Use of myb3r1 gene in regulating the number of nodules on a plant
By regulating the expression or activity of the MYB3R1 gene in legumes to control the number of root nodules, the problem of unclear regulatory mechanisms in the formation of root nodules in legumes was solved, and nitrogen utilization efficiency and environmentally friendly high-efficiency nitrogen fixation were achieved.
Patent Information
- Application Number
- CN202111627956.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-12-28
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2041-12-28
AI Technical Summary
The complex regulatory mechanisms of root nodule formation in legumes are not fully understood in the current technology, resulting in low nitrogen use efficiency, which affects crop yield and causes environmental pollution.
By regulating the expression or activity of MYB3R1 in rhizobium plants, including upregulation or downregulation, methods such as gene editing, gain-of-function mutations, and regulators can be used to control the number of rhizobium and promote or inhibit rhizobium formation.
It can significantly increase or decrease the number of root nodules, improve nitrogen use efficiency, reduce the demand for nitrogen fertilizer, promote nitrogen fixation capacity and biomass, and achieve environmentally friendly and efficient nitrogen fixation.
Smart Images

Figure HDA0003440411420000011 
Figure HDA0003440411420000012 
Figure HDA0003440411420000021
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and botany; more specifically, this invention relates to... MYB3R1 Application of genes in regulating the number of root nodules in root-knot plants. Background Technology
[0002] Low nitrogen use efficiency is a major factor limiting crop yield. Agricultural production often relies heavily on industrial nitrogen fertilizers to increase crop yield per unit area. However, excessive nitrogen fertilizer application not only causes economic losses and resource waste but also leads to serious environmental problems such as surface water pollution and soil acidification, hindering sustainable agricultural development. Besides the rational application of nitrogen fertilizers and the combined use of inorganic and organic fertilizers, a more important approach to solving these problems is to fully utilize the symbiotic nitrogen-fixing mechanism between leguminous crops and rhizobia.
[0003] Legumes, such as soybeans, peanuts, and alfalfa, are rich in protein and nutrients, making them an important source of plant-based protein for humans and animals. Like other crops, legumes require a significant amount of nitrogen for their growth and development. However, legumes can obtain nitrogen not only from the soil but also from the air. This is because most legumes can form a mutually beneficial symbiotic relationship with nitrogen-fixing bacteria in the soil, specifically rhizobia, forming specialized lateral organs called root nodules. Subsequently, the biological nitrogen fixation by the rhizobia within the nodules converts free nitrogen from the air into nitrogen-containing compounds to meet the plant's own growth and development needs. Furthermore, after legumes die, the nitrogen they have fixed is released into the soil and utilized by other plants, contributing to soil nourishment and crop rotation.
[0004] Therefore, understanding and exploring the mechanisms of the symbiotic interaction between legumes and rhizobia has always been an important research topic. Existing studies have shown that the formation of root nodules in legumes is subject to complex and delicate regulation by both the plant and the rhizobia, with a large amount of orderly information exchange between them.
[0005] However, the field still knows very little about the factors that influence such complex and sophisticated regulatory mechanisms, and remains at a relatively basic research stage, urgently needing to find some new research targets. Summary of the Invention
[0006] The purpose of this invention is to provide MYB3R1 Application of genes in regulating the number of root nodules in root-knot plants.
[0007] In a first aspect of the invention, a method for regulating the number of root nodules in a root-nodule plant or a method for preparing a root-nodule plant with an increased or decreased number of root nodules is provided, comprising: regulating the expression or activity of MYB3R1 in the root-nodule plant, said regulation including upregulation or downregulation.
[0008] In one or more embodiments, the upregulation of MYB3R1 expression or activity in plants includes (but is not limited to): introducing the gene encoding MYB3R1 or an expression construct or vector containing the gene encoding MYB3R1 into plants; performing gain-of-function mutations on MYB3R1 (e.g., for plants with low MYB3R1 function / activity); promoting MYB3R1 expression by expressing an enhancing promoter or a tissue-specific promoter; or promoting MYB3R1 expression by an enhancer.
[0009] In one or more embodiments, the gain-of-function mutation of MYB3R1 includes: targeted modification of the gene encoding MYB3R1 to alter its low or no function / activity. For example, in the case of premature termination of translation of MYB3R1, altering the type of the premature termination-related bases to restore the function / activity of the encoded protein.
[0010] In one or more embodiments, downregulating the expression or activity of MYB3R1 in plants includes: knocking out or silencing the gene encoding MYB3R1 in plants, or inhibiting the activity of MYB3R1; preferably, knocking out or silencing the gene encoding MYB3R1 in plants includes:
[0011] Gene editing using the CRISPR system to knock out the coding gene of MYB3R1, and homologous recombination to knock out the coding gene of MYB3R1.
[0012] Silencing MYB3R1 by interfering molecules that specifically interfere with the expression of the gene encoding MYB3R1;
[0013] The MYB3R1 gene is fused with a dominant repressor domain to inhibit the function of MYB3R1 in activating downstream genes; preferably, the dominant repressor domain is SRDX (plant-specific ERF-associated amphiphilic repression domain).
[0014] In plants containing MYB3R1, a loss-of-function mutation of MYB3R1 is performed.
[0015] In one or more embodiments, the method for preparing root-nodule plants with increased or decreased root nodule number further includes: hybridizing a transgenic plant whose expression or activity of MYB3R1 has been regulated with a root-nodule plant with a root-nodule plant without the introduction of a polypeptide or its encoding gene of MYB3R1 to obtain hybrid offspring.
[0016] In another aspect of the invention, there is provided the use of MYB3R1 or a regulator thereof for regulating the number of nodules in a root-nodule plant or for preparing a root-nodule plant with an increased or decreased number of nodules, said regulation including upregulation or downregulation.
[0017] In one or more embodiments, the regulator is a MYB3R1 upregulator that increases the number of root nodules, the upregulator comprising: an exogenous MYB3R1 encoding gene or an expression construct or vector containing the encoding gene.
[0018] In one or more embodiments, the expression construct includes an enhancing promoter, a tissue-specific promoter, or an enhancer; or, a reagent for gain-of-function point mutation of MYB3R1.
[0019] In one or more embodiments, the reagent for gain-of-function point mutation of MYB3R1 is a reagent that reverts the mutant to the wild-type MYB3R1 in plants with MYB3R1 mutations; preferably, for plants with low MYB3R1 function / activity, a complementary plasmid is constructed, in which the coding sequence of the wild-type gene is introduced, and the complementary plasmid is transformed into the plant.
[0020] In one or more embodiments, the regulator is a MYB3R1 downregulator that reduces the number of root nodules. The downregulator includes: a reagent that knocks out or silences MYB3R1, or a reagent that inhibits MYB3R1 activity; preferably, it includes: a CRISPR gene editing reagent, a homologous recombination reagent, or a site-directed mutagenesis reagent targeting MYB3R1, wherein the reagent induces a loss-of-function mutation in MYB3R1; an interfering molecule that specifically interferes with the expression of the gene encoding MYB3R1, or a dominant repressor domain that can fuse with the dominant repressor domain to inhibit the function of MYB3R1 in activating downstream genes; preferably, the dominant repressor domain is SRDX.
[0021] In one or more embodiments, the terms "upgrade", "promote", "enhance" or "increase" indicate a significant upgrade, promotion, enhancement or increase, such as an upgrade, promotion, enhancement or increase of 5%, 10%, 20%, 40%, 60%, 80%, 90% or higher.
[0022] In one or more embodiments, the downregulation, suppression, or reduction refers to a significant downregulation, suppression, or reduction, such as a downregulation, suppression, or reduction of 5%, 10%, 20%, 40%, 60%, 80%, 90%, or higher.
[0023] In one or more embodiments, the downregulated expression includes missing expression.
[0024] In one or more embodiments, the increase in the number of root nodules means a significant increase in the number of root nodules, for example, an increase of 1% to 100%; more specifically, for example, an increase of 2%, 4%, 6%, 8%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 60%, 80%, or more.
[0025] In one or more embodiments, the reduction in the number of root nodules means a significant reduction in the number of root nodules, for example, a reduction of 1% to 100%; more specifically, for example, a reduction of 2%, 4%, 6%, 8%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 60%, 80%, or more.
[0026] In one or more embodiments, the root nodule plant is a legume; preferably, the legume includes (but is not limited to): alfalfa, soybean, birdsfoot root, pea, peanut, kidney bean, mung bean, adzuki bean, broad bean, cowpea or milkvetch.
[0027] In one or more embodiments, the MYB3R1 includes a cDNA sequence, a genomic sequence (gDNA), or a sequence that is artificially optimized or modified based on them.
[0028] In one or more embodiments, the MYB3R1 includes its homologs.
[0029] In one or more embodiments, the amino acid sequence of the MYB3R1 polypeptide is selected from the group consisting of: (i) a polypeptide having the amino acid sequence shown in SEQ ID NO: 2; (ii) a polypeptide derived from (i) having the regulatory trait function formed by substituting, deleting, or adding one or more (e.g., 1-20, 1-10, 1-5, 1-3) amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; (iii) a polypeptide having the regulatory trait function with an amino acid sequence homology ≥80% (preferably ≥85%, ≥90%, ≥95%, or ≥98%) to the amino acid sequence shown in SEQ ID NO: 2; (iv) an active fragment of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2; or, (v) a polypeptide formed by adding a tag sequence or restriction enzyme site sequence to the N or C end of a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or by adding a signal peptide sequence to its N end.
[0030] In one or more embodiments, the increase in the number of root nodules in the rhizophyte further promotes the optimization of traits in the rhizophyte, including (but not limited to): enhancing the nitrogen-fixing capacity of the rhizophyte roots; enhancing the utilization of nitrogen by the rhizophyte; reducing the rhizophyte's demand for nitrogen fertilizer; increasing the rhizophyte biomass; or increasing the rhizophyte yield.
[0031] In another aspect of the invention, a plant cell, tissue, or organ is provided, wherein an exogenous MYB3R1 upregulator is contained; wherein the MYB3R1 upregulator comprises: an exogenous MYB3R1 encoding gene or an expression construct or vector containing the encoding gene.
[0032] In one or more embodiments, the expression construct includes an enhancing promoter, a tissue-specific promoter, or an enhancer; or, a reagent for gain-of-function point mutation of MYB3R1.
[0033] In another aspect of the invention, a plant cell, tissue, or organ is provided, containing an exogenous MYB3R1 downregulator; said MYB3R1 downregulator includes: a reagent for knocking out or silencing MYB3R1, a reagent for inhibiting MYB3R1 activity; preferably including: a CRISPR gene editing reagent, a homologous recombination reagent, or a site-directed mutagenesis reagent targeting MYB3R1, said reagent causing a loss-of-function mutation in MYB3R1; an interfering molecule that specifically interferes with the expression of the gene encoding MYB3R1, or a dominant repressor domain, which can fuse with the dominant repressor domain to inhibit the function of MYB3R1 in activating downstream genes; preferably, the dominant repressor domain is SRDX.
[0034] In another aspect of the invention, a use is provided for the root nodule plant MYB3R1, for use as a molecular marker for identifying root nodule plant traits, or as a molecular marker for targeted screening of plants; wherein the trait includes: the number of root nodules in the root nodule plant.
[0035] In another aspect of the present invention, a method for selecting or identifying root-nodule plants is provided, comprising: identifying the expression or sequence characteristics of MYB3R1 protein or its gene in a test plant; if the MYB3R1 protein or its gene in the test plant is highly expressed or highly active, then the plant is a plant with a high number of root nodules; if the MYB3R1 protein or its gene in the test plant is poorly expressed (including not expressed) or poorly active (including inactive), then the plant is a plant with a low number of root nodules.
[0036] In one or more embodiments, high expression or high activity means a statistically significant increase in expression or activity compared to the average expression or activity of similar or identical plants.
[0037] In one or more embodiments, the low expression or low activity refers to a statistically significant reduction in expression or activity compared to the average expression or activity of similar or identical plants.
[0038] In one or more embodiments, a high number of root nodules means a significant increase in the number of root nodules compared to the number of root nodules of the same type or plant species.
[0039] In one or more embodiments, the low number of root nodules refers to a significant reduction in the number of root nodules compared to the number of root nodules of the same type or plant species (e.g., a reduction of 2%, 4%, 6%, 8%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 60%, 80% or more).
[0040] In another aspect of the present invention, a method is provided for screening substances (potential substances) that regulate the number of root nodules in rhizobium plants, comprising: (1) adding a candidate substance to a system expressing MYB3R1; (2) detecting the system and observing the expression or activity of MYB3R1 therein; if the expression or activity of MYB3R1 is increased (significantly increased, such as increased by 10%, 20%, 40%, 60%, 80%, 90% or higher), it indicates that the candidate substance is a substance that can be used to increase the number of root nodules in rhizobium plants; if the expression or activity of MYB3R1 is decreased (significantly decreased, such as decreased by 10%, 20%, 40%, 60%, 80%, 90% or lower), it indicates that the candidate substance is a substance that can be used to reduce the number of root nodules in rhizobium plants.
[0041] In one or more embodiments, the screening method further includes setting up a control group to clearly distinguish the difference in MYB3R1 expression or activity between the test group and the control group.
[0042] In one or more embodiments, the candidate substances include (but are not limited to): regulatory molecules (such as upregulators, small molecule compound gene editing constructs, etc.) designed to target MYB3R1 or its encoding gene or their upstream or downstream proteins or genes.
[0043] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description
[0044] Picture 1 , MYB3R1-OE The phenotype was compared with that of plants transformed into empty vectors as controls.
[0045] Left: Phenotype of alfalfa plants transfected with empty vector and inoculated with rhizobium Rm2011 (A17);
[0046] Right side: Inoculated with Rhizobium Rm2011 MYB3R1-OE Phenotypic of Tribulus terrestris.
[0047] Picture 2 The number of root nodules in alfalfa plants converted to EV and MYB3R1-OE, respectively.
[0048] Picture 3 The number of root nodules in alfalfa plants converted to EV and MYB3R1-SRDX, respectively. Detailed Implementation
[0049] This invention is the first to study and reveal a novel gene. MYB3R1 It encodes a key biological function MYB3R1 The polypeptide, which can regulate the number of root nodules in rhizobium plants, is a potential plant genetic improvement gene. MYB3R1 A relatively high expression level indicates an increase in the number of root nodules in rhizobium plants. This invention discloses a novel mechanism regulating the root nodule trait in rhizobium plants, which has significant theoretical implications for the genetic improvement of plant traits.
[0050] the term
[0051] As used herein, "plant" includes plants that express MYB3R1. Based on knowledge in the art, plants containing MYB3R1 or its homologs possess the mechanisms of action claimed in this invention, enabling them to achieve the technical effects claimed in this invention.
[0052] As used herein, "nodule-forming plants" primarily refers to plants that can form nodules on their roots through invasion and stimulation by rhizobia. "Nodule-forming plants" may include legume nodule plants and non-legume nodule plants. Preferably, the "nodule-forming plants" are legumes.
[0053] As used herein, “nodule plants” also include “nodule-like plants”, which refers to plants with nodule-like or root-nodule-like structures.
[0054] As used herein, “improved traits” refers to improved plant characteristics, including but not limited to: increasing the number of nodules in nodules, promoting the nitrogen-fixing capacity of nodules, promoting nitrogen utilization in nodules, reducing the nitrogen fertilizer requirement of nodules, increasing nodule biomass, and increasing nodule yield.
[0055] As used in this article, terms such as "improvement of plant traits," "improved traits," "improved plant traits," and "trait improvement" can be used interchangeably. They refer to statistically significant improvements in characteristics such as light energy utilization efficiency, photosynthetic efficiency, growth, and biomass (including yield and tiller number) of plants modified by the technical solution of this invention compared to unmodified plants (such as wild-type plants).
[0056] Regarding "control plants," selecting appropriate control plants is a routine part of experimental design. These can include corresponding wild-type plants or transgenic plants without the target gene. Control plants are generally the same plant species or even varieties of the same species or class as the plant being evaluated. Control plants can also be individuals from transgenic plants that have lost their transgenic components due to segregation. As used in this article, control plants refer not only to whole plants but also to plant parts, including seeds and seed portions.
[0057] As used herein, the term "biomass" can refer to the nutrient biomass of a plant, to reproductive organs, and / or to propagules. "Biomass" includes yield, number of tillers, etc.
[0058] As used herein, the terms “enhancement,” “improvement,” or “enhancement” are interchangeable and should be interpreted in the sense of comparison with the control plant as defined herein, such as 2–100%, such as at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 40%, 60%, 80%, 90%, or higher.
[0059] As used herein, the terms “introduction” or “transformation” include the transfer of exogenous polynucleotides into host cells, and there are no particular limitations on the methods of “introduction” or “transformation” in this invention.
[0060] MYB3R1
[0061] MYB3R1 The gene encodes a transcription factor belonging to the MYB (Myeloblastosis) protein family. MYB3R1 proteins are highly conserved in most eukaryotic genomes, and the expression of many cell cycle genes is strictly regulated by the MYB3R1 protein family.
[0062] The MYB protein family is large, especially in plants. In the model plant Arabidopsis thaliana, there are at least 100 MYB proteins with diverse functions. Most of these MYB proteins act as transcription factors, regulating the expression of multiple genes. The MYB3R1 protein is highly conserved in most eukaryotic genomes, and numerous studies have shown that the expression of many cell cycle genes is tightly regulated by the MYB3R1 protein family.
[0063] However, in existing research, those skilled in the art do not understand... MYB3R1 The correlation between genes and root nodule regulation in rhizomatous plants. The inventors have cloned a cell cycle-related gene from alfalfa for the first time. MYB3R1 Studies have shown that it is closely related to the number of root nodules in rhizobium-bearing plants. The inventors have elucidated for the first time... MYB3R1 Molecular mechanisms by which genes participate in regulating the number of root nodules in root-knot plants.
[0064] The inventors unexpectedly discovered that overexpression in rhizobium plants... MYB3R1 Following gene expression, the expression of multiple cell cycle genes was increased to varying degrees compared to the control, indicating that MYB3R1 activates the expression of multiple cell cycle-related genes, suggesting that MYB3R1 may activate cell division in the early stages of nodule formation. Furthermore, the inventors discovered that MYB3R1 can interact with the transcription factor DELLA, highlighting the importance and complexity of MYB3R1's role in nodule symbiosis. These experimental data demonstrate that the transcription factor MYB3R1 promotes nodule organogenesis by activating the expression of downstream genes.
[0065] In this invention, MYB3R1 refers to a polypeptide having the sequence SEQ ID NO: 2 or its encoding gene, and also includes sequence variations having the same function as the MYB3R1 polypeptide. The encoding gene can be gDNA or cDNA, and may also contain a promoter. For example, the cDNA has the nucleotide sequence shown in SEQ ID NO: 1. The sequence of the encoding gene also includes sequences degenerate with the sequences provided in this invention.
[0066] Variations of the MYB3R1 polypeptide include (but are not limited to): deletions, insertions, and / or substitutions of several amino acids (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, and even more preferably 1-8 or 1-5); and additions or deletions of one or more amino acids (typically up to 20, preferably up to 10, and more preferably up to 5) at the C-terminus and / or N-terminus. Any protein with high homology to the MYB3R1 polypeptide (e.g., 70% or higher homology to the polypeptide sequence shown in SEQ ID NO: 2; preferably 80% or higher; more preferably 90% or higher, such as 95%, 98%, or 99% homology) and having the same function as the MYB3R1 polypeptide is also included in this invention. In this invention, polypeptides derived from species other than alfalfa that have high homology to the sequence shown in SEQ ID NO: 2, or that play the same or similar roles in the same or similar regulatory pathways, are also included.
[0067] The invention also includes mutant forms of MYB3R1 or truncated polypeptide fragments that substantially retain the activity of the full-length protein.
[0068] In this invention, "MYB3R1" also includes its homologs. It should be understood that although this invention preferably studies MYB3R1 obtained from a specific species, alfalfa, other polypeptides or genes obtained from other species that are highly homologous to MYB3R1 (e.g., having more than 60%, such as 70%, 80%, 85%, 90%, 95%, or even 98% sequence identity) are also within the scope of this invention.
[0069] The polynucleotide (gene) encoding the MYB3R1 polypeptide can be a natural gene from a plant or a degenerate sequence thereof.
[0070] Vectors containing the said coding sequence, and host cells genetically engineered using the said vector or polypeptide coding sequence, are also included in this invention. Methods well known to those skilled in the art can be used to construct suitable expression vectors.
[0071] The host cell is usually a plant cell. Transformation of plants can generally be achieved using methods such as Agrobacterium-mediated transformation or gene gun transformation, including leaf disc transformation and embryonic transformation; Agrobacterium-mediated transformation is preferred. Transformed plant cells, tissues, or organs can be regenerated into plants using conventional methods, thereby obtaining plants with altered traits compared to the wild type.
[0072] MYB3R1 Application of genes in controlling the number of root nodules in legumes
[0073] In the inventors' research, a method for regulating the growth, development, and number of root nodules in rhizomatous plants was provided. The inventors also cloned for the first time a novel gene with a specific function from alfalfa. MYB3R1 Gene. Functional analysis showed that this gene is closely related to the number of nodules in rhizobium plants. Therefore, this gene can be applied to plant improvement to obtain plants with altered nodule and nitrogen-fixing traits. Thus, one object of this invention is to provide a gene that regulates the number of nodules in rhizobium plants, its application in efficient nitrogen fixation, and methods for applying it.
[0074] Through genetic and molecular biology experiments, the inventors discovered that *Alfalfa truncatum*, a model leguminous plant, expresses... MYB3R1 The gene can significantly increase the number of root nodules in plants, indicating that MYB3R1 plays a positive regulatory role in controlling the number of root nodules in nodule-producing plants. It can be overexpressed in nodule-producing plants using genetic engineering and other techniques. MYB3R1 Using genes to regulate the number of root nodules in rhizotrophic plants, thereby controlling their efficient nitrogen fixation, provides an environmentally friendly method for efficient nitrogen fixation in legumes.
[0075] Based on the inventor's new discovery, the present invention provides a method for improving the traits of root nodules or preparing root nodules with improved traits, comprising: upregulating the expression or activity of MYB3R1 in the plant; wherein the improved trait includes: increasing the number of root nodules in the root nodule plant.
[0076] Based on the inventor's new discovery, the present invention provides a use of MYB3R1 or its upregulator for improving the traits of root nodule plants or preparing root nodule plants with improved traits; the improved traits include: increasing the number of root nodules in root nodules plants.
[0077] Therefore, the present invention provides a method for causing plants, particularly plants that express low (including no) MYB3R1, to exhibit a significant increase in the number of root nodules, comprising: upregulating the expression or activity of MYB3R1.
[0078] It should be understood that, after understanding the functions of MYB3R1 and the signaling pathways containing MYB3R1 (preferably, also including its upstream and downstream genes), various methods well known to those skilled in the art can be used to regulate the expression or activity of MYB3R1 or to regulate related upstream or downstream genes of MYB3R1. For example, various methods well known to those skilled in the art can be used to overexpress MYB3R1 or its upstream or downstream genes.
[0079] In this invention, the upregulators of the MYB3R1 protein or its encoding gene, its upstream or downstream proteins or their encoding genes include promoters, agonists, and activators. The terms "upregulation" and "promotion" include "upregulation" and "promotion" of protein activity or protein expression, and these are statistically significant "upregulation" and "promotion." Any substance that can increase the activity of MYB3R1 or its signaling pathway proteins (including its upstream and downstream proteins), increase the stability of MYB3R1 or its signaling pathway proteins, upregulate the expression of MYB3R1 or its signaling pathway genes, increase the effective duration of MYB3R1 or its signaling pathway proteins, or increase the phosphorylation / activation level of various proteins can be used in this invention as substances useful for upregulating MYB3R1 or signaling pathways. These substances can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level.
[0080] This invention also provides a method for upregulating MYB3R1 expression in plants, the method comprising: transferring the coding gene of MYB3R1 or an expression construct or vector containing the coding gene into plants. Alternatively, gain-of-function mutations may be performed on MYB3R1 or its coding gene; expression of the coding gene of MYB3R1 may be promoted by expressing an enhancing promoter or a tissue-specific promoter; or, expression of the coding gene of MYB3R1 may be promoted by an enhancer.
[0081] It should be understood that other methods for upregulating MYB3R1 expression in plants should also be included in this invention.
[0082] It is understandable that, given the close correlation between the number of root nodules and nitrogen fixation and utilization in rhizotrophic plants, an increase in the number of root nodules will inevitably promote nitrogen fixation and utilization, thereby increasing biomass or yield. Therefore, in this invention, based on MYB3R1 increasing the number of root nodules in rhizotrophic plants, it will inevitably further promote the optimization of traits in rhizotrophic plants, including but not limited to: enhancing the nitrogen fixation capacity of rhizotrophic plant roots; enhancing nitrogen utilization in rhizotrophic plants; reducing the nitrogen fertilizer requirement of rhizotrophic plants; increasing rhizotrophic plant biomass; or increasing rhizotrophic plant yield. The regulatory effects of MYB3R1 on these traits are also covered in this invention.
[0083] It is understandable that, in addition to exerting its positive regulatory effect and increasing the number of root nodules in rhizotrophic plants by overexpressing or increasing MYB3R1 activity, the new findings of this invention can also be used to negatively regulate the number of root nodules in rhizotrophic plants, for example by introducing downregulators of MYB3R1 protein or its encoding gene into rhizotrophic plants to reduce the number of root nodules in rhizotrophic plants.
[0084] In this invention, the downregulator of MYB3R1 protein or its encoding gene refers to any agent that can reduce the activity of MYB3R1 protein, reduce the stability of MYB3R1 protein or its encoding gene, downregulate the expression of MYB3R1 protein, reduce the effective duration of MYB3R1 protein, or inhibit... MYB3R1 Substances that inhibit gene transcription and translation, or reduce protein phosphorylation / activation levels, can be used in this invention as substances useful for downregulating MYB3R1. These can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level. For example, the downregulator is a specific interferon. MYB3R1 Interfering RNA molecules or antisense nucleotides with gene expression; or specific editing MYB3R1 Gene editing reagents, etc.
[0085] This invention also provides a method for downregulating MYB3R1 in plants, including... MYB3R1 Genes can be downregulated through targeted mutation, editing, or recombination. As a more specific example, the CRISPR / Cas9 system is used for gene editing to knock out or downregulate target genes. Suitable sgRNA target sites lead to higher gene editing efficiency; therefore, appropriate target sites should be designed and identified before gene editing begins. After designing specific target sites, in vitro cell activity screening is necessary to obtain effective target sites for subsequent experiments.
[0086] Another method for downregulating MYB3R1 expression in plants includes, for example: (1) using interferon... MYB3R1 (1) The gene expression interference molecule is transferred into plant cells, tissues, organs, or seeds to obtain plant cells, tissues, organs, or seeds transformed with the interference molecule; (2) the plant cells, tissues, organs, or seeds transformed with the interference molecule obtained in step (1) are regenerated into plants. Preferably, the method further includes: (3) selecting plant cells, tissues, or organs transformed with the vector; and (4) regenerating plants from the plant cells, tissues, or organs in step (3).
[0087] It should be understood that the methods for downregulating target genes / proteins in plants are not limited to those listed above.
[0088] This invention is the first to clone a gene with a novel function from alfalfa. MYB3R1 This study explores the molecular mechanism by which this gene controls the number of root nodules, providing genetic resources and theoretical basis for the molecular design of efficient nitrogen fixation and high yield in rhizobium plants. Furthermore, molecular biology techniques such as overexpression are used to finely regulate the number of root nodules, providing technical support for the subsequent creation of breeding materials suitable for efficient nitrogen fixation in rhizobium plants.
[0089] Molecular markers
[0090] After learning about the function of MYB3R1, it can be used as a molecular marker for targeted screening of plants.
[0091] After learning about the function of MYB3R1, this new discovery can also be used to screen for substances or potential substances that can regulate the number of root nodules in rhizophytes by modulating this mechanism.
[0092] Therefore, this invention provides a method for targeted selection or identification of plants, the method comprising: identifying the expression or sequence characteristics of MYB3R1 in a test plant; if the test plant highly expresses MYB3R1 protein or its gene, it is a nodule-forming plant with an increased number of root nodules; if the test plant low expresses or does not express MYB3R1 protein or its gene, it is a nodule-forming plant with a decreased number of root nodules. This method can be applied to early identification, such as for the identification of plant seed / root tissue.
[0093] The present invention provides a method for screening substances (potential substances) that regulate root nodule traits, comprising: (1) adding candidate substances to a system expressing MYB3R1; (2) detecting the system and observing the expression or activity of MYB3R1 therein. If its expression or activity is increased, it indicates that the candidate substance is a substance that can be used to increase the number of root nodules in root nodule plants.
[0094] Methods for screening substances that act on proteins or genes or specific regions thereof as targets are well known to those skilled in the art, and these methods can all be used in this invention. The candidate substances can be selected from: peptides, polymeric peptides, peptide-like substances, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, and nucleic acid sequences, etc. Depending on the type of substance to be screened, those skilled in the art understand how to select an appropriate screening method.
[0095] A variety of conventional techniques can be used to identify gene transcription or expression in a system. These techniques include, but are not limited to, oligonucleotide hybridization (e.g., probes), polymerase chain reaction (PCR), and polyacrylamide gel electrophoresis. Detecting protein-protein interactions and their strength can be achieved using various techniques well-known to those skilled in the art, such as immunoprecipitation, GST precipitation, phage display, or yeast two-hybrid systems. Nuclear localization of proteins is also a well-known technique in the field.
[0096] In addition, the tobacco bimolecular fluorescence complementarity (BIFC) assay can also be used to analyze protein interactions. The principle is that fluorescent proteins (YFP, GFP, Luciferase, etc.) have many specific sites on their loop structures between the two β-sheets that allow for the insertion of exogenous proteins without affecting the fluorescent activity of the fluorescent protein. BiFC technology utilizes this characteristic of the fluorescent protein family, splitting the fluorescent protein into two non-fluorescent molecular fragments, which are then fused separately with target proteins for expression. If the two target proteins approach each other due to physical interactions, the two molecular fragments of the fluorescent protein spatially approach each other, reforming an active fluorescent group and emitting fluorescence.
[0097] Through large-scale screening, a class of potential substances that specifically act on MYB3R1 or the signaling pathways involved by it can be obtained, which can regulate the number of root nodules in rhizobium plants.
[0098] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the manufacturer's recommendations.
[0099] plant materials
[0100] Tribulus terrestris ( Medicago truncatula Materials: Wild-type Jemalong A17 alfalfa whose genome has been sequenced.
[0101] All plants were grown in the artificial climate chamber of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. The cultivation conditions were set as follows: constant temperature 22℃, light intensity 200 μmol / L. m -2 s -1 Incubate in light for 16 hours, then in the dark for 8 hours, with a humidity of 65%.
[0102] Strains and cloning vectors
[0103] E. coli strains: Escherichia coli DH5α;
[0104] Agrobacterium rhizogenes strain: Agrobacterium rhizogenes Arqua1 ;
[0105] Transgenic construction vector: pUB-GFP-FLAG was purchased from Addgene.
[0106] pK7WG2R was purchased from BioVector.
[0107] Data analysis platforms and software
[0108] Sequence BLAST analysis: NCBI online analysis platform.
[0109] Primer design: Primer Premier 6.0 software.
[0110] Example 1, Overexpression MYB3R1 Construction of recombinant plasmids
[0111] MYB3R1 The cDNA sequence is as follows (SEQ ID NO: 1):
[0112]
[0113] MYB3R1 The amino acid sequence is as follows (SEQ ID NO: 2):
[0114] MGSESTIPALSDGVQKIRALHGRTTGPTRRSTKGQWTPEEDNILRKAVERFQGKNWKKIAECFKDRTDVQCLHRWQKVLNPELIKGPWSKEEDETIVDLVNKYGPKKWSTIAQHLPGRIGKQCRERWHNHLNPSINKEAWTQEEELALIHAHQIYGNRWAELSKFLPGRTDNAIKNHWNSSVKKKLDSYLASGLLAQFQNVPLVGNPNQPIASSSARLQFSVDDNGPRGTEGEEVSQCSQESINASHFPSGRELSIAVIQNVEEYRQNEESNQASCSEPYYMSLDGVTLQEVCSSQFLEQKYSNEPGSSSANVDCQFNLHALPTSLDFGQESTQLQNDSLASGENMMIVPYEYRPSSMGNAKGEQNMLITDDECCRFLFSEAMSDECFSSGGVNNVDLSGYTSSLCHSSLPSDSRMIMSTAEANQLVGSVDQQFDSREDVVKDDSLKLEPVSNSGCGSDTMQTCYPIDEKPNVHTQQEETGGTLCYEPPRFPSLDIPFLSCDLIQSGDMQQEFSPLGIRQFMMSSMNCLTPFRLWDSPSRIDSPDALLKSAAKTFTSTPSIMKKKKRNRERDLLSPLSDRRMEKKHEIDMTSTLIRNFSRLDVMFDDNETQGIEHDKENRGPAFMVEDKSNSEEKIEQPPLDADSKMKNDIDTTAEIVQQPSRVLIEHDMNDPSLYSPNQVGLKSDIVLSLSARSHQKSVSRFSSPCVRLKEHERLSVSVTCVQSICSSSIPGENMDDQTGNDDGFETNNIFGGMPFRKSFESPSAWKSPLFINTFLSSPRIDAEITIEDYGCFFSPGDKSSYDALGWIKQIGEHTAAQYANALEALENETPKALPNDASGDDQENNDPHNQSGNHSKSPSNASVERRMLDFSECGTPNKGDKGKSSAMSVSSPSSYLLKGCR
[0115] First, using the genome of Alfalfa truncatum as a template, the cDNA of Alfalfa truncatum was amplified using primers MYB3R1-F / MYB3R1-R and KOD-FX enzyme (a high-fidelity DNA polymerase purchased from Toyobo).
[0116] The primer sequences are as follows:
[0117] MYB3R1-F (SEQ ID NO: 3):
[0118] CAGTCTAGAATGGGAAGTGAGTCGACAATTC
[0119] MYB3R1-R (SEQ ID NO: 4):
[0120] GTCGGTACCTCTACAGCCCTTCAACAAATACG
[0121] After the PCR products are recovered, they undergo... KpnI , XbaI Enzyme digestion was performed and the recombinant plasmid was ligated into the pUB-GFP-FLAG vector, transformed into E. coli DH5α to identify positive clones, plasmid DNA was extracted, and Sanger sequencing was used to verify the correctness and integrity of the recombinant plasmid.
[0122] The recombinant plasmid was named: pUB-GFP-FLAG- MYB3R1 ( MYB3R1 (The gene was inserted into the pUB-GFP-FLAG vector).
[0123] Example 2: Transformation of alfalfa with Agrobacterium rhizogenes
[0124] 1. Expression vector introduced into Agrobacterium rhizogenes Arqua1
[0125] (1) Take Agrobacterium rhizogenes Arqua1 competent cells and place them on ice to thaw. Add plasmid DNA (pUB-GFP-FLAG- MYB3R1 After gently mixing the plasmid or empty vector (pUB-GFP-FLAG), incubate on ice for 10 minutes.
[0126] (2) After quick freezing in liquid nitrogen for 5 minutes, bath in water at 37°C for 5 minutes.
[0127] (3) Add 1 mL of TY liquid culture medium and shake at 28℃ (220 r / min) for 1-2 h.
[0128] (4) Take an appropriate amount of bacterial solution and spread it evenly on TY solid medium (containing the corresponding antibiotics), incubate at 28℃ for 2-3 days, pick single clones for PCR identification, and preserve the strain after the identification is correct.
[0129] 2. Disinfection and germination of alfalfa seeds
[0130] (1) Select alfalfa seeds with intact seed coats and gently abrade the seed coats with sandpaper. Place 50 seeds per 2mL centrifuge tube.
[0131] (2) Add 1 mL of 10% NaClO (prepare fresh before use) and mix thoroughly. Shake for 1-2 minutes until 1-3 black spots appear on the seed coat. Immediately wash with sterile water 5-8 times.
[0132] (3) The seeds were left to stand in sterile water for 5 minutes, then washed twice and spread evenly on 1% Water Agar.
[0133] (4) After wrapping the flat plate with aluminum foil, place it upside down in a refrigerator at 4℃ for 1-3 days.
[0134] (5) Turn the plate to 22℃ and invert it for dark culture for 12-16 hours to allow the seeds to germinate.
[0135] 3. Hairy root transformation of alfalfa
[0136] (1) Take Agrobacterium rhizogenes (containing the corresponding plasmid) stored at -70℃, streak it on a plate, and incubate at 28℃ for 36-48h. Pick single clones and incubate in 5mL TY liquid medium (containing the corresponding antibiotic) at 28℃ with shaking for 12-16h (220r / min).
[0137] (2) Take 1 mL into a new 100 mL TY liquid culture medium (containing the corresponding antibiotic) and incubate at 28°C with shaking for 8-12 h (220 r / min).
[0138] (3) Suspend Arqua1 bacterial culture in 5 mL of sterile TY liquid culture medium.
[0139] (4) After 12-16 hours of germination, the radicle of alfalfa seeds elongates to about 1-1.5 cm. Open the agar plate and add an appropriate amount of sterile water to keep the alfalfa seedlings moist.
[0140] (5) Use sterilized tweezers to gently grasp the cotyledon part of the alfalfa, cut off 5mm from the root tip upwards, and place the seedling in the resuspended bacterial solution.
[0141] (6) After soaking in the bacterial solution, the alfalfa seedlings were transferred sequentially into square dishes containing FP medium. They were incubated vertically at 22°C for 7 days under normal light. The medium formula was based on The Medicago Handbook (2006) by Barker et al.
[0142] (7) One week later, cut off all the roots that grow near the radicle swelling.
[0143] (8) Transfer the seedlings sequentially into square dishes containing MFP medium. Incubate vertically at 22℃ for 3-4 weeks under normal light.
[0144] (9) After 3 weeks, the seedlings were placed under a fluorescence microscope for identification, non-positive roots were removed, and the seedlings were placed in small flower pots containing sterilized vermiculite.
[0145] (10) After inoculating with Rhizobium Rm2011, the plants were removed 3-4 weeks later for root nodule counting.
[0146] Example 3, Overexpression MYB3R1 Phenotypic analysis of root nodules after gene therapy
[0147] The constructed recombinant plasmid vector pUB-GFP-FLAG-MYB3R1 was transformed into Agrobacterium rhizogenes. A. rhizogenes In Arqua1, the hairy roots of alfalfa were transformed. After co-culturing, the alfalfa plants were transferred to sterilized vermiculite for rooting and growth. After 3 days, they were treated with *Rhizobium sinense* (a type of alfalfa rhizobium). Sinorhizobium meliloti Rm2011 was used to infect alfalfa plants with tribulus terrestris. The number of root nodules was counted 21 days after infection.
[0148] (1) Phenotypic observation
[0149] The inventor observed the transgenic MYB3R1-OE The phenotype was compared with that of plants transformed into empty vectors as controls.
[0150] The results are as follows Picture 1 Phenotypic characteristics of alfalfa plants inoculated with rhizobium Rm2011 and transformed with an empty vector (A17) are shown in the figure. Picture 1 The left image shows a normal number of root nodules; the inoculation with rhizobium Rm2011... MYB3R1-OE See the phenotype of alfalfa thorn. Picture 1 As shown in the right figure, the number of root nodules has increased significantly.
[0151] (2) Statistics on the number of nodules
[0152] Select Student using Microsoft Excel 2016 software t The -test method is used to test for differences in the number of nodules.
[0153] The results are as follows Picture 2 Compared to the empty vector control, overexpression MYB3R1 After gene therapy, the number of root nodules per plant increased significantly. The average number of root nodules per plant increased by 10.5.
[0154] Example 4: The number of nodules decreased significantly after inhibiting MYB3R1 function.
[0155] The inventors fused the MYB3R1 gene with the known dominant repressor domain SRDX (plant-specific ERF-associated amphiphilic repression domain) and transformed it into the pK7WG2R vector, which significantly inhibited the function of MYB3R1 in activating downstream genes.
[0156] The pK7WG2R-MYB3R1-SRDX vector was transformed into Agrobacterium rhizogenes. A. rhizogenes In Arqua1, the hairy roots of alfalfa were transformed. After co-culturing, the alfalfa plants were transferred to sterilized vermiculite for rooting and growth. After 3 days, they were treated with *Rhizobium sinense* (a type of alfalfa rhizobium). Sinorhizobium meliloti Rm2011 was used to infect alfalfa plants with tribulus terrestris. The number of root nodules was counted 21 days after infection.
[0157] The inventors have compiled statistics on genetically modified organisms. MYB3R1-SRDX The phenotype was compared, with plants transformed into empty vectors serving as controls. Student phenotypes were selected using Microsoft Excel 2016 software. t The -test method is used to test for differences in the number of nodules.
[0158] The results are as follows Picture 3 Compared to the empty vector control, the expression MYB3R1-SRDX Afterwards, the number of root nodules per plant decreased significantly, with an average reduction of 8.5 root nodules.
[0159] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this patent should be determined by the appended claims. Furthermore, all documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. sequence list <110> Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences <120> Application of the MYB3R1 gene in regulating the number of root nodules in root-knot plants <130> 217413 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2712 <212> DNA <213> Physician <400> 1 atgggaagtg agtcgacaat tcctgcttta tcagatggcg tacagaaaat tagagcatta 60 catgggagga ctactggccc tacaggcga tccactaag gataggac acccgagg 120 tataatatat tgaggaggc tgttgagcgt ttcaggaa aaaattgga aaaaatagcg 180 gagtgtttca aggatagaac tgatgtacaa tgcctgcata ggtggcaaaa agtcttaaat 240 ccagaactta tcaaggtcc ttggtccaa gaggagatg aaacaatgt tgatttggta 300 aacaaatatg gggcctaaaa gtggtctact atagcacac atttacctgg acgtatcggt 360 aagcaatgtc gagaaaggtg gcataatcat cttaatcctt ctataaacaa agaagcatgg 420 acgcaggaag agagttggc tctaatacat gctcatcaga tatatggga tagatgggca 480 gagttatca agttttgcc tggaaggac gatagcta taagaacca ctggaatagt 540 tctgttaaga aaaaattgga ttcctacttg gcgtcaggct tgcttgctca gttcaaat 600 gtcccacttg ttggaaatcc gatcaacct attgctcat cctctgcaag gttgcagttt 660 agtgtagatg ataatggtcc taggggcaca gaagtgagg aagtttcaca gtgtagccag 720 gagtccatta atgctagtca ctttccgtct ggcagagagt tgagcattgc cgttatacaa 780 aatgtggagg agtacaggca aaatgaagaa tctaatcaag catcatgttc agagccatat 840 tacatgtctc tggatgtgt tactctccaa gaggtttgct ccttchcatt tcttgagcaa 900 aaatattcaa acgaacctgg gagttcctcc gcaatgtgg actgccaatt taatttacat 960 gctttgccca cctcactgga ctttggcag gatcgacgc agttgcaaa tgattcttta 1020 gcttctggtg aaaacatgat gattgttcca tatgaatatc ggccttcatc tatgggcaat 1080 gctaaaggag aaaaaacat gttgataact gatgatgaat gttgcagatt cctattttca 1140 gaggcaatga gcgatgaatg ttttcctct ggaggagtaa ataatgttga cttgtctgga 1200 tacacttcat ctcttgtca ttcgtcttta ccatctgata gtaggatgat atgtctact 1260 gccgaagcaa atcagttggt cggctctgtg gatcagcaat tgactcgag ggagatgtt 1320 gtgaaagatg atagtttaaa attggagcct gtaagtaatt ctggatgtgg atcagatacg 1380 atgcaaactt gctatccaat tgatgaaaag ccaaatgtgc atacacaaca ggaggaaaca 1440 ggaggaactc tatgtatga accgccccgt tttccaagct tggatatacc tttcttgagc 1500 tgtgatctta tacaatctgg agatatgcag caagaattta gtcccttagg tatccgccag 1560 tttatgatgt cttctatgaa ctgtctgact cctttcagat tgtgggactc accttctcgc 1620 attgatagtc cggacgcttt gttaaaaagt gctgctaaaa ctttcacaag tacaccgtcc 1680 ataatgaaga agaagaaacg aaaccgagaa agagacctt tatctccact atcagataga 1740 agaatggaga agaaacatga gattgacatg acgtcaactt tgattagaaa cttttccccgt 1800 ttggatgtca tgtttgatga caatgagact caaggtattg aacatgataa agaaaatcgt 1860 ggaccagctt ttatggtgga ggataaaagt aactctgagg agaagattga gcagcctcca 1920 cttgatgctg attctaagat gaagaatgat attgatacca ctgctgaaat tgtgcaacag 1980 ccttctcgag ttttgattga acatgatatg aatgatccat cgctgtattc tcctaatcaa 2040 gttggttga aatcagacat agttctaagt ttaagtgctc gaagtcatca aaaatcagtc 2100 tcaagattta gctctccttg tgttcgatta aaggagcacg aaagactctc agtttctgtt 2160 acttgtgtac aatccatctg ttcatcatca atcccaggag agaatatgga tgatcaaacc 2220 ggaaatgatg atggttttga aaaataac atttttggag gaatgccttt taggaaaagc 2280 tttgaatcac cttcagcatg gaaatcccct ttgtttataa acaccttttt gtctagtcct 2340 aggattgatg ctgaaattac tatcgaggac tacggatgtt tctttagccc gggtgataaa 2400 agcagctatg atgcacttgg atggattaag cagattggtg aacacactgc tgctcaatat 2460 gccaatgctc tagaggcttt agaaaatgaa actcctaagg cactaccaaa tgatgcctct 2520 ggagacgacc aggaaaacaa cgatcctcat aatcagtctg ggaaccattc taagtcgcct 2580 tcaaatgctt cggtggagcg acgcatgctt gacttcagcg aatgtggaac tccaaacaaa 2640 ggtgataagg gcaaatcctc agctatgagt gtttcaagtc cttcttcgta tttgttgaag 2700 ggctgtagat ag 2712 <210> 2 <211> 903 <212> PRT <213> Medicago <400> 2 Met Gly Ser Glu Ser Thr Ile Pro Ala Leu Ser Asp Gly Val Gln Lys 1 5 10 15 Ile Arg Ala Leu His Gly Arg Thr Thr Gly Pro Thr Arg Arg Ser Thr 20 25 30 Lys Gly Gln Trp Thr Pro Glu Glu Asp Asn Ile Leu Arg Lys Ala Val 35 40 45 Glu Arg Phe Gln Gly Lys Asn Trp Lys Lys Ile Ala Glu Cys Phe Lys 50 55 60 Asp Arg Thr Asp Val Gln Cys Leu His Arg Trp Gln Lys Val Leu Asn 65 70 75 80 Pro Glu Leu Ile Lys Gly Pro Trp Ser Lys Glu Glu Asp Glu Thr Ile 85 90 95 Val Asp Leu Val Asn Lys Tyr Gly Pro Lys Lys Trp Ser Thr Ile Ala 100 105 110 Gln His Leu Pro Gly Arg Ile Gly Lys Gln Cys Arg Glu Arg Trp His 115 120 125 Asn His Leu Asn Pro Ser Ile Asn Lys Glu Ala Trp Thr Gln Glu Glu 130 135 140 Glu Leu Ala Leu Ile His Ala His Gln Ile Tyr Gly Asn Arg Trp Ala 145 150 155 160 Glu Leu Ser Lys Phe Leu Pro Gly Arg Thr Asp Asn Ala Ile Lys Asn 165 170 175 His Trp Asn Ser Ser Val Lys Lys Lys Leu Asp Ser Tyr Leu Ala Ser 180 185 190 Gly Leu Leu Ala Gln Phe Gln Asn Val Pro Leu Val Gly Asn Pro Asn 195 200 205 Gln Pro Ile Ala Ser Ser Ser Ala Arg Leu Gln Phe Ser Val Asp Asp 210 215 220 Asn Gly Pro Arg Gly Thr Glu Gly Glu Glu Val Ser Gln Cys Ser Gln 225 230 235 240 Glu Ser Ile Asn Ala Ser His Phe Pro Ser Gly Arg Glu Leu Ser Ile 245 250 255 Ala Val Ile Gln Asn Val Glu Glu Tyr Arg Gln Asn Glu Glu Ser Asn 260 265 270 Gln Ala Ser Cys Ser Glu Pro Tyr Tyr Met Ser Leu Asp Gly Val Thr 275 280 285 Leu Gln Glu Val Cys Ser Ser Gln Phe Leu Glu Gln Lys Tyr Ser Asn 290 295 300 Glu Pro Gly Ser Ser Ser Ala Asn Val Asp Cys Gln Phe Asn Leu His 305 310 315 320 Ala Leu Pro Thr Ser Leu Asp Phe Gly Gln Glu Ser Thr Gln Leu Gln 325 330 335 Asn Asp Ser Leu Ala Ser Gly Glu Asn Met Met Ile Val Pro Tyr Glu 340 345 350 Tyr Arg Pro Ser Ser Met Gly Asn Ala Lys Gly Glu Gln Asn Met Leu 355 360 365 Ile Thr Asp Asp Glu Cys Cys Arg Phe Leu Phe Ser Glu Ala Met Ser 370 375 380 Asp Glu Cys Phe Ser Ser Gly Gly Val Asn Asn Val Asp Leu Ser Gly 385 390 395 400 Tyr Thr Ser Ser Leu Cys His Ser Ser Leu Pro Ser Asp Ser Arg Met 405 410 415 Ile Met Ser Thr Ala Glu Ala Asn Gln Leu Val Gly Ser Val Asp Gln 420 425 430 Gln Phe Asp Ser Arg Glu Asp Val Val Lys Asp Asp Ser Leu Lys Leu 435 440 445 Glu Pro Val Ser Asn Ser Gly Cys Gly Ser Asp Thr Met Gln Thr Cys 450 455 460 Tyr Pro Ile Asp Glu Lys Pro Asn Val His Thr Gln Gln Glu Glu Thr 465 470 475 480 Gly Gly Thr Leu Cys Tyr Glu Pro Pro Arg Phe Pro Ser Leu Asp Ile 485 490 495 Pro Phe Leu Ser Cys Asp Leu Ile Gln Ser Gly Asp Met Gln Gln Glu 500 505 510 Phe Ser Pro Leu Gly Ile Arg Gln Phe Met Met Ser Ser Met Asn Cys 515 520 525 Leu Thr Pro Phe Arg Leu Trp Asp Ser Pro Ser Arg Ile Asp Ser Pro 530 535 540 Asp Ala Leu Leu Lys Ser Ala Ala Lys Thr Phe Thr Ser Thr Pro Ser 545 550 555 560 Ile Met Lys Lys Lys Lys Arg Asn Arg Glu Arg Asp Leu Leu Ser Pro 565 570 575 Leu Ser Asp Arg Arg Met Glu Lys Lys His Glu Ile Asp Met Thr Ser 580 585 590 Thr Leu Ile Arg Asn Phe Ser Arg Leu Asp Val Met Phe Asp Asp Asn 595 600 605 Glu Thr Gln Gly Ile Glu His Asp Lys Glu Asn Arg Gly Pro Ala Phe 610 615 620 Met Val Glu Asp Lys Ser Asn Ser Glu Glu Lys Ile Glu Gln Pro Pro 625 630 635 640 Leu Asp Ala Asp Ser Lys Met Lys Asn Asp Ile Asp Thr Thr Ala Glu 645 650 655 Ile Val Gln Gln Pro Ser Arg Val Leu Ile Glu His Asp Met Asn Asp 660 665 670 Pro Ser Leu Tyr Ser Pro Asn Gln Val Gly Leu Lys Ser Asp Ile Val 675 680 685 Leu Ser Leu Ser Ala Arg Ser His Gln Lys Ser Val Ser Arg Phe Ser 690 695 700 Ser Pro Cys Val Arg Leu Lys Glu His Glu Arg Leu Ser Val Ser Val 705 710 715 720 Thr Cys Val Gln Ser Ile Cys Ser Ser Ser Ile Pro Gly Glu Asn Met 725 730 735 Asp Asp Gln Thr Gly Asn Asp Asp Gly Phe Glu Thr Asn Asn Ile Phe 740 745 750 Gly Gly Met Pro Phe Arg Lys Ser Phe Glu Ser Pro Ser Ala Trp Lys 755 760 765 Ser Pro Leu Phe Ile Asn Thr Phe Leu Ser Ser Pro Arg Ile Asp Ala 770 775 780 Glu Ile Thr Ile Glu Asp Tyr Gly Cys Phe Phe Ser Pro Gly Asp Lys 785 790 795 800 Ser Ser Tyr Asp Ala Leu Gly Trp Ile Lys Gln Ile Gly Glu His Thr 805 810 815 Ala Ala Gln Tyr Ala Asn Ala Leu Glu Ala Leu Glu Asn Glu Thr Pro 820 825 830 Lys Ala Leu Pro Asn Asp Ala Ser Gly Asp Asp Gln Glu Asn Asn Asp 835 840 845 Pro His Asn Gln Ser Gly Asn His Ser Lys Ser Pro Ser Asn Ala Ser 850 855 860 Val Glu Arg Arg Met Leu Asp Phe Ser Glu Cys Gly Thr Pro Asn Lys 865 870 875 880 Gly Asp Lys Gly Lys Ser Ser Ala Met Ser Val Ser Ser Pro Ser Ser 885 890 895 Tyr Leu Leu Lys Gly Cys Arg 900 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <400> 3 cagtctagaa tgggaagtga gtcgacaatt c 31 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <400> 4 gtcggtacct ctacagccct tcaacaaata cg 32
Claims
1. A method of modulating the number of nodules of a nodule plant or a method of producing a nodule plant having an increased or decreased number of nodules, comprising: The expression or activity of MYB3R1 in rhizobium plants is regulated, including upregulation or downregulation. Upregulation of MYB3R1 expression or activity increases the number of rhizobs, while downregulation of MYB3R1 expression or activity decreases the number of rhizobs. The amino acid sequence of MYB3R1 is shown in SEQ ID NO:
2. The rhizobium plant is Alfalfa tribulus.
2. The method of claim 1, wherein, Upregulation of MYB3R1 expression or activity in plants includes: Introduce the MYB3R1 coding gene or expression constructs or vectors containing the coding gene into plants; Promote MYB3R1 expression by expressing an enhancing promoter or a tissue-specific promoter; or Enhancers promote MYB3R1 expression.
3. The method of claim 1, wherein, Downregulating the expression or activity of MYB3R1 in plants includes knocking out or silencing the gene encoding MYB3R1 in plants, or inhibiting the activity of MYB3R1.
4. The method of claim 3, wherein, The gene encoding MYB3R1 that is knocked out or silenced in plants includes: Gene editing using the CRISPR system to knock out the coding gene of MYB3R1, and homologous recombination to knock out the coding gene of MYB3R1. Silencing MYB3R1 by interfering molecules that specifically interfere with the expression of the gene encoding MYB3R1; The MYB3R1 gene was fused with a dominant repressor domain to inhibit the function of MYB3R1 in activating downstream genes; this dominant repressor domain was SRDX. In plants containing MYB3R1, a loss-of-function mutation of MYB3R1 is performed.
5. The method according to any one of claims 1 to 4, characterized in that, The DNA sequence encoding MYB3R1 is a cDNA sequence or a genomic sequence.
6. The use of MYB3R1 or a regulator thereof for regulating the number of root nodules in a nodule plant or for preparing nodule plants with increased or decreased root nodule numbers; the amino acid sequence of said MYB3R1 is shown in SEQ ID NO: 2; the nodule plant is alfalfa; wherein: The regulator is a MYB3R1 upregulator that increases the number of root nodules. The upregulator includes: an exogenous MYB3R1 encoding gene or an expression construct or vector containing that encoding gene; or The regulator is a MYB3R1 downregulator that reduces the number of root nodules. The downregulator includes: reagents that knock out or silence MYB3R1, and reagents that inhibit MYB3R1 activity.
7. Use according to claim 6, characterized in that, The expression constructs include enhanced promoters, tissue-specific promoters, or enhancers.
8. The use according to claim 6, characterized in that, The MYB3R1 downregulator mentioned above is: CRISPR gene editing reagents, homologous recombination reagents, or site-directed mutagenesis reagents targeting MYB3R1, wherein the reagents induce loss-of-function mutations in MYB3R1; Interfering molecules that specifically interfere with the expression of the gene encoding MYB3R1; or The dominant repressor domain can fuse with the dominant repressor domain to inhibit the function of MYB3R1 in activating downstream genes; this dominant repressor domain is SRDX.
9. Use according to any one of claims 6 to 8, characterized in that, The DNA sequence encoding MYB3R1 is a cDNA sequence or a genomic sequence.
10. Use according to any one of claims 6 to 8, characterized in that, Increasing the number of root nodules in rhizotrophic plants further promotes the optimization of traits including: Promotes the nitrogen-fixing ability of roots in rhizobium plants; To promote nitrogen utilization in root nodules; or Reduce the nitrogen fertilizer requirement of root nodule plants.