Use of lncrna snhg26 in preparation of tumor prevention and treatment drugs
By using lncRNA SNHG26 as a target and interfering with its expression using siRNA technology, diagnostic reagents and drugs for the prevention and treatment of glioma were prepared, overcoming the limitations of existing treatment methods and achieving effective inhibition of glioma cells.
Patent Information
- Application Number
- CN202310337771.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2043-03-31
AI Technical Summary
Existing treatments for gliomas, such as surgery, radiotherapy, and chemotherapy, have limitations, especially the limited indications for surgery and the severe radiation damage, as well as the lack of effective new molecular therapies.
Using lncRNA SNHG26 as the target, we interfered with SNHG26 expression through siRNA technology to prepare diagnostic reagents and drugs for the prevention and treatment of glioma. By utilizing its characteristic of being significantly elevated in glioma, we inhibited cell proliferation and migration.
It significantly inhibits the proliferation and migration of glioma cells, providing a new strategy for tumor prevention and treatment, and enhancing the therapeutic effect of glioma.
Smart Images

Figure CN116334226B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically involving the application of lncRNA SNHG26 in the preparation of tumor prevention and treatment drugs. Background Technology
[0002] Gliomas are primary intracranial tumors resulting from cancerous changes in glial cells of the brain and spinal cord. They are the most common type of primary malignant tumor of the central nervous system. Currently, the standard treatment for gliomas involves a combination of surgery, radiotherapy, and chemotherapy. However, not all glioma patients are suitable for surgical resection. Treatment strategies must be determined based on the tumor's location, size, the important structures involved, and prognosis. Furthermore, postoperative whole-brain radiotherapy is often performed, resulting in significant radiation damage and numerous complications. Therefore, finding new treatment strategies is crucial. Currently, there is increasing interest in researching novel molecular therapies for gliomas, with gene therapy and immunotherapy showing great promise in early clinical trials.
[0003] With the rapid development of functional genomics, long noncoding RNAs (lncRNAs), as important members of the noncoding RNA (ncRNA) family, have received increasing attention. LncRNAs are a subset of noncoding RNA transcripts exceeding 200 nucleotides (nt). Most lncRNAs are transcribed by RNA polymerase II and contain a 5' methylated cap and a 3' polyadenylated (polyA) tail. LncRNAs regulate gene expression primarily through epigenetic, transcriptional, and posttranscriptional regulation, thus playing a crucial role in various biological processes and being closely related to the occurrence and development of human diseases. SNHG26 (small nucleolar RNA host gene 26, [Homosapiens (human)], Gene ID: 109729180) is one such lncRNA molecule. To date, there have been no reports on the role of SNHG26 in glioma. Summary of the Invention
[0004] The present invention provides new uses for lncRNA SNHG26, particularly for its use in the preparation of tumor diagnostic reagents and preventive drugs.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] Application of lncRNA SNHG26 in the preparation of tumor diagnostic reagents. Specifically, the tumor is glioma.
[0007] Application of lncRNA SNHG26 in screening drugs for tumor prevention and treatment. Specifically, the tumor is glioma.
[0008] Application of lncRNA SNHG26 inhibitors in the preparation of tumor prevention and treatment drugs. Specifically, the tumor is glioma.
[0009] Furthermore, the lncRNA SNHG26 inhibitor is one or more of the following: compound, protein, polypeptide, polysaccharide, glycoprotein, glycopeptide, and nucleic acid.
[0010] Furthermore, the nucleic acid is siRNA, and the sequence of the siRNA is as follows:
[0011] Justice Chain: GGGAGGUUAUGCCACCAUTT(seq-1)
[0012] Antonym chain: AUGGUGGCAUAAUCCUCCCTT(seq-2).
[0013] The nucleotide sequence of SNHG26 is as follows:
[0014] Homo sapiens small nucleolar RNA host gene 26(SNHG26),long non-codingRNA NCBI Reference Sequence:NR_146320.1
[0015] GenBank Graphics
[0016] >NR_146320.1Homo sapiens small nucleolar RNA host gene 26(SNHG26),long non-coding RNA
[0017]
[0018] This invention identified a significant increase in SNHG26 in gliomas using the online database LncExpDB and real-time quantitative PCR. Further transfection of U251 cells with a specific siRNA targeting SNHG26 showed that knocking down SNHG26 significantly inhibited the proliferation and migration of U251 glioma cells. Therefore, lncRNA SNHG26 can not only be used as a target for designing diagnostic reagents but also for preparing anti-tumor drugs. Attached Figure Description
[0019] Figure 1 The expression of SNHG26 in glioma.
[0020] Figure 2 Results of interference efficiency of SNHG26 siRNA.
[0021] Figure 3 The results show the inhibition of proliferation and migration of U251 glioma cells after SNHG26 knockdown. In the figures: A represents the EdU assay results, and B represents the Ibidi chamber migration assay results. Detailed Implementation
[0022] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are within the scope of the present invention. Experimental methods and reagents not specifically described in the embodiments are performed according to conventional conditions in the art.
[0023] Example 1
[0024] Expression of SNHG26 in Gliomas
[0025] The expression of SNHG26 in different tumors was examined using the online database LncExpDB (https: / / ngdc.cncb.ac.cn / lncexpdb / ). Its expression in the human glioma cell line U251 was detected using real-time quantitative PCR. The results are as follows: Figure 1 As shown, SNHG26 is significantly elevated in gliomas.
[0026] Example 2
[0027] SNHG26 Functional Verification
[0028] I. Culture of human glioma cell line U251
[0029] Take the frozen U251 cells out of the -80℃ freezer and thaw them rapidly in a 37℃ water bath. In a clean bench, aspirate the cell suspension, add 2mL of DMEM high-glucose complete medium, centrifuge, wash once with an appropriate amount of complete medium, and then seed the cells evenly in 60mm culture dishes. Incubate at 37℃ in a cell culture incubator for routine culture, changing the medium every other day. When the cells grow to 80%-90%, they can be used for subsequent experiments.
[0030] II. Extraction of Cellular RNA
[0031] Wash the U251 cultured in a 35mm culture dish three times with PBS, and add 1mL of PBS. Reagent (Thermofisher) was transferred to a 1.5 mL RNase-free EP tube and lysed on ice for 5 min. 200 μL of chloroform was added, vortexed vigorously for 20 s, and incubated at room temperature for 5 min; then centrifuged at 13000 rpm, 4°C for 15 min. The supernatant was carefully aspirated, and 500 μL of isopropanol was added. The mixture was gently mixed by inverting, incubated at room temperature for 10 min, and then centrifuged at 13000 rpm, 4°C for 15 min. The supernatant was discarded. 1 mL of 75% ethanol was added, and the precipitate was gently washed. The mixture was centrifuged at 13000 rpm, 4°C for 5 min; the supernatant was removed, and the precipitate was dried. An appropriate amount of RNase-free H2O was added, and the precipitate was dissolved at 65°C for 10 min. The OD value and concentration of the RNA were measured, and the RNA was stored at -80°C for later use.
[0032] III. RNA reverse transcription to synthesize cDNA
[0033] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Novizan, R312-01).
[0034] Perform on ice, with each reaction system containing 20 μL, as follows:
[0035]
[0036] The reaction procedure was: 37℃ for 15 min, 85℃ for 5 sec, 4℃ for ∞.
[0037] IV. Real-time quantitative PCR (qRT-PCR)
[0038] SNHG26 qRT-PCR primer sequences were designed based on primer design principles.
[0039] SNHG26 qRT-PCR primers:
[0040] SNHG26-F:GGGCCAGTTGTCTCAGAATC(seq-4)
[0041] SNHG26-R: CTTGTCCAGCTGCAAAATCA (seq-5).
[0042] The cDNA obtained from the reverse transcription reaction was diluted at a ratio of 1:5 and subjected to the following qRT-PCR reaction.
[0043] (1) Prepare the qRT-PCR reaction solution according to the following components:
[0044]
[0045] (2) Mix the reaction solution thoroughly. The Real-time PCR program is as follows:
[0046]
[0047] (3) Set up 3 replicates for the reaction, with GAPDH as the internal control. After the program is completed, check the melting curve and amplification curve, discard experimental data with large errors, and perform statistical analysis on the data according to the specific experimental requirements.
[0048] V. Electroporation of U251 siRNA
[0049] Count the U251 cells cultured to generation P2, take a certain amount of cells and mix them with siRNA, mix thoroughly, so that the final concentration is 2.0 × 10⁻⁶ cells per 100 μL tube. 6 Cells were injected with 200 nM siRNA, with a cell volume of 90 μL and a siRNA volume of 10 μL. Electroporation was then performed according to the NEPA21 (NEPAGENE) endothelial cell line electroporation procedure (275 V, 1 ms).
[0050] The SNHG26 siRNA is shown below:
[0051] Justice Chain: GGGAGGUUAUGCCACCAUTT
[0052] Antonyms: AUGGUGGCAUAAUCCUCCCTT.
[0053] VI. Identification of siRNA interference efficiency
[0054] U251 cells were transfected with specific siRNA targeting SNHG26 and its control Ctrl (Control) siRNA, respectively. After 24 hours, the cells were harvested and processed according to... RNA was extracted from U251 cells using the Reagent (Thermo Fisher) instruction manual, reverse transcribed, and then subjected to qRT-PCR. The results are as follows: Figure 2 As shown, after 24 h of siRNA treatment, SNHG26 siRNA significantly reduced the expression of SNHG26 in U251 cells. SNHG26 siRNA vs. Ctrl siRNA, with P values marked in the figure.
[0055] VII. Effects of SNHG26 knockdown on the proliferation and migration of U251 glioma cells
[0056] U251 cells were transfected with specific siRNA targeting SNHG26 and its control Ctrl (Control) siRNA, respectively. After 24 hours, the cells were digested, counted, and seeded at a rate of 8 × 10⁶ cells / year. 3Cells were cultured in 96-well plates for 22 hours and the experiment was performed according to the instructions of the EdU kit (Cell-Light EdU Apollo567 In Vitro Kit (100T), C10310-1) manufactured by Guangzhou Ruibo Pharmaceutical Co., Ltd. 1.5 × 10⁶ cells were seeded per well of Ibidi. 3 Cell migration experiments were conducted. Images were taken at 0h, 12h, 24h, 36h, and 48h after complete cell adhesion, and migration parameters were statistically analyzed. Results are as follows: Figure 3 As shown, knockdown of SNHG26 significantly inhibited the proliferation and migration of glioma cells U251.
Claims
1. Application of lncRNA SNHG26 inhibitor in the preparation of drugs for the prevention and treatment of glioma, wherein the lncRNA SNHG26 inhibitor is a nucleic acid, and the nucleic acid is siRNA, the sequence of which is as follows: Justice Chain: GGGAGGUUAUGCCACCAUTT Antonyms: AUGGUGGCAUAAUCCUCCCTT.