Application of Populus transcription factor PtSND2 gene in improving plant drought tolerance

Abstract

The present invention discloses the application of a poplar transcription factor PtSND2 gene in improving plant drought tolerance. The gene sequence number of the PtSND2 gene in NCBI is NW_001492763.1. The nucleotide sequence of the modified poplar transcription factor PtSND2-SRDX gene is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2. In transgenic poplar plants overexpressing PtSND2-SRDX, PtSND2-SRDX can significantly reduce the damage of drought to plant seedlings, significantly improve the survival rate of seedlings, significantly reduce the water loss rate of seedlings under drought conditions, and can grow normally under water-deficient conditions, which will play an important role in cultivating new drought-resistant poplar materials, and can have a substantial impact on China's animal husbandry, agriculture, forestry, etc., and has broad application prospects and research value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the poplar transcription factor PtSND2 gene in improving plant drought tolerance. Background Art

[0002] Poplar wood is one of the main renewable resources highly valued by the pulp and paper industry. As one of the most environmentally cost-effective forest tree species, it is also widely used for land reforestation and phytoremediation of polluted soils. Understanding the molecular mechanisms that control its growth and development will help cultivate fast-growing tree species with improved wood quantity and quality.

[0003] Poplar (Latin scientific name: Populus L), belonging to the Salicaceae family, is the most widely distributed and adaptable tree species in the world. It can be widely used in ecological shelter forests, the Three-North Shelter Forest Program, agroforestry shelter forests, and industrial timber forests. Poplar is one of the main renewable resources. As one of the most environmentally cost-effective forest tree species, it is also widely used for land reforestation, windbreak and sand fixation, and phytoremediation of polluted soils. Understanding the molecular mechanisms that control its growth and development will help cultivate drought-tolerant woody plants.

[0004] With the global water resource crisis and environmental deterioration, plants are often harmed by drought stress. Drought is a climatic phenomenon that affects the economy, society, and environment, especially having a particularly serious impact on agricultural production. It will hinder the normal growth of crops and cause huge losses to agricultural production. In the 1990s, the average annual drought-affected area in China reached 27 million hectares, and the grain yield reduction due to drought reached 4.7%. China is a large agricultural country and a country with frequent droughts. With the increase in population and the improvement of agricultural product demand, drought climate will directly threaten China's food security. Therefore, targeted measures need to be taken to reduce the damage and losses. After plants are subjected to drought stress, they will dehydrate and wilt, causing a series of physiological and biochemical metabolic disorders. If the drought situation continues, it will lead to plant death. However, some proteins in plants have drought-tolerant mechanisms. Cloning drought-tolerant proteins and overexpressing them in target plants will improve the drought tolerance of plants.

[0005] The NAC domain transcription factor is an important regulator that activates secondary wall biosynthesis in wood formation. PtSND2 is a domain protein related to the secondary wall and a member of the NAC family. Reverse transcription polymerase chain reaction, subcellular localization, and transcriptional activation analysis show that PtSND2 is a transcription factor with transcriptional activation activity. At the same time, the secondary cell wall thickness of xylem fibers in the stems of transgenic plants is inhibited, and the cellulose and lignin contents are significantly reduced, and the plants are dwarfed. However, there is no report on its drought resistance aspect yet.

[0006] The SUPERMAN repression domain X (SRDX) is a conserved domain with a 12 - amino - acid sequence (LDLDLELRLGFA), which can dominantly inhibit the transcriptional activity of its target gene by recombination with the target gene. Summary of the Invention

[0007] The object of the present invention is to provide the application of the poplar transcription factor PtSND2 gene in improving plant drought tolerance.

[0008] Also provided is a method for improving plant drought tolerance. The PtSND2 - SRDX gene is cloned into a plant through transgenic technology to obtain a transgenic plant, and the drought tolerance of the transgenic plant is improved.

[0009] In order to achieve the above object, the technical solution of the present invention is outlined as follows:

[0010] The application of the poplar transcription factor PtSND2 gene in improving plant drought tolerance, wherein the gene sequence number of the PtSND2 gene in NCBI is NW_001492763.1.

[0011] Using gene modification technology, a conserved domain with a 12 - amino - acid sequence (LDLDLELRLGFA) is recombined with the PtSND2 gene. The nucleotide sequence of the poplar transcription factor PtSND2 - SRDX gene is shown in SEQ ID NO.1, and its amino - acid sequence is shown in SEQ ID NO.2.

[0012] The expression vector pCAMBIA - 2301 containing the transcription factor PtSND2 - SRDX gene also has the function of improving plant drought tolerance. The constructed plant expression vector can be directly used for Agrobacterium - mediated crop genetic transformation to create new drought - tolerant woody plant varieties and can be used for crop improvement.

[0013] In order to improve the excellent traits of plants, the present invention also discloses a method for improving plant drought tolerance. The PtSND2 - SRDX gene is introduced into a target plant to obtain a transgenic plant, and the drought tolerance in the transgenic plant is higher than that of the target plant.

[0014] Specifically, the PtSND2 - SRDX gene can be introduced into the target plant through the over - expression vector. In this method, the over - expression vector can transform plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electro - conductivity, Agrobacterium - mediated, etc., and the transformed plant tissues are cultivated into plants.

[0015] In addition, a plant breeding method is also disclosed, and the method is as follows (1) and (2):

[0016] (1) By increasing the activity of PtSND2-SRDX protein in the target plant, a plant with higher drought tolerance than the target plant is obtained;

[0017] (2) By promoting the expression of the PtSND2-SRDX gene in the target plant, plants with higher drought resistance than the target plant are obtained.

[0018] Among them, the implementation methods of promoting the expression of the PtSND2-SRDX gene in the target plant include introducing the PtSND2-SRDX gene into the target plant or introducing a strong promoter or enhancer.

[0019] In the present invention, there is no particular limitation on the plants applicable to the present invention, as long as they are suitable for gene transformation operations, such as various crops, flower plants, or forestry plants, etc. The plants can be, for example (but not limited to): dicotyledons, monocotyledons or gymnosperms.

[0020] As an embodiment, the "plant" includes but is not limited to: poplar, especially Populus dasyphylla, and any plant having the gene or a gene homologous thereto is applicable. It is particularly suitable for plants that need to improve plant drought resistance. In the actual application process, for plants that need to improve plant drought resistance, strains with the gene transferred in can be cultivated by genetically modifying.

[0021] The "plant" mentioned in the present invention includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (tubers), flowers, tissues and organs, and these different parts all have our target gene or nucleic acid. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen and microspores, and similarly, each of the aforementioned objects contains the target gene or nucleic acid.

[0022] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny obtained using the method of this patent have the same characteristics.

[0023] The invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It also further relates to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starch or proteins. The invention also relates to foods or food additives obtained from the relevant plants.

[0024] Advantages of the present invention:

[0025] The present invention provides a poplar transcription factor PtSND2. The complete cDNA encoding the transcription factor PtSND2 gene was isolated from Populus trichocarpa, ligated to a plant expression vector, and plants were transformed using the Agrobacterium infection method. For the obtained transgenic plants, stress resistance analysis was carried out. The results showed that in transgenic poplar plants overexpressing PtSND2-SRDX, wood formation was severely inhibited. The modified PtSND2-SRDX gene can significantly reduce the damage of drought to plant seedlings, significantly improve the survival rate of seedlings, significantly reduce the water loss rate of seedlings under drought conditions, and can grow normally under water-deficient conditions. It can not only be used to cultivate woody drought-tolerant transgenic plants, but also play an important role in the drought-resistant traits of other economic crops, and can have a substantial impact on animal husbandry, agriculture, forestry, etc. in China, with broad application prospects and research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Comparison of the growth conditions of transgenic Populus davidiana var. japonica and wild-type Populus davidiana var. japonica after drought treatment;

[0027] Figure 2 Comparison of the water loss rates of transgenic Populus davidiana var. japonica and wild-type Populus davidiana var. japonica under drought conditions;

[0028] Figure 3 Comparison of the stomata of transgenic Populus davidiana var. japonica and wild-type Populus davidiana var. japonica under normal growth conditions and drought;

[0029] Figure 4 Comparison of the stomatal apertures of transgenic Populus davidiana var. japonica and wild-type Populus davidiana var. japonica. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] The present invention will be further described below in conjunction with specific embodiments, and the advantages and characteristics of the present invention will become clearer as the description progresses. However, the specific experimental methods involved in the following embodiments are all implemented under the conditions of conventional methods unless otherwise specified.

[0031] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The test methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can all be obtained by purchasing from the market.

[0032] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are only for illustrative purposes.

[0033] Example 1 Obtaining the PtSND2-SRDX Gene

[0034] The full-length cDNA of PtSND2 (PtrNAC154) was cloned from the sequence of Populus trichocarpa Torr. & Gray in the poplar database. The gene sequence number in NCBI is NW_001492763.1. Then, using gene modification technology, a conserved domain with a 12-amino acid sequence (LDLDLELRLGFA) was recombined with the PtSND2 gene to form the poplar transcription factor PtSND2-SRDX gene. The nucleotide sequence is shown in SEQ ID NO.1. The nucleotide sequence consists of 936 bases and encodes 311 amino acids, and its sequence is shown in SEQ ID NO.2. Total RNA of Populus trichocarpa seedlings was extracted using an RNA extraction and isolation reagent (RNAiso kit), and then reverse transcriptase (ReverTra Ace)

[0035] was used for amplification. The primers used are as follows:

[0036] Forward primer: CCGGATCCATGACTTGGTGCAATGACTGCA;

[0037] Reverse primer: CCGAGCTCTTAAGCGAAACCCAAACGGAGTTCTAGATCGATCCAGGGGGATAAAAGAAGA;

[0038] To construct a dominant repression expression vector, the stop codon of PtSND2 was replaced with a plant-specific dominant repression domain (SRDX, LDLDLELRLGFA), and then it was ligated to the pCAMBIA-2301 vector under the control of two copies of the cauliflower mosaic virus 35S promoter and transformed into Agrobacterium tumefaciens EHA105. Then, positive clones were screened using an LB solid plate supplemented with 50 mg / L rifampicin + 50 mg / L kanamycin. After that, the positive clones were inoculated into an LB liquid medium (containing antibiotics: 50 mg / L rifampicin, 50 mg / L kanamycin) and cultured in a constant temperature shaker at 28°C (20 rpm) until OD600 = 0.3 - 0.5. The leaves of wild-type Populus davidiana var. alba were immersed in the inoculated LB liquid medium solution for 15 minutes, and then the leaves were co-cultured on an MS differentiation medium containing acetosyringone and continuously cultured under normal conditions (25°C, 16 hours of light, 8 hours of darkness) until clustered buds were normally differentiated.

[0039] Afterwards, the differentiated cluster buds were transferred onto an MS rooting medium (50 mg / L kanamycin and 300 mg / L ticarcillin antibiotic) for resistance screening. After obtaining normal positive transgenic seedlings, they were subcultured onto the rooting medium for continued rooting culture. After obtaining rooted tissue culture seedlings, they were verified by semi-quantitative RT-PCR. Finally, homozygous transgenic Populus davidiana × Populus bolleana containing the drought-tolerant gene PtSND2-SRDX was obtained.

[0040] 2. Functional verification of the PtSND2-SRDX gene

[0041] The sterile seedlings were subcultured on MS medium and grown in a sterile culture room for 15 days, then transplanted into separate flower pots and cultured in a greenhouse under a 12-hour light and 12-hour dark light cycle, including natural sunlight and supplementary lights. The daytime temperature was maintained at 21-25 °C, and the nighttime temperature was maintained at 15-18 °C. Appropriate watering was carried out according to the evaporation requirements at different growth stages.

[0042] (1) Phenotypic observation. The tissue culture seedlings were transplanted, and two-week-old wild poplar or transgenic poplar trees were transplanted into pots filled with nutrient soil for greenhouse cultivation. Regular watering was carried out for cultivation. At 15 days, watering was carried out once again with the same amount of water. Then, wild-type and transgenic poplar seedlings of the same size were selected for a drought experiment. As a control, half of the wild-type and transgenic poplar seedlings were watered normally, and the remaining seedlings were not watered. Their drought tolerance was observed. After 14 days of greenhouse cultivation, the leaves of wild-type poplar trees began to wilt, and after 20 days, the wild-type poplar trees died, but the transgenic poplar trees were still growing normally. The transgenic poplar trees did not show leaf wilting until 27 days ( Figure 1 ).

[0043] (2) Leaf water loss rate experiment. Three leaves were cut from each of the wild-type and transgenic poplar trees with normal growth and placed in an artificial incubator at normal room temperature. The leaf weight was measured every hour to count the water loss situation, and it was found that the water loss rate of transgenic poplar leaves was slower than that of the wild-type (control) ( Figure 2 ).

[0044] (3) Observation of leaf stomata. The epidermis of the leaves at the same position was torn off and observed under a microscope for leaf stomata ( Figure 3 ). It can be seen from the figure that the opening and closing degree of the stomata of transgenic poplar leaves is smaller than that of the wild-type (control).

[0045] (4) Statistical analysis of leaf stomatal aperture. The stomatal aperture was calculated as the ratio of stomatal width to length. Approximately 100 stomata were analyzed for each genotype. The results showed that the stomatal aperture of transgenic PtSND2 poplar trees was smaller than that of wild-type poplar trees ( Figure 4 ).

[0046] In summary, the PtSND2-SRDX gene-transformed poplar has higher drought resistance than the wild type. Therefore, the PtSND2 gene plays an important role in the drought resistance of poplar, which has important guiding significance for cultivating woody drought-tolerant transgenic plants.

[0047] The above-described embodiments are only preferred embodiments of the present invention, which are merely used to explain the present invention and do not limit the scope of implementation of the present invention. For those skilled in the art of this technology, other implementation manners can certainly be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Application of Modified Poplar Transcription Factor PtSND2-SRDX gene in improving drought tolerance of poplar, characterized in that Modified Poplar Transcription Factor PtSND2-SRDX The nucleotide sequence of the gene is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The expression vector containing the modified poplar transcription factor described in claim 1 PtSND2-SRDX is pCAMBIA-2301.

3. A method for improving the drought tolerance of plants, characterized in that, Introduce the PtSND2-SRDX gene described in Claim 1 into the target plant to obtain a transgenic plant, wherein the drought tolerance of the transgenic plant is higher than that of the target plant, and the target plant is poplar.

4. The method for improving the drought tolerance of plants according to claim 3, wherein, The poplar tree is Populus davidiana × P. bolleana Lauche.

5. A plant breeding method, characterized in that, The method is as follows (1) or (2): (1) By increasing the activity of PtSND2-SRDX protein in the target plant, a plant with higher drought tolerance than the target plant is obtained; (2) By promoting the expression of the PtSND2-SRDX gene in the target plant, a plant with a drought tolerance content higher than that of the target plant is obtained; The PtSND2-SRDX nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the PtSND2-SRDX protein is shown in SEQ ID NO.2, and the target plant is poplar.

6. The plant breeding method according to claim 5, characterized in that, The poplar tree is Populus davidiana × P. bolleana Lauche.

Images