] Electrophoresis image of PCR products on a 1% agarose gel is shown below. Figure 5 As shown, lanes 1 and 3 represent the DS2000 marker, lane 2 represents the sgS1Ⅰ target site, lane 4 represents the sgS1Ⅱ target site, and lane 5 represents the sgS1Ⅲ target site.

[0111] Figure 5The results showed that the PCR product was around 500bp, which was consistent with expectations.

[0112] The comparison results of sequencing peak diagrams of PCR products from mutant and wild-type zebrafish are as follows: Figure 6 As shown.

[0113] from Figure 6 As can be seen from the wild-type peak diagram of sgS1Ⅰ, the target site sgS1Ⅰ cannot amplify a single band, meaning it cannot be specifically amplified. Therefore, it cannot be used to conduct knockout experiments, indicating that the target site sgS1Ⅰ is not suitable for knocking out the zebrafish chs1 gene. Consequently, knockout and downstream mutation verification experiments cannot be performed.

[0114] contrast Figure 6 The peak diagrams of sgS1Ⅱ and sgS1Ⅲ show that the target sites sgS1Ⅱ and sgS1Ⅲ can amplify a single band, but the peak diagram of the mutant sgS1Ⅲ target site differs from that of the wild type. Figure 1 Similarly, there was no "overlapping peaks" phenomenon, indicating that sgS1Ⅱ-sgRNA can produce effective mutant offspring; while sgS1Ⅲ-sgRNA cannot obtain effective mutations, and none of the knocked-out individuals have mutations.

[0115] Example 5: Construction and preservation of zebrafish strains with chs1 gene knockout

[0116] 1. Construction of F0 generation chimeras from zebrafish with chs1 gene knockout

[0117] The Cas9-nanos mRNA obtained in Example 3 with a final concentration of 250 ng / μl was mixed with the sgS1Ⅱ-sgRNA obtained in Example 2 with a final concentration of 150 ng / μl and phenol red dye. The mixture was then microinjected into zebrafish fertilized eggs (embryos) at the one-cell stage (single-cell stage). The embryos were then cultured in a constant temperature incubator at 28°C for about 3 days. Five embryos were taken as a group, and 1 to 3 groups were taken. Genomic DNA was extracted using the alkaline lysis method in Example 4. PCR amplification was performed using the target site-specific primers in Example 1. The amplified sequences were sent to a sequencing company for sequencing to confirm whether the knockout of the embryos in this batch was successful.

[0118] The sequencing peak diagram of genomic target sites in F0 generation embryo samples is shown below. Figure 7 As shown, the orange underline represents the PAM site, and the blue underline represents the sgRNA sequence. Figure 7 The results showed that the "overlapping peaks" phenomenon appeared starting from the target site sequence, indicating that the mutation was successfully generated and the batch of embryos was successfully knocked out.

[0119] Some embryos were cultured to sexual maturity and then genotyped. Mature zebrafish genome templates were extracted from a portion of the caudal fin using a kit (Beyotime Biotechnology, Animal Genomic DNA Rapid Extraction Kit (for PCR analysis)). Ten samples were selected as representatives, and the target site sequences were amplified and sequenced according to the method in Example 4 to detect the presence of mutations.

[0120] The sequencing peak diagram of F0 generation adult fish genome target sites is shown below. Figure 8 As shown, numbers 1 to 10 represent 10 samples.

[0121] Figure 8 The results showed that the target site sequences amplified from some individuals exhibited a "peak overlap" phenomenon, indicating that some individuals successfully generated mutations and obtained F0 generation chimeras for further experiments.

[0122] 2. Construction of chs1 gene knockout F1 generation heterozygotes

[0123] The selected F0 generation chimeras were hybridized with wild-type zebrafish to obtain F1 generation embryos. Genomic DNA was extracted from some of the embryos, and the target site sequence was amplified according to the method in Example 4. The embryos were then sent to a sequencing company (Sangon Biotech (Shanghai) Co., Ltd.) for sequencing to confirm whether the mutation was successfully inherited.

[0124] After the remaining embryos were cultured to adulthood, the target site sequence was amplified by PCR according to the method in Example 4. After recovering the sequence fragment, it was ligated into… The bacteria were placed on a zero-cloning vector and transformed with E. coli. Single colonies were picked and amplified by colony PCR. Single colonies with the target band were randomly selected and sent to a sequencing company (Sangon Biotech (Shanghai) Co., Ltd.) for sequencing.

[0125] F1 generation sequencing results as follows Figure 9 As shown, the green sequence represents the sgS1Ⅱ target site sequence in the wild type, null indicates no mutation, and the number of deleted (-) or inserted (+) bases for each mutation is indicated in parentheses; the percentage represents the proportion of that type of mutation in the detected number. Eight different mutation types were found in the mutated alleles of the F1 heterozygotes.

[0126] This process separates the alleles of F1 heterozygotes, obtains the specific mutation sequence of each F1 individual, and selects individuals with consistent mutation types as F1 heterozygotes for further culture.

[0127] 3. Construction of chs1 gene knockout F2 homozygotes

[0128] Heterozygous F1 individuals with consistent mutant types were self-crossed to obtain F2 individuals. According to Mendel's laws, one-quarter of these F2 individuals were homozygous for the mutant. After all embryos reached adulthood, caudal fins were harvested from each individual, and zebrafish genotypes were analyzed. Individuals exhibiting overlapping peaks during sequencing were identified as heterozygous mutants. Sequences from individuals without overlapping peaks were compared with those from the wild-type control group. Sequences differing from the wild-type control group were identified as homozygous mutants. Homozygous mutant F2 individuals were preserved for experimental use. Simultaneously, calcofluor white dye and SNAP-CBD (SNAP Chitin-binding domain) fusion protein were used to specifically stain the chitin membrane to confirm whether the chitin membrane was missing in the larval intestine.

[0129] The results of chitin membrane staining in the intestines of wild-type and mutant larvae are as follows: Figure 10 As shown, the bright field represents the morphology of the larvae under bright field conditions, the red fluorescence is the fluorescence image stained with SNAP-CBD fusion protein, and the tubular red fluorescence is the chitin membrane signal located in the larvae's intestine.

[0130] Figure 10 The results showed that red fluorescence appeared in the intestinal staining of wild-type larvae, indicating the presence of a chitin membrane in the intestines of wild-type larvae; while no red fluorescence was observed in the intestinal staining of mutant larvae, i.e., no chitin membrane signal was found, indicating that a chitin membrane was not present in the intestines of mutant larvae.

[0131] 4. Preservation of gene knockout fish strains

[0132] To reduce developmental abnormalities and decreased fertility caused by repeated self-pollination, it is necessary to periodically cross chs1 homozygous mutant fish lines with wild-type zebrafish to obtain heterozygous individuals, and then obtain new chs1 homozygous mutants through self-pollination.

[0133] Example 6: Detection of intestinal physiology and gene expression in wild-type zebrafish and F2 generation mutant zebrafish from Example 5.

[0134] 1. Transcriptome analysis was performed on wild-type zebrafish and the F2 generation mutant zebrafish of Example 5.

[0135] Strictly control the rearing conditions of mutant and wild-type zebrafish produced on the same day to ensure consistent growth conditions, euthanize both after they have grown for more than three months and reached sexual maturity using 200 mg / L tricaine (MS-222). After collecting intestinal samples, preserve them in RNAlater animal tissue RNA stabilization preservation solution (Thermo) under low temperature cryopreservation and hand them over to Biomarker for transcriptome sequencing.

[0136] After obtaining the sequencing results, the laboratory assembled and annotated the data, selecting genes that differed between the mutant and wild-type strains. The expression levels of representative differentially expressed genes are shown below. Figure 11 As shown, A represents digestion-related genes, B represents cell cycle-related genes, and C represents immune-related genes. Each column represents an individual, and the color in each cell corresponds to the expression level of the gene in that column in that sample. The redder the color, the higher the expression level, and the bluer the color, the lower the expression level.

[0137] Figure 11 Figure A shows that the expression levels of digestion-related genes in the gut of mutant zebrafish are generally downregulated compared to those in wild-type zebrafish, indicating that digestion-related physiological activities in the gut of mutant zebrafish are suppressed.

[0138] Figure 11 The results showed that the expression patterns of genes regulating the cell cycle were different in the wild-type and mutant gut, with some genes being expressed higher and others lower; that is, there were differences in the regulation of intestinal cell renewal and migration between the two types of zebrafish.

[0139] Figure 11 The results showed that the expression levels of some inflammatory factors were upregulated in the gut lacking the chitin membrane, while the expression levels of other immune factors were downregulated, indicating that the immune system has a defensive response in the mutant gut and is in a chronic inflammatory state.

[0140] 2. Body size detection of wild-type zebrafish and F2 generation mutant zebrafish of Example 5

[0141] Mutant and wild-type zebrafish of the same age and under the same rearing conditions were rapidly anesthetized with 100 mg / L tricaine (MS-222), and their body length and weight were measured and photographed. They were then quickly returned to fresh water without anesthesia and allowed to recover. Representative body shapes of the mutant and wild-type zebrafish are shown below. Figure 12 As shown, its body length is closest to the average body length of the group to which the fish belongs. One male and one female fish were selected from each type.

[0142] Figure 12 The results showed that, under the same rearing conditions, wild-type individuals of the same age were larger and better developed than the mutants, thus confirming... Figure 11 As shown in Figure A, the loss of digestion in the mutant is attenuated.

[0143] 3. Detection of differences in cell renewal and senescence in wild-type zebrafish and F2 generation mutant zebrafish of Example 5

[0144] Adult zebrafish aged six months or older, with long-term rearing and abdominal depressions, were euthanized with 200 mg / L tricaine (MS-222). The visceral mass was removed and fixed overnight at 4°C using Carnoy's solution. The wax was then embedded in a sequence of 70% ethanol, 90% ethanol, 95% ethanol, anhydrous ethanol, TO clearing agent, and paraffin. The embedded wax block was cut into 6 nm wax slices, which were then attached to glass slides. The wax was then dewaxed in reverse gradients using TO clearing agent, anhydrous ethanol, 95% ethanol, 90% ethanol, and 70% ethanol. The intestinal mucus layer was stained using an Abcam staining kit, and the changes in the intestinal surface mucus layer were observed under a stereomicroscope.

[0145] Staining results of gastric vesicle portions of wild-type and mutant zebrafish are as follows: Figure 13 As shown, blue is Alcian blue staining dye, which shows the distribution of acidic mucopolysaccharides; red is nuclear solid red dye, which shows the location of epithelial cells.

[0146] Figure 13 The study showed that zebrafish intestines are prone to atrophy and other abnormal phenomena after the loss of chitinous membrane, indicating that there are abnormalities in the renewal and metabolism of their intestinal cells, and that they atrophy and age faster.

[0147] 4. Detection of differences in immunity between wild-type zebrafish and the F2 generation mutant zebrafish of Example 5

[0148] (1) Preparation of mixed Vibrio bacterial culture

[0149] Vibrio anguillarum and Vibrio parahaemolyticus were cultured overnight in LB20 liquid medium (LB liquid medium with 2% sodium chloride by mass). To prepare dead bacteria, formaldehyde was added to a final concentration of 4%, and the culture was shaken for 24 hours; this step was omitted to prepare live bacteria. The cultures were centrifuged at 4°C, the supernatant was discarded, and the cultures were resuspended in PBS, then centrifuged again, washing the cells two to three times. Finally, the cultures were resuspended in a very small volume of PBS, and the OD was adjusted using a spectrophotometer. 600 This resulted in an OD value that was 100 times higher than that of the high-concentration bacterial solution. 600 The OD value of the low-concentration bacterial solution is 1.0A. 600 The concentration is 1.0A. Mix the two types of Vibrio bacteria at the same concentration in a 1:1 volume ratio and store at 4°C for later use.

[0150] (2) Immunological testing

[0151] Wild-type and mutant zebrafish of the same age and under the same rearing conditions were rapidly anesthetized with 100 mg / L MS-222, followed by intraperitoneal injection using an insulin syringe, or oral gavage using an insulin syringe with a thin tubing attached to the tip. Each zebrafish was injected or gavaged with 20 μl of a mixed Vibrio bacterial solution, using a low concentration (OD200) of Vibrio. 600 =1.0A) and high concentration (OD)600 Two bacterial concentrations (100 times that of 1.0A) were used, and two stimulation methods were employed: intraperitoneal injection and oral gavage. Two different survival states of Vibrio bacteria—dead and live—treated with formaldehyde were used to stimulate both wild-type and mutant strains. After treatment, the strains were placed in clean water and observed for 2 hours. The water was then changed, and the strains were reared normally for 10 consecutive days, with the number of surviving strains recorded.

[0152] The experimental results of zebrafish survival rate within 10 days after mixed Vibrio stimulation are as follows: Figure 14 As shown,

[0153] Figure 14 The results showed that intraperitoneal injection of dead bacteria had varying degrees of negative effects on wild-type cells depending on the concentration. However, intraperitoneal injection of live bacteria, regardless of concentration, led to infection in wild-type cells because intraperitoneal injection is an invasive stimulation method. When using gavage, a non-invasive stimulation method, high concentrations of live bacteria had no effect on either wild-type or mutant cells, demonstrating that the mutant gut maintains a certain level of immune defense after chitinous membrane formation and can mount an immune response to some extent.

[0154] Example 7: Gut microbiome sequencing of wild-type zebrafish and F2 generation mutant zebrafish from Example 5.

[0155] Strictly control the breeding conditions of mutant and wild-type offspring produced on the same day to ensure that their growth conditions are consistent. After both have grown for more than three months and reached sexual maturity, they are euthanized using 200 mg / L tricaine (MS-222). After collecting intestinal samples, they are frozen in liquid nitrogen and then handed over to Biomarker Biotechnology for microbiome sequencing.

[0156] After obtaining the sequencing results, the laboratory annotates them, selecting microorganisms that differ from the wild-type in the mutant form, and comparing their biodiversity, etc. Differences in microbial biodiversity include... Figure 15 As shown in the figure, the Ace index, Chao1 index, and Faith_pd index are all commonly used values ​​for calculating and measuring species richness and evenness.

[0157] Figure 15 The results showed that the mutant gut microbiota had lower diversity than the wild-type microbiota, indicating that the presence or absence of the chitin membrane affects gut microbial homeostasis.

[0158] Example 8: Study on the activity of microplastics in the intestines of wild-type zebrafish and F2 generation mutant zebrafish of Example 5.

[0159] A small number of mutant and wild-type larvae, aged 6-7 days, were cultured in small volumes in 11cm cell culture dishes. An appropriate amount of 6μm polystyrene microspheres was added to mimic microplastic particles. After a period of time, the movement trajectories of the ingested microspheres in the two types of larvae were observed. The trajectories of the 6μm polystyrene microspheres in wild-type and mutant larvae are shown below. Figure 16 As shown, the white arrows indicate the locations of the microbeads embedded in the intestinal villi.

[0160] Figure 16 The results showed that in the wild-type gut, microbeads were encapsulated in tubular form by chitin and confined within the intestinal lumen; in the mutant gut, the lack of chitin membrane to indicate the range of movement of microbeads caused them to move freely within the intestinal lumen and even become embedded in the villi.

[0161] Example 9: Morphology of the intestinal mucus layer in wild-type zebrafish and F2 generation mutant zebrafish from Example 5.

[0162] Three-month-old zebrafish and adult mice were used to smear the intestines of the adult fish using the method described in Example 6, Section 3.

[0163] The staining results of tissue sections for mucus in the intestines of adult zebrafish and the small intestine of mice are as follows: Figure 17 As shown, the blue dye is Alcian blue, indicating the location of the mucus; the red dye is Nucleotide red, indicating the location of the epithelial cells.

[0164] Figure 17 The results showed that zebrafish intestinal villi were shorter and rounder than those of mouse small intestine, but all were finger-shaped and contained goblet cells for storing mucus. The distribution of mucus was sparse on the surface of both wild-type and mutant zebrafish intestines, which is very similar to the sparse mucus distribution on the surface of mouse small intestine.

[0165] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for constructing a stable, heritable zebrafish strain with a complete absence of the intestinal chitin membrane, characterized in that, The chs1 gene was knocked out using CRISPR / Cas9 technology and sgRNA; the nucleotide sequence of the sgRNA is shown in SEQ ID NO:

18. The method includes the following steps: S1. Using the target site with the nucleotide sequence shown in SEQ ID NO: 1 as the target site, a DNA fragment with the structure T7 promoter-target site sequence-sgRNA scaffold is amplified using primer pairs with the nucleotide sequences shown in SEQ ID NO: 11 and SEQ ID NO: 13, and sgRNA is obtained by in vitro transcription; the nucleotide sequence of the DNA fragment is shown in SEQ ID NO:

15. S2. Cas9 mRNA was obtained through in vitro transcription; S3. Mix the sgRNA obtained in step S1 with the Cas9 mRNA obtained in step S2, and microinject the mixture into zebrafish fertilized eggs at the one-cell stage. S4. After the fish have been cultured to sexual maturity, F0 generation chimeras with the chs1 gene deletion type are selected. The F0 generation chimeras are crossed with wild-type zebrafish to obtain F1 generation heterozygous zebrafish. The genotype of the heterozygous zebrafish is identified. The F1 generation heterozygous zebrafish with the same genotype are self-crossed to obtain F2 generation zebrafish. Homozygotes are identified, and the result is obtained.

2. The application of the zebrafish strain with a stable genetic disorder and complete absence of the intestinal chitin membrane obtained by the method of claim 1 as an animal model for intestinal atrophy.

Images