A method for detecting viruses in a body of water
By combining SPR sensors with a CRISPR system, the problems of long detection time and high cost of SARS-CoV-2 in wastewater have been solved, enabling rapid and low-cost virus detection with high sensitivity and specificity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-16
- Publication Date
- 2026-04-07
AI Technical Summary
Existing technologies for detecting the novel coronavirus in wastewater suffer from problems such as long detection times and high costs, making it difficult to achieve efficient and dynamic prevention and control.
The surface plasmon resonance (SPR) technology combined with the CRISPR system is used to detect the viral content in water by contacting the nucleic acid probe with the SPR sensor. The virus target fragment is identified by CRISPR-related nucleases and guide RNA, and the detection is performed by combining the wavelength changes of the SPR sensor.
It enables the detection of viruses in water bodies in a short time with low cost and high efficiency, with a detection limit of 800 copies/mL. It has high sensitivity and specificity and is suitable for real-time online monitoring.
Smart Images

Figure CN116334313B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of water body detection, in particular to a detection method of viruses in water bodies. BACKGROUND
[0002] The main transmission routes of the new coronavirus are droplet transmission, aerosol transmission and fecal transmission. The fecal transmission route directly links sewage with the new coronavirus, so researchers can estimate the spread of the new coronavirus epidemic by analyzing the information of the new coronavirus contained in domestic sewage. Some studies even show that for some patients whose saliva samples are negative, a large number of positive samples can be detected in their feces. Therefore, it is necessary to detect the new coronavirus in sewage of various sources. Many foreign research institutions have implemented the use of conventional wastewater monitoring as a method for early warning of the spread of the new coronavirus, which has the advantages of non-disturbing collection and low cost. China has also recently stipulated the steps and methods for using sewage to monitor the new coronavirus, including sewage sampling, inactivation, enrichment and concentration, and nucleic acid extraction and detection.
[0003] After comparing the existing methods at home and abroad, they can be roughly divided into the following categories:
[0004] I. Real-time quantitative RT-PCR: After enriching and concentrating the viruses in sewage, the genomic RNA is extracted, and then cDNA is obtained by reverse transcription. The conserved fragments of specific genes (such as N gene and Orf1a gene) are selected to design PCR primers, and the fluorescence intensity is recorded in real time during the PCR reaction. An internal control gene is also selected for quality control. After the reaction is completed, the corresponding Ct value is read out, and if they are all less than 35, it is determined to be positive. However, although this method is more accurate, it still takes about 6 hours to get the results, which is not conducive to efficient and dynamic prevention and control.
[0005] II. Cas12a fluorescent reporter method: After enriching and concentrating the viruses in sewage, the genomic RNA is extracted, and then cDNA is obtained by reverse transcription. Primers are designed for specific genes (such as N gene) and PCR is performed. After 40 cycles of amplification, the amplification product is reacted with the Cas12a fluorescent reporter system, and the fluorescence produced is read by a microplate reader. Since the fluorescence intensity is proportional to the number of virus copies in the sewage, the viral load in the sewage can be quantitatively analyzed. However, the reporter gene used in the Cas12a fluorescent reporter system needs to be chemically synthesized, which is costly and consumes a large amount of material per reaction, making it unsuitable for large-scale detection.
[0006] Therefore, it is necessary to provide a detection method for viruses in sewage that is short in detection time, low in detection cost and good in detection effect. SUMMARY
[0007] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides a method for detecting viruses in a water body, which can efficiently detect target viruses in a short time and at a low cost.
[0008] In a first aspect, the present application provides a method for detecting viruses in a water body, comprising the following steps:
[0009] S1: Collecting the water body, inactivating, centrifuging to obtain the supernatant, extracting RNA and reverse transcribing into cDNA, and amplifying;
[0010] S2: Mixing the amplification product and the CRISPR system, and then contacting with the SPR sensor, and determining the content of viruses in the water body according to the wavelength change of the SPR sensor before and after the contact.
[0011] The SPR sensor comprises an optical fiber and a nucleic acid probe with metal nanoparticles connected thereto modified on the optical fiber.
[0012] The CRISPR system comprises a CRISPR-associated nuclease and a guide RNA for recognizing a target fragment of the virus.
[0013] According to the detection method of the embodiments of the present application, at least the following beneficial effects are achieved:
[0014] The method adopted in the present application combines surface plasmon resonance technology (SPR) to realize the detection of viruses in the water body. The water body is sampled, inactivated, pretreated, nucleic acid is extracted, and reverse transcribed and amplified to complete the preliminary processing of the sample before detection. Through this preliminary processing method, the viruses in the water body can be better extracted and amplified, and finally the content thereof can be detected by the specific nucleic acid probe through the SPR technology. The detection effect of the viruses can be obtained by using only a small amount of water body, the detection time required can be less than 2 hours, and the detection limit of the viruses can reach 800 copies
[0015] / mL, which has relatively high sensitivity and specificity.
[0016] As can be seen, the embodiments of the present application provide a method capable of real-time online monitoring of viruses in a water body, which realizes the effects of shortening the detection time, improving the timeliness of data, and reducing the detection cost.
[0017] In some embodiments of the present application, the virus is an RNA virus. In some of these embodiments, the virus is selected from at least one of HIV virus, coronavirus, Ebola virus, Marburg virus, Lassa virus, rabies virus, Hantavirus, hepatitis A virus, and hand-foot-mouth disease virus. In some of these embodiments, the coronavirus is selected from at least one of SARS, SARS-CoV-2, and MERS.
[0018] In some embodiments of the present application, the nucleic acid probe comprises an H1 DNA fragment and an H2 DNA fragment, the H1 DNA fragment is modified on the optical fiber, the H2 DNA fragment is connected with a metal nanoparticle, and the H2 DNA fragment is combined with at least part of the reverse complementary pairing of the H1 DNA fragment. The two-segment DNA fragment is used to construct a combined probe, wherein the H1 DNA fragment is used to combine with the surface of the optical fiber to facilitate the provision of a cleavage site of the CRISPR-associated nuclease on the surface of the optical fiber. The H2 DNA is used to combine with the metal nanoparticle at one end and combine with the H1 DNA at the other end by base complementary pairing to modify the metal nanoparticle on the surface of the optical fiber. The two-segment combined mode can make the synthesis of the probe more simple, the fixation of the metal nanoparticle more stable, and the subsequent cleavage of the nuclease more convenient, thereby improving the detection effect.
[0019] In some embodiments of the present application, the sequence of the H1 DNA fragment is 5'-SH-CTTTACTCAACttattattACGAACATCAGG-3'(SEQ ID No. 1), and the sequence of the H2 DNA fragment is 5'-SH-CCTGATGTTCGT-3'(SEQ ID No. 2). Through the design of the probe sequence, the binding efficiency of the nucleic acid probe and the subsequent cleavage are ensured, and the detection sensitivity and accuracy of the virus are optimized.
[0020] In some embodiments of the present application, the method for modifying the nucleic acid probe on the optical fiber comprises the following steps:
[0021] Taking the optical fiber, incubating with a physiological buffer;
[0022] Subsequently, taking the solution of the H1 DNA fragment, further incubating the optical fiber with the H1 DNA fragment;
[0023] After taking the optical fiber, incubating with the physiological buffer again, taking the solution of the H2 DNA fragment, further incubating the optical fiber with the H2 DNA fragment;
[0024] After incubating the optical fiber in a mercaptoethanol solution, incubating the optical fiber with the physiological buffer again.
[0025] The physiological buffer refers to a biochemical solution with a buffering effect known in the art, which includes but is not limited to at least one of Tris buffer, MOPS buffer, HEPES buffer, SSC buffer, Tricine buffer, PBS buffer, etc. In most cases, the physiological buffers used in the above steps are the same buffer. In some embodiments, the solution of the H1 DNA fragment and / or the solution of the H2 DNA fragment is the above-mentioned physiological buffer containing the H1 DNA fragment and / or the H2 DNA fragment.
[0026] In some embodiments, incubation means contacting the optical fiber with the corresponding solution and placing it at 20-40℃ for 1 min-2 h. In some embodiments, incubation in the method of modifying the nucleic acid probe onto the optical fiber means contacting the optical fiber with the corresponding solution and placing it at room temperature for 1 min-2 h.
[0027] In some embodiments of the present application, the metal nanoparticles are gold nanoparticles.
[0028] In some embodiments of the present application, the method of modifying the nucleic acid probe onto the optical fiber comprises the following steps:
[0029] Take the optical fiber, incubate it with the physiological buffer at room temperature for 2-10 min;
[0030] Subsequently, take the solution of the H1 DNA fragment, incubate it with the optical fiber at room temperature for 20-40 min;
[0031] After taking the optical fiber and incubating it again with the physiological buffer at room temperature for 2-10 min, take the solution of the H2 DNA fragment and further incubate it with the optical fiber at room temperature for 30 min-2 h;
[0032] After incubating the optical fiber in the mercaptoethanol solution at room temperature for 20-40 min, incubate it again with the physiological buffer for 2-10 min.
[0033] In some embodiments of the present application, after taking the supernatant in S1 and before extracting the RNA, a step of enrichment and concentration is further included.
[0034] In some embodiments of the present application, the enrichment and concentration in S1 can be achieved by at least one of the following methods: polyethylene glycol precipitation method (separating and collecting the water solution from the virus particle multimers by making the virus particles form multimers), aluminum salt coagulation precipitation method (collecting the virus-containing colloids by adsorbing and wrapping the virus particles with aluminum hydroxide colloids generated by aluminum salt hydrolysis), centrifugal ultrafiltration method (collecting by centrifugation to retain the virus particles with a molecular weight greater than the molecular weight cut-off of the ultrafiltration membrane in the ultrafiltration cup), etc.
[0035] In some embodiments of the present application, the enrichment and concentration after taking the supernatant in S1 and before extracting the RNA is achieved by the coagulation precipitation method, and the specific steps include:
[0036] Take the supernatant, add a coagulant, adjust the pH to 5-6.5, stir and centrifuge, remove the supernatant, dissolve the precipitate, and obtain the concentrated solution.
[0037] In some embodiments of the present application, the coagulant includes aluminum ions.
[0038] In some embodiments of the present application, the coagulant comprises aluminum chloride.
[0039] In some embodiments of the present application, the precipitate is dissolved with EDTA solution.
[0040] In some embodiments of the present application, the supernatant is obtained by centrifuging the inactivated water body at 4000-6000 rpm for 10-40 min.
[0041] In some embodiments of the present application, the inactivation is performed by high-temperature inactivation.
[0042] In some embodiments of the present application, the inactivation comprises a treatment at a temperature above 40℃ for more than 2 min.
[0043] In some embodiments of the present application, the inactivation comprises a treatment at a temperature above 40-100℃ for 2 min-1 h. It can be understood that a shorter treatment time can be selected at a higher temperature.
[0044] In some embodiments of the present application, the extraction of RNA is performed by a conventional nucleic acid extraction method known in the art, for example, by using a corresponding extraction kit according to a standard procedure, and the same applies to reverse transcription.
[0045] In some embodiments of the present application, the method for amplifying the cDNA can be a PCR method, or other amplification methods known in the art, for example, isothermal amplification methods such as LAMP, RPA, RCA, CPA, SDA, HAD, etc.
[0046] In some embodiments of the present application, the method for amplifying the cDNA is PCR amplification. In some embodiments thereof, Taq DNA polymerase system is used for amplification. In some embodiments thereof, the amplification procedure is 90-98℃ for 10-20 s, 50-60℃ for 10-20 s, and 70-75℃ for 20-40 s, with a cycle number of 25-50. In some embodiments thereof, the amplification procedure is 94-96℃ for 10-20 s, 56-58℃ for 10-20 s, and 71-73℃ for 20-40 s, with a cycle number of 30-50.
[0047] In some embodiments of the present application, the CRISPR-associated nuclease is selected from at least one of Cas, Csa, Csb, Csc, Cse, Csf, Csm, Csn, Csx, Csy, Cmr. Among them, the Cas enzyme includes at least one of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a-i, Cas13a-d, Cas14a-c, etc., the Csa enzyme includes at least one of Csa1-5, etc., the Csb enzyme includes at least one of Csb1-3, etc., the Csc enzyme includes at least one of Csc1-2, etc., the Cse enzyme includes at least one of Cse1-2, etc., the Csf enzyme includes at least one of Csf1-4, etc., the Csm enzyme includes at least one of Csm1-6, etc., the Csx enzyme includes at least one of Csx1-20, etc., the Csy enzyme includes at least one of Csy1-3, etc., and the Cmr enzyme includes at least one of Cmr1-6, etc. At the same time, according to different CRISPR-associated enzymes, the types of corresponding guide RNA are also different. In some embodiments, the guide RNA can be one of sgRNA or crRNA.
[0048] In some embodiments of the present application, the CRISPR-associated nuclease is a Cas12a enzyme, and the guide RNA is a crRNA.
[0049] In some embodiments of the present application, forward primer (sequence 5'-GCTCAATACACTTCTGCACTG 3', SEQ ID No. 3) and reverse primer (sequence 5'-AGCAAGATTAGCAGAAGCTC-3', SEQ ID No. 4) are used for amplification to detect whether it contains SARS-CoV-2.
[0050] In some embodiments of the present application, when detecting the N gene, the corresponding crRNA sequence is UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC, SEQ ID No. 5.
[0051] In some embodiments of the present application, when detecting the S gene, the crRNA sequence of the Omicron subtype is UAAUUUCUACUAAGUGUAGAUAATGATATCTTTTCACGTCT, SEQ ID No. 6.
[0052] In some embodiments of the present application, S2 includes:
[0053] Contacting the SPR sensor with a biological buffer and recording the first wavelength;
[0054] contacting the SPR sensor with a biological buffer, recording a first wavelength;
[0055] According to the changes of the first wavelength and the second wavelength, the content of viruses in the water body is determined.
[0056] In some embodiments of the present application, S2 comprises:
[0057] contacting the SPR sensor with a biological buffer, recording a first wavelength;
[0058] contacting the SPR sensor with a biological buffer, recording a first wavelength;
[0059] According to the changes of the first wavelength and the second wavelength, the content of viruses in the water body is determined.
[0060] In some embodiments of the present application, the contacting in the step S2 means that the SPR sensor is contacted with the corresponding solution at 20-50°C for a period of time, for example, 1 min-2 h. Further, it means that the optical fiber of the SPR sensor and the nucleic acid probe on the surface thereof are contacted with the corresponding solution.
[0061] In some embodiments of the present application, S2 comprises:
[0062] contacting the SPR sensor with a biological buffer at 20-50°C for 2-10 min, recording a first wavelength;
[0063] contacting the SPR sensor with a biological buffer at 20-50°C for 2-10 min, recording a first wavelength;
[0064] According to the changes of the first wavelength and the second wavelength, the content of viruses in the water body is determined.
[0065] In some embodiments of the present application, S2 comprises:
[0066] contacting the SPR sensor with a biological buffer at 30-40°C for 4-6 min, recording a first wavelength;
[0067] The SPR sensor is contacted with the CRISPR system and the amplification product at 20-30°C for about 1 hour, then contacted with a biological buffer at 30-40°C for 4-6 minutes, then contacted with proteinase K at 30-40°C for 25-35 minutes, then contacted with a biological buffer at 30-40°C for 4-6 minutes, and the second wavelength is recorded.
[0068] According to the changes in the first wavelength and the second wavelength, the content of the virus in the water body is determined.
[0069] In some embodiments of the present application, according to the changes in the first wavelength and the second wavelength, the content of the virus in the water body is determined as whether the virus is contained or how much the virus is contained. Specifically, according to whether the first wavelength and the second wavelength change, it can be determined whether the virus is contained in the water body, and according to how much the first wavelength and the second wavelength change, it can be determined how much the virus is contained in the water body. For example, a mathematical relationship between the virus content and the wavelength change can be determined by constructing standard samples of different virus contents, so that the virus content in the water body can be determined by the changes in the first wavelength and the second wavelength using the mathematical relationship.
[0070] In some embodiments of the present application, the water body includes sewage, which can be domestic sewage, production sewage, medical water, agricultural water, and other types of sewage or wastewater, or can be at least one of a river, a sea water body, etc. It can be understood that the water body can also be other mixtures that can contain nucleic acids to be tested, with water as a solvent or dispersant.
[0071] In some embodiments of the present application, the detection method of the virus in the water body is a detection method for non-diagnostic or therapeutic purposes, which can be a method for monitoring or early warning of the water body.
[0072] The second aspect of the present application also provides a product for detecting a virus in a water body, which includes an SPR sensor and a CRISPR system.
[0073] In some embodiments of the present application, the SPR sensor includes an optical fiber and a nucleic acid probe with metal nanoparticles connected thereto modified on the optical fiber.
[0074] In some embodiments of the present application, the CRISPR system includes a CRISPR-associated nuclease and a guide RNA for recognizing a target fragment of the virus.
[0075] Additional aspects and advantages of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS
[0076] Figure 1is the change of SPR wavelength during the whole process of fiber modification of embodiment 1 of the present application.
[0077] Figure 2 is the change of SPR wavelength during the whole process of new coronavirus detection of embodiment 1 of the present application.
[0078] Figure 3 is the change of SPR wavelength of key steps PBS-L1 and PBS-L2 when detecting new coronavirus in embodiment 1 of the present application.
[0079] Figure 4 is the relationship diagram between the copy number of new coronavirus pseudo virus and the change of SPR wavelength Δλ in the limit of detection experiment in embodiment 1 of the present application. D DETAILED DESCRIPTION
[0080] The concept and the technical effects of the present application will be described in detail below in combination with embodiments, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0081] The embodiments of the present application will be described in detail below, and the described embodiments are exemplary and are only used to explain the present application, and cannot be understood as limiting the present application.
[0082] In the description of the present application, if several meanings are more than one, the meaning of multiple is more than two, greater than, less than, more than, etc. are understood as not including the number, above, below, within, etc. are understood as including the number. If it is described as first, second, it is only used for the purpose of distinguishing technical features, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features or implicitly indicating the sequence of indicated technical features. In the following description, although the logical order is shown in the flowchart, in some cases, the steps shown or described can be performed in an order different from that in the flowchart.
[0083] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as understood by those skilled in the art to which the present application belongs. The terms used herein are only for the purpose of describing the embodiments of the present application, and are not intended to limit the present application.
[0084] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "exemplary embodiment", "example", "specific example", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the exemplary description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any suitable manner in one or more embodiments or examples.
[0085] Embodiment 1
[0086] The present embodiment provides a method for detecting SARS-CoV-2 in domestic sewage, comprising the following steps:
[0087] I. Extraction and amplification of nucleic acid
[0088] (1) Sampling: Collect 40 mL of domestic sewage sample in situ with a sterile polyethylene water pipe.
[0089] (2) Inactivation: Inactivate the virus by heating the domestic sewage sample in a water bath at 60°C for 30 min.
[0090] (3) Pretreatment: After inactivation of the virus, transfer the domestic sewage sample to a 50 mL centrifuge tube and centrifuge at 5000 rpm for 30 min.
[0091] (4) Enrichment and concentration: Take the supernatant obtained by centrifugation, add 0.5 mL of coagulant (3M aluminum chloride solution), and adjust the pH to 6 with 1M sodium hydroxide solution (pH test paper). Add magnetic stirrer and stir for 10 min, then centrifuge at 5000 rpm for 30 min, discard the supernatant, and retain the sediment at the bottom of the centrifuge tube. Add 1 mL of EDTA solution (20% concentration) to the sediment, shake it, then transfer the centrifuge tube to a water bath, incubate at 60°C for 10 min, and obtain the virus concentrate.
[0092] (5) Nucleic acid extraction: Use RNA extraction kit (Daan Gene, DA-0620) to complete virus RNA extraction of the virus concentrate by nucleic acid automatic extraction instrument (Wanwuchenshi, MS-001).
[0093] (6) Reverse transcription: Take 6 μL of the obtained virus RNA, add 10 μL of water, then add 4 μL of 5× RNA reverse transcription mixture (Saiwei Bio, G3337), incubate at 37°C for 30 min, and obtain the virus cDNA.
[0094] (7) Amplification: 1 μL of the obtained viral cDNA was taken, 8 μL of water, 0.5 μL of forward primer (sequence: 5'-GCTCAATACACTTCTGCACTG-3', SEQ ID No. 3), and 0.5 μL of reverse primer (5'-AGCAAGATTAGCAGAAGCTC-3', SEQ ID No. 4) were added, and after mixing, the mixture was added to 10 μL of Taq DNA polymerase reaction system (Savillex, G3441), and the viral nucleic acid fragment was amplified in a PCR instrument. The program was as follows: 95°C for 15 s, 57°C for 15 s, 72°C for 30 s, and the cycle number was 40. Finally, the amplification product of the new coronavirus nucleic acid fragment was obtained.
[0095] II. SPR detection
[0096] The optical fiber SPR device used in this embodiment includes a light source, an SPR sensor, and a spectrometer arranged in sequence along the direction of light propagation, and a terminal receiving and displaying the data processed by the spectrometer. The SPR sensor includes a single-mode optical fiber and a coreless optical fiber arranged in sequence, and the surface of the coreless optical fiber has a metal plating layer, thereby forming a surface plasmon resonance structure. In use, the SPR sensor is inserted into a plastic tube and contacts the solution in the plastic tube. The light emitted by the light source passes through the SPR sensor and is received by the spectrometer, and is displayed on the terminal.
[0097] The specific steps of the SPR detection in this embodiment are as follows:
[0098] (1) Optical fiber modification
[0099] a. 300 μL of phosphate buffer solution (PBS) was taken and placed in an enzyme-free plastic tube on a hot stage. The optical fiber was inserted, incubated at room temperature for 5 min, the wavelength PBS-L1 at this time was recorded, and the plastic tube was removed.
[0100] b. 300 μL of PBS solution containing H1 DNA (sequence: 5'-SH-CTTTACTCAACttattattACGAACATCAGG-3', SEQ ID No. 1) (concentration: 100 μM) was taken and placed in an enzyme-free plastic tube on a hot stage. The optical fiber was inserted, incubated at room temperature for 30 min, and the plastic tube was removed.
[0101] c. 300 μL of PBS was taken and placed in an enzyme-free plastic tube on a hot stage. The optical fiber was inserted, incubated at room temperature for 5 min, the wavelength PBS-L2 at this time was recorded, and the plastic tube was removed.
[0102] d. Take 300 μL of gold nanoparticle modified H2 DNA (sequence: 5'-SH-CCTGATGTTCGT-3', SEQ ID No. 2) in PBS solution (concentration: 100 μM) in an enzyme-free plastic tube and place it on a hot stage. Insert the optical fiber, incubate at room temperature for 1 h, and remove the plastic tube.
[0103] e. Take 300 μL of thiol caproic alcohol (MCH) in PBS solution (concentration: 100 μM) in an enzyme-free plastic tube and place it on a hot stage. Insert the optical fiber, incubate at room temperature for 30 min, and remove the plastic tube.
[0104] f. Take 300 μL of PBS in an enzyme-free plastic tube and place it on a hot stage. Insert the optical fiber, incubate at room temperature for 5 min, record the wavelength PBS-L3 at this time, and remove the plastic tube.
[0105] At this time, the gold nanoparticles are modified to the surface of the coreless optical fiber to form a nucleic acid probe through the reverse complement of H1 DNA and H2 DNA and form an additional gold nanoparticle modification layer through self-assembly of MCH.
[0106] The wavelength λ changes with time during the above modification process and is recorded as shown in Figure 1 .
[0107] (2) New crown detection
[0108] g. Prepare the Cas12a detection system: take 1 μL of the amplification product in the nucleic acid extraction and amplification step, 30 μL of 10x Cas12a Buffer (Yizhibio), 30 μL of crRNA solution (1 μM, Shenggongbio, sequence: 5'-UAAUUUCUACUAAGUGUAGAUCCCCCAGCGCUUCAGCGUUC-3', SEQ ID No. 5, targeting the N gene fragment in the amplification product), 2 μL of Cas12a enzyme (10 μM, Yizhibio), add 247 μL of water, and mix well.
[0109] h. Take 300 μL of PBS in an enzyme-free plastic tube and place it on a hot stage. Insert the modified optical fiber, incubate at 37°C for 5 min, record the wavelength PBS-L1 at this time, and remove the plastic tube.
[0110] i. Place 300 μL of the Cas12a detection system in g in an enzyme-free plastic tube and place it on a hot stage. Insert the optical fiber, incubate at room temperature for 1 h, and remove the plastic tube.
[0111] j. Take 300 μL of PBS in an enzyme-free plastic tube and place it on a hot stage. Insert the optical fiber, incubate at 37°C for 5 min, and remove the plastic tube.
[0112] k. Take 300 μL of proteinase K solution (100 ng / mL in PBS) into an enzyme-free plastic tube and place it on the hot stage. Insert the optical fiber and incubate at 37℃ for 30 min. Remove the plastic tube.
[0113] l. Take 300 μL of PBS into an enzyme-free plastic tube and place it on the hot stage. Insert the optical fiber and incubate at 37℃ for 5 min. Record the wavelength PBS-L2 at this time, and remove the plastic tube.
[0114] The full wavelength change record during the above detection process is shown in Figure 2 , wherein L1-L2 is the SPR detection result, denoted as Δλ D , and the results are shown in Figure 3 .
[0115] (3) Determining the detection limit
[0116] m. Dilute the new coronavirus pseudovirus (Zhongding Biology) with a water gradient to obtain virus dilutions with concentrations of 100000, 20000, 4000 and 800 copies / mL, respectively.
[0117] n. Perform SPR detection on the above virus dilutions according to the foregoing steps to obtain the Δλ D values corresponding to different virus dilutions.
[0118] o. Plot the Δλ D values obtained in n against the logarithm of the number of virus copies to determine the detection limit.
[0119] The results are shown in Figure 4 . As can be seen from the graph, the detection limit is 800 copies / mL.
[0120] In addition, the pseudovirus with the above different concentration gradients can also be used as a standard, and the fitting relationship between Δλ D and the virus content in the sample can be determined, so as to quantitatively analyze the virus content in the sample according to Δλ D .
[0121] Example 2
[0122] The present embodiment provides a method for detecting the new coronavirus in sewage, which differs from example 1 in that:
[0123] (1) In the SPR detection, different subtypes of viruses corresponding to specific crRNA were added in the Cas12a detection system of step g of the new crown detection. In this embodiment, the crRNA sequence for detecting the Omicron subtype is: 5'-UAAUUUCUACUAAGUGUAGAUAATGATATCTTTTCACGTCT-3', SEQ ID No. 6, which targets and recognizes the specific S gene fragment of the Omicron subtype in the amplification product. The method provided in this embodiment can obtain similar detection effect as that in Example 1.
[0124] Example 3
[0125] Twenty-one sewage samples in a certain city were selected for detection by a commercially available new coronavirus nucleic acid detection kit (fluorescent PCR method) according to the instructions. The N gene and the ORF gene were used as the target genes for detection, and the detection results of the RT-PCR method were used as the gold standard for judging whether the sewage sample was positive or not. The positive standard of the RT-PCR method was Ct value less than 35. At the same time, the 21 sewage samples were detected by the method of Example 1, and the results are shown in the following table:
[0126] Table 1. Sewage sample detection results
[0127]
[0128] From the above table results, it can be seen that the detection rate of positive samples using the method of Example 1 can reach 100%, and the sensitivity and specificity reach 100%.
[0129] The above has made a detailed description of the present application in combination with the examples, but the present application is not limited to the above examples. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.
Claims
1. A method for detecting the novel coronavirus in water, characterized in that, Includes the following steps: S1: Collect water samples, inactivate the virus, centrifuge to obtain the supernatant, extract RNA and reverse transcribe it into cDNA, and amplify it; S2: After the amplification product and the CRISPR system are mixed, they are brought into contact with the SPR sensor. The content of the virus in the water is determined based on the wavelength change of the SPR sensor before and after contact. The SPR sensor includes an optical fiber and a nucleic acid probe with metal nanoparticles attached to the optical fiber. The nucleic acid probe includes an H1 DNA fragment and an H2 DNA fragment. The H1 DNA fragment is modified on the optical fiber, and the sequence of the H1 DNA fragment is 5′-SH-CTTTACTCAACttattattACGAACATCAGG-3′. The H2 DNA fragment is attached to the metal nanoparticles, and the H2 DNA fragment binds to at least a portion of the H1 DNA fragment in an anti-complementary pair. The sequence of the H2 DNA fragment is 5′-SH-CCTGATGTTCGT-3′. The CRISPR system includes a CRISPR-associated nuclease and a guide RNA for recognizing the target fragment of the virus, wherein the CRISPR-associated nuclease is a Cas12a enzyme.
2. The detection method according to claim 1, characterized in that, The method for modifying the nucleic acid probe onto the optical fiber includes the following steps: Take the optical fiber and incubate it with physiological buffer solution; Subsequently, a solution of the H1 DNA fragment was taken and further incubated with the optical fiber; After incubating the optical fiber with the physiological buffer solution again, a solution of the H2 DNA fragment is incubated with the optical fiber for further incubation. The optical fiber was incubated in mercaptoethanol solution and then incubated again with physiological buffer.
3. The detection method according to claim 1, characterized in that, The step of enrichment and concentration after centrifugation and supernatant collection in S1 includes: Take the supernatant, add coagulant, adjust the pH to 5-6.5, stir and centrifuge, remove the supernatant, dissolve the precipitate to obtain a concentrated solution.
4. The detection method according to claim 3, characterized in that, The coagulant includes aluminum ions.
5. The detection method according to claim 3, characterized in that, The coagulant includes aluminum trichloride.
6. The detection method according to claim 1, characterized in that, In S1, the supernatant is obtained by centrifuging the inactivated water at 4000-6000 rpm for 10-40 min.
7. The detection method according to claim 1, characterized in that, S2 include: The SPR sensor was brought into contact with a biological buffer solution, and the first wavelength was recorded. The SPR sensor was reacted with the CRISPR system and amplification products, then reacted with a biological buffer, followed by reaction with proteinase K and then reacted with a biological buffer again to record the second wavelength. The content of the virus in the water body is determined based on the changes in the first wavelength and the second wavelength.
8. A product for detecting the novel coronavirus in water, characterized in that, include: The SPR sensor includes an optical fiber and a nucleic acid probe with metal nanoparticles attached to the optical fiber. The nucleic acid probe includes an H1 DNA fragment and an H2 DNA fragment. The H1 DNA fragment is modified on the optical fiber, and the sequence of the H1 DNA fragment is 5′-SH-CTTTACTCAACttattattACGAACATCAGG-3′. The H2 DNA fragment is attached to the metal nanoparticles and binds to at least a portion of the H1 DNA fragment in an anti-complementary pair. The sequence of the H2 DNA fragment is 5′-SH-CCTGATGTTCGT-3′. The CRISPR system includes a CRISPR-associated nuclease and a guide RNA for recognizing the target fragment of the virus, wherein the CRISPR-associated nuclease is a Cas12a enzyme.
Citation Information
Patent Citations
DNA probe combined with gold nanospheres and application of DNA probe to detection of Hg<2+> based on solid-state nanopores
CN111778244A
CRISPR-SPR biosensor chip as well as preparation method and application thereof
CN114621998A
Method for raising surface plasma resonance sensor sensitivity by using nano gold grain catalytic growing
CN1815194A