Veillonella parvula and its use in the preparation of products for the diagnosis and treatment of oral squamous cell carcinoma

By screening and identifying *Vironella spp.* NCTC11810, the lack of research on the association between oral flora imbalance and oral squamous cell carcinoma was addressed. This study demonstrated that the proliferation and invasion of oral squamous cell carcinoma can be inhibited and treated using this strain and its metabolite propionate, providing a new diagnostic and therapeutic approach.

CN116355785BActive Publication Date: 2026-07-03NANJING CHILDRENS HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211217787.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-29
Publication Date
2026-07-03
Estimated Expiration
2042-09-29

AI Technical Summary

Technical Problem

Current technologies lack research on oral microbiota genes, especially on the association between dysbiosis of microbiota such as Veillonella and oral squamous cell carcinoma, resulting in a lack of effective means for the diagnosis and treatment of oral squamous cell carcinoma.

Method used

A strain of Veillonella parvula, NCTC11810, was screened and identified. It was found that it could inhibit proliferation and migration and promote apoptosis in oral squamous cell carcinoma cells with high TROP2 expression, and can be used as a candidate marker microorganism for diagnosis and treatment.

Benefits of technology

The small-scale *Veinia villosa* NCTC11810 and its metabolite propionate can effectively inhibit the proliferation and invasion of TROP2-overexpressing oral squamous cell carcinoma cells and promote their apoptosis, providing a new direction for the diagnosis and treatment of oral squamous cell carcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116355785B_ABST
    Figure CN116355785B_ABST
Patent Text Reader

Abstract

This invention discloses a strain of *Veillonella parvula* and its application in the preparation of products for the diagnosis and treatment of oral squamous cell carcinoma (OSCC), belonging to the field of microbial applications. This invention discloses a strain of *Veillonella parvula*, with the accession number CGMCC No. 25592. Using high-throughput 16S rDNA sequencing and bioinformatics analysis of saliva 16S rRNA sequencing data from 11 OSCC patients and a control group, this invention identified *Veillonella parvula*, which was significantly reduced in the saliva of OSCC patients. Experimental verification showed that the metabolites of *Veillonella parvula* can effectively inhibit the proliferation and invasion of TROP2-overexpressing oral squamous cell carcinoma cells and significantly promote their apoptosis. Therefore, this invention provides a new direction for the diagnosis and treatment of TROP2-overexpressing oral squamous cell carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial applications, and in particular to a strain of *Veillonella spp.* and its application in the preparation of products for the diagnosis and treatment of oral squamous cell carcinoma. Background Technology

[0002] Oral squamous cell carcinoma (OSCC) accounts for 90% of head and neck squamous cell carcinomas, causing approximately 170,000 deaths annually, mostly concentrated in developing countries in Asia. OSCC is a locally invasive tumor originating in the inner lining of the oral mucosa, causing dysfunction in eating, chewing, speaking, swallowing, and breathing. It often metastasizes to lymph nodes early, severely impacting patients' quality of life and prognosis. Treatment for OSCC primarily involves surgery combined with radiotherapy and chemotherapy, but the 5-year survival rate has not significantly improved in recent years. Studies have shown that oral microbiota dysbiosis is closely related to the development and progression of various tumors, including OSCC. Changes in oral microbiota abundance may be related to the development and progression of oral diseases. Other studies have found that dysbiosis of specific saliva flora, such as Veillonella and Actinomyces, is associated with oral epithelial cell lesions. However, current research mainly focuses on the level of changes in microbial abundance and species, lacking specific genetic studies of the microbiome, and there are no reports of a correlation between related microbial changes and oral squamous cell carcinoma. Summary of the Invention

[0003] The purpose of this invention is to provide a strain of *Veillonella spp.* and its application in the preparation of products for the diagnosis and treatment of oral squamous cell carcinoma, in order to solve the problems existing in the prior art. This strain can inhibit the proliferation and migration of TROP2-overexpressing oral squamous cell carcinoma cells and promote their apoptosis, providing a new direction for the diagnosis and treatment of oral squamous cell carcinoma.

[0004] To achieve the above objectives, the present invention provides the following solution:

[0005] This invention provides a strain of Veillonella parvula, with accession number CGMCC No. 25592, deposited on August 26, 2022, at the China General Microbiological Culture Collection Center, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0006] The present invention also provides the application of *Veillonella spp.* as a candidate marker microorganism in the preparation of oral squamous cell carcinoma diagnostic products.

[0007] Preferably, the product includes reagents and drugs.

[0008] Preferably, when the expression level of *Virginia var. virginiana* in the saliva of the test recipient is reduced by 10 times or more compared with the expression level of *Virginia var. virginiana* in the saliva of a normal person, it indicates that the test recipient is a patient with oral squamous cell carcinoma.

[0009] The present invention also provides the use of the aforementioned *Veillonella spp.* in the preparation of products for treating oral squamous cell carcinoma.

[0010] The present invention also provides the use of the aforementioned *Veillonella spp.* in the preparation of products that inhibit oral squamous cell carcinoma.

[0011] Preferably, the product includes a biological agent. More preferably, the biological agent is a probiotic agent.

[0012] The present invention also provides a product for diagnosing and / or treating and / or inhibiting oral squamous cell carcinoma, the product containing the aforementioned *Veillonella spp.*

[0013] Preferably, the product comprises reagents and biological agents. More preferably, the biological agent is a probiotic agent.

[0014] The present invention discloses the following technical effects:

[0015] This invention utilizes 16S rRNA gene sequencing technology to sequence and analyze saliva samples from OSCC patients and their control groups, identifying differentially expressed bacteria in the saliva of OSCC patients. Screening and identification were performed at both the species and strain levels, resulting in the acquisition of a strain of *Veillonella Parvula* NCTC11810. Using cell biology techniques, this invention verifies the role of *Veillonella Parvula* NCTC11810 in TROP2-overexpressing OSCC cells and its function in regulating OSCC cell proliferation, apoptosis, and invasion phenotypes. Results show that this strain can inhibit the proliferation and migration of TROP2-overexpressing oral squamous cell carcinoma cells and promote their apoptosis. Therefore, this invention provides candidate marker microorganisms for the diagnosis of oral squamous cell carcinoma and offers novel probiotics for its treatment, providing a new direction for the clinical diagnosis and treatment of oral squamous cell carcinoma. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1The 16S rDNA sequencing results of saliva samples from patients with TROP2 high expression in oral squamous cell carcinoma are shown in (A). The V4 region gene sequence of the identified Veillonella parvula NCTC11810 cell line is compared with the Blast database (B) and its expression level in the salivary flora of patients with oral squamous cell carcinoma is shown in (C).

[0018] Figure 2 The effects of Veillonella parvula NCTC11810 amplification products, inactivation products and culture supernatant on the proliferative activity of TROP2-overexpressing oral squamous cell carcinoma cells;

[0019] Figure 3 The effect of Veillonella parvula NCTC11810 amplification products, inactivation products and culture supernatant on the invasive ability of TROP2-overexpressing oral squamous cell carcinoma cells; A: Transwell assay results, B: Transwell statistical results;

[0020] Figure 4 Effects of Veillonella parvula NCTC11810 amplification products, inactivation products, and culture supernatant on apoptosis in TROP2-overexpressing oral squamous cell carcinoma cells; A: Flow cytometry results; B: Flow cytometry statistical results;

[0021] Figure 5 The effect of propionate, an active component of Veillonella parvula NCTC11810 metabolite, on the proliferative activity of TROP2-overexpressing oral squamous cell carcinoma cells;

[0022] Figure 6 The effect of propionate, an active metabolite of Veillonella parvula NCTC11810, on the invasive ability of TROP2-overexpressing oral squamous cell carcinoma cells; A: Transwell assay results, B: Transwell statistical results;

[0023] Figure 7 The effect of propionate, an active metabolite of Veillonella parvula NCTC11810, on promoting apoptosis in TROP2-overexpressing oral squamous cell carcinoma cells; A: Flow cytometry results; B: Flow cytometry statistical results;

[0024] Figure 8 The changes in TROP2 expression, PI3K, AKt and their phosphorylation expression after treatment with propionate, the active component of Veillonella parvula NCTC11810 metabolites. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] Example 1: Screening and Identification of *Virginia var. var.*

[0031] Saliva samples were collected from 11 OSCC patients and corresponding clinical samples from control groups. Based on 16S rRNA analysis, we identified the differentially expressed bacteria in the saliva of OSCC patients and control groups at the species level. Figure 1A) The saliva sample was then serially diluted and spread onto Columbia blood agar plates to obtain single clones. These single clones were then cultured and selected for incubation in liquid medium under suitable conditions. The liquid medium consisted of the following components: 5.0 g tryptone, 3.0 g yeast extract, 1.0 g glucose, 0.75 g sodium thioglycolate, 1.0 g Tween 80, and 1 L water; pH 7.5. The medium was autoclaved at 121°C for 15 minutes, cooled to room temperature, and aseptically treated. Two vials of 60% sodium lactate (2 mL) and one vial of vancomycin (1 mL) were added to every 100 mL of medium and mixed thoroughly. The resulting bacterial culture was sent to a sequencing company for sequencing. Based on the sequencing results, the nucleic acid sequence was entered into the NCBI-Blast database, and the BLAST command was used to search for strains with different sequence matching degrees. Sequences with a matching degree of 95% or higher were selected to identify the marker bacteria.

[0032] The bacterium was identified as a mutant strain of *Virginia var. var.*, NCTC11810. Figure 1 B).

[0033] The V4 region sequence of the saliva sample genome was further amplified by PCR using the universal microbial primers 27F: AGAGTTTGATCCTGGCTCAG; 1429R: GGTTACCTTGTTACGACTT. The amplification program was as follows: 98℃ for 1 min; 98℃ for 10 s, 68℃ for 15 s, 72℃ for 3 min; 30 cycles; 72℃ for 5 min.

[0034] Amplified sequence of Veillonella parvula V4 region (SEQ ID NO:1):

[0035]

[0036] At the species level, the expression level of the Veillonella parvula mutant strain NCTC11810 was found to be 10-fold lower in saliva of the OSCC group. Figure 1 C).

[0037] The Veillonella parvula mutant strain NCTC11810, with accession number CGMCCNo.25592, was deposited on August 26, 2022, at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0038] Example 2: CCK8 assay to detect the effect of Veillonella tinctoria NCTC11810 on the proliferation activity of OSCC cells.

[0039] The *Veillaris var. spp.* obtained in Example 1 was inoculated into liquid culture medium for overnight expansion. The bacterial cells and supernatant were separated by centrifugation at 5000 rpm for 5 min. The bacterial cells were washed three times with PBS and resuspended in cell culture medium. The supernatant was then reacted with normal oral epithelial cells (HOK) and TROP2-overexpressing HN6 cells (1×10⁶ cells) in 96-well plates at a concentration of 5 μg / mL. 4 The cells were obtained from Nanjing Children's Hospital. The supernatant was diluted by the same factor and then co-cultured with the cells. The cells were inactivated at 121℃ for 20 minutes with 5 μg / mL of bacterial cells. After cooling to room temperature, the cells were co-cultured with the cells. The empty complete culture medium group served as the control group, and the cell-free group served as the blank group. After 2 hours of culture, the culture medium was removed, and the cells were washed twice with sterile PBS and replaced with fresh culture medium. The cells were then cultured for another 24 hours. 10 μL of CCK solution was added to each well, and the cells were incubated at 37℃ for 2 hours. The absorbance was measured at 450 nm using a microplate reader.

[0040] like Figure 2 As shown, the results indicate that *Virginia var. var.* NCTC11810 inhibits the proliferation activity of OSCC cells.

[0041] Example 3: Transwell assay to detect the effect of *Virginia var. chinensis* NCTC11810 on the invasion of OSCC cells.

[0042] A 15-fold dilution of Matrigel was placed at the bottom of the Transwell chamber and air-dried at 4°C. Following the CCK8 experimental grouping method, *Virginia var. virginiana* NCTC11810, inactivated *Virginia var. virginiana* NCTC11810, culture supernatant, and empty complete medium were respectively mixed with HOK and TROP2-overexpressing HN6 cell lines (1×10⁻⁶). 4After co-suspending, 200 μL was added to the chamber, and after 2 hours, the culture medium was replaced and cultured for another 24 hours. Crystal violet staining was used to detect the number of cells that had passed through.

[0043] like Figure 3 As shown, the results indicate that *Virginia var. virginia* NCTC11810 inhibits the invasive ability of OSCC cells.

[0044] Example 4: Flow cytometry assay to detect the effect of *Virginia var. var.* NCTC11810 on apoptosis in OSCC cells.

[0045] According to the co-culture method of *Virginia valerate* and OSCC cells in the CCK8 experimental grouping method, cells were collected after 4 hours, centrifuged at 1000 rpm for 5 min, washed twice with PBS, and resuspended with binding buffer. According to the instructions of the cell apoptosis detection kit, FITC and PI single positive staining wells and negative control wells were set up. FITC and PI were added to the sample wells at the same time, gently mixed, and incubated at room temperature in the dark for 15 min before detection.

[0046] like Figure 4 As shown in the figure, the results indicate that *Virginia var. var.* NCTC11810 promotes apoptosis in OSCC cells.

[0047] Example 5: Effect of propionate, the active ingredient of Veillonella parvula NCTC11810 metabolite, on the proliferative activity of TROP2-overexpressing oral squamous cell carcinoma cells. Sodium propionate was serially diluted at 0 mM, 10 mM, 20 mM, 50 mM, and 100 mM and added to pre-coated HOK and HN6 cells (1 × 10⁶ cells per well). 4 In each well, after culturing for 24 hours, 10 μL of CCK solution was added to each well, and the mixture was incubated at 37°C for 2 hours. The absorbance was measured at 450 nm using a microplate reader.

[0048] like Figure 5 As shown in the figure, the results indicate that sodium propionate inhibits the proliferation activity of OSCC cells.

[0049] Example 6: Effect of propionate, the active component of Veillonella parvula NCTC11810 metabolite, on the invasive ability of TROP2-overexpressing oral squamous cell carcinoma cells.

[0050] Layer the bottom of the Transwell chamber with a 15-fold dilution of Matrigel and air dry at 4°C. Add 10 mM sodium propionate to the HOK, TROP2-overexpressing HN6 cell line (1×10⁻⁶). 4 The cells were then plated into the upper chambers of the matrix gel, and the number of cells that passed through was detected by crystal violet staining 24 hours later.

[0051] like Figure 6 As shown in the figure, the results indicate that sodium propionate inhibits the invasive ability of OSCC cells.

[0052] Example 7: Flow cytometry assay to detect the effect of sodium propionate on apoptosis in OSCC cells.

[0053] Add DMEM medium containing 10 mM sodium propionate to the pre-coated 6-well cell plate. After culturing for 24 hours, collect the cells, centrifuge at 1000 rpm for 5 min, wash twice with PBS, and resuspend in binding buffer. According to the instructions of the cell apoptosis detection kit, set up FITC and PI single positive staining wells and negative control wells. Add FITC and PI to the sample wells at the same time, mix gently, and incubate at room temperature in the dark for 15 min before detection.

[0054] like Figure 7 As shown in the figure, the results indicate that sodium propionate promotes apoptosis in OSCC cells.

[0055] Example 8: Sodium propionate treatment inhibited TROP2 pathway activity in OSCC cells.

[0056] Add DMEM medium containing 10 mM sodium propionate to pre-coated 6-well plates of cells. After culturing for 24 hours, take samples, add protein lysis buffer, and lyse on ice for 30 minutes. Collect the protein, boil it in SDS for 10 minutes, and detect the expression of the TROP2 / PI3K / AKt pathway by Western Blot.

[0057] like Figure 8 As shown, the results indicate that sodium propionate inhibits the expression of TROP2 and the activation of PI3K and AKt in HN6 cells, demonstrating that sodium propionate inhibits the malignant behavior of oral squamous cell carcinoma cells with high TROP2 expression by inhibiting the activity of the TROP2 pathway.

[0058] As can be seen from the above embodiments, this invention utilizes 16S rRNA gene sequencing technology to sequence and analyze saliva samples from 5 OSCC patients and their control group, enriching multiple bacterial groups including Veillonella. Further analysis revealed that the abundance of Veillonella Parvula was reduced in OSCC. A Veillonella Parvula mutant strain, NCTC11810, was isolated and screened; detection showed that this mutant strain exhibited a 10-fold reduction in expression in the saliva of OSCC patients.

[0059] Further investigation using CCK8, Transwell assays, and flow cytometry to verify the regulatory effects of the *Virococcus spp.* mutant strain NCTC11810 on OSCC cell proliferation, apoptosis, and invasion revealed that the live amplification products and their culture supernatant significantly inhibited the proliferation and invasion of TROP2-overexpressing OSCC cell lines and promoted apoptosis. Inactivated products, however, did not exhibit these functions, nor did they possess this ability on normal oral epithelial cells. This indicates that the metabolites of the *Virococcus spp.* mutant strain NCTC11810, rather than the cell itself, can significantly inhibit the proliferation and invasion of TROP2-overexpressing OSCC cell lines and promote apoptosis. It is known that the main component of the metabolites of the *Virococcus spp.* mutant strain NCTC11810 is short-chain fatty acid propionate. In this invention, propionate was used to treat TROP2-overexpressing OSCC cells, and the results showed that it had the same function as the culture supernatant of the *Virococcus spp.* mutant strain NCTC11810.

[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. *Virginia var. var.* ( Veillonella parvula Its application in the preparation of biological agents for inhibiting oral squamous cell carcinoma is characterized by, The preservation number of *Veillonella spp.* is CGMCC No. 25592. The inhibition of oral squamous cell carcinoma involves using *Veillonella spp.* to inhibit the proliferation and invasion of the TROP2-overexpressing OSCC cell line. The cancer cells of the oral squamous cell carcinoma are HN6 cells that overexpress TROP2.

2. *Virginia var. var.* ( Veillonella parvula Its application in the preparation of biological agents for treating oral squamous cell carcinoma, characterized in that, The preservation number of the *Vironella spp.* is CGMCC No. 25592. The treatment of oral squamous cell carcinoma utilizes the *Vironella spp.* to inhibit the proliferation and invasion of the TROP2-overexpressing OSCC cell line. The cancer cells of the oral squamous cell carcinoma are HN6 cells that overexpress TROP2.

3. A biological preparation for treating and / or inhibiting oral squamous cell carcinoma, characterized by, The biological agent contains *Vironella spp.*, whose preservation number is CGMCC No. 25592.

Citation Information

Patent Citations

  • Bacterial compositions and methods of use thereof

    CN107949393A

  • Compositions and methods for treating cancer and immune disorders using veillonella bacteria

    CN112074283A

  • Microbiome biomarkers immunotherapy responsiveness: diagnostic, prognostic and therapeutic uses thereof

    US20210177918A1