Primers, kits and methods for detecting the causative agent of hemorrhagic fever with renal syndrome
By designing specific primers and using multiplex PCR technology, combined with a next-generation sequencing platform, the problems of long detection time and difficulty in identifying pathogens in patients with fever and hemorrhage have been solved. This has enabled rapid and accurate pathogen detection, shortened detection time, and improved precision medication.
Patent Information
- Application Number
- CN202310517976.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-09
- Publication Date
- 2026-06-23
- Estimated Expiration
- 2043-05-09
AI Technical Summary
Existing technologies for detecting pathogens causing fever and hemorrhage suffer from problems such as long detection time, cumbersome operation, and difficulty in identifying pathogens. In particular, products based on traditional etiological diagnosis and immunoassay or fluorescent PCR methods cannot meet the needs for rapid and accurate detection.
131 pairs of specific primers were designed, and combined with multiplex PCR technology and a next-generation sequencing platform, high-throughput detection of 26 pathogens with fever and hemorrhage was achieved. Through multiplex PCR amplification and sequencing analysis, the detection time was shortened to within 15 hours.
It enables rapid and accurate detection of pathogens causing fever and hemorrhagic disease, improving detection precision and coverage, reducing mortality, and lowering the complexity and cost of testing.
Smart Images

Figure CN116377099B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, and more specifically, this invention relates to primers, reagent kits and methods for simultaneously detecting pathogens with fever and hemorrhagic disease. Background Technology
[0002] Fever with hemorrhage is a general term for a series of diseases characterized by fever (≥37.5℃, duration ≤3 weeks) accompanied by two or more of the following clinical manifestations (petechiae or purpura on the skin, petechiae on the mucous membranes, epistaxis, hemoptysis, hemoptysis, hematochezia, anemia, platelet count below normal and persistently decreased, and other bleeding manifestations). Clinically, diseases causing fever with hemorrhage mainly include dengue fever, hemorrhagic fever with renal syndrome (HFRS), severe fever with thrombocytopenia syndrome (SFTS), plague, leptospirosis (LS), and streptococcal infection in pigs. Pathogens include two main categories: viruses and bacteria, primarily including dengue virus (DENV), Hantavirus (HTNV), new bunyavirus (NBYV), leptospires, and streptococci in pigs. These pathogens cause serious infections and hematopoietic system diseases, posing a huge threat to human health.
[0003] Traditional etiological diagnosis relies on the morphology, physiological and biochemical reactions, and immunological characteristics of pathogens. This process is time-consuming and cumbersome. Furthermore, due to limited understanding of the causative microorganisms and the widespread use of broad-spectrum antibiotics in clinical practice, identifying the pathogen is quite difficult. Currently, products on the market for fever accompanied by bleeding are mainly based on immunoassays, such as the "Fever with Thrombocytopenia Syndrome ELISA Detection Kit," or on fluorescence PCR, such as the "Nucleic Acid Detection Kit for Thirteen Fever with Bleeding Pathogens."
[0004] With the development of molecular biology techniques, next-generation sequencing (NGS) technology has gradually become an indispensable tool for one-stop clinical pathogen identification. Targeted high-throughput sequencing (tNGS) refers to a solution for detecting multiple pathogens by combining multiplex PCR technology with next-generation sequencing platforms (NGS). This technology is characterized by short cycle time, high detection accuracy, and wide coverage. Currently, there are no tNGS-based nucleic acid detection products for pathogens causing fever with hemorrhagic symptoms. Summary of the Invention
[0005] Based on this, the purpose of the present invention is to provide primers, reagent kits and methods for detecting pathogens of fever accompanied by hemorrhage.
[0006] The technical solutions for achieving the above-mentioned objectives include the following.
[0007] In a first aspect, the present invention provides primers for detecting pathogens causing fever accompanied by hemorrhagic disease, comprising:
[0008] Primers for detecting Yersinia pestis, with sequences as shown in SEQ ID NO.1 to SEQ ID NO.12;
[0009] Primers for detecting Streptococcus suis, with sequences shown in SEQ ID NO.13 to SEQ ID NO.24;
[0010] Primers for detecting Vibrio vulnificus, with sequences shown in SEQ ID NO.25 to SEQ ID NO.36;
[0011] Primers for detecting Aeromonas spp., with sequences shown in SEQ ID NO.37 to SEQ ID NO.46;
[0012] Primers for detecting Leptospira* (Leptospira noguchi) with sequences as shown in SEQ ID NO.47 to SEQ ID NO.56;
[0013] Primers for detecting Leptospira genus* (Leptospira renalis) with sequences as shown in SEQ ID NO.57~SEQ ID NO.68;
[0014] Primers for detecting Hantavirus, with sequences shown in SEQ ID NO.69 to SEQ ID NO.74;
[0015] Primers for detecting Seoul virus, with sequences shown in SEQ ID NO.75 to SEQ ID NO.88;
[0016] Primers for detecting California encephalitis virus, with sequences shown in SEQ ID NO.89 to SEQ ID NO.100;
[0017] Primers for detecting Rift Valley fever virus, with sequences shown in SEQ ID NO.101 to SEQ ID NO.110;
[0018] Primers for detecting Crimean-Congo hemorrhagic fever virus, with sequences shown in SEQ ID NO.111 to SEQ ID NO.118;
[0019] Primers for detecting novel Bunyaviruses, with sequences shown in SEQ ID NO.119 to SEQ ID NO.126;
[0020] Primers for detecting yellow fever virus, with sequences shown in SEQ ID NO.127 to SEQ ID NO.134;
[0021] Primers for detecting dengue virus, with sequences shown in SEQ ID NO.135 to SEQ ID NO.140;
[0022] Primers for detecting Japanese encephalitis virus, with sequences shown in SEQ ID NO.141 to SEQ ID NO.150;
[0023] Primers for detecting West Nile virus, with sequences shown in SEQ ID NO.151 to SEQ ID NO.158;
[0024] Primers for detecting St. Louis encephalitis virus, with sequences shown in SEQ ID NO.159 to SEQ ID NO.166;
[0025] Primers for detecting Usutu virus, with sequences shown in SEQ ID NO.167 to SEQ ID NO.174;
[0026] Primers for detecting tick-borne encephalitis virus, with sequences shown in SEQ ID NO.175 to SEQ ID NO.180;
[0027] Primers for detecting Zika virus, with sequences shown in SEQ ID NO.181 to SEQ ID NO.192;
[0028] Primers for detecting ALKhurma hemorrhagic fever virus, with sequences shown in SEQ ID NO.193 to SEQ ID NO.200;
[0029] Primers for detecting lymphocytic choroid plexus meningitis virus, with sequences shown in SEQ ID NO.201 to SEQ ID NO.208;
[0030] Primers for detecting Lassa virus, with sequences shown in SEQ ID NO.209 to SEQ ID NO.218;
[0031] Primers for detecting mammalian arenaviruses* (Kuning virus) with sequences as shown in SEQ ID NO.219~SEQ ID NO.226;
[0032] Primers for detecting mammalian arenaviruses (Guanareto virus) with sequences as shown in SEQ ID NO.227 to SEQ ID NO.234;
[0033] Primers for detecting mammalian arenaviruses* (muschopoviruses) with sequences as shown in SEQ ID NO.235~SEQ ID NO.242;
[0034] Primers for detecting Ebola virus, with sequences shown in SEQ ID NO.243 to SEQ ID NO.246;
[0035] Primers for detecting sandfly virus, with sequences shown in SEQ ID NO.247 to SEQ ID NO.254.
[0036] Primers for detecting Casanor forest disease virus, with sequences shown in SEQ ID NO.255 to SEQ ID NO.262.
[0037] In a second aspect, the present invention provides a kit for detecting pathogens causing fever with hemorrhage, comprising the primers described above for detecting pathogens causing fever with hemorrhage.
[0038] A third aspect of the present invention provides a method for detecting pathogens of fever accompanied by hemorrhage, comprising the following steps: using the nucleic acid of the sample to be tested as a template, and using the primers for detecting pathogens of fever accompanied by hemorrhage as primers for multiplex PCR amplification.
[0039] In this invention, 131 pairs of specific primers were designed based on highly conserved regions of 26 pathogens associated with fever and bleeding, and a detection method for these 26 pathogens was established. This detection method can comprehensively cover the detection of pathogens associated with fever and bleeding, with high accuracy, strong specificity, and high sensitivity. It can perform rapid detection in as little as 15 hours (TAT), reducing mortality and improving precision medication. Attached Figure Description
[0040] Figure 1 These are the experimental results of the detection limit of the method of the present invention in the experimental examples of the present invention. Detailed Implementation
[0041] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0042] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0043] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Green and Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2013), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.
[0044] In this invention, based on 26 pathogens associated with fever and hemorrhage (including 21 viruses—Hantavirus, Seoul virus, California encephalitis virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, novel Bunyavirus, yellow fever virus, dengue virus, Japanese encephalitis virus, West Nile virus, St. Louis encephalitis virus, Usutu virus, tick-borne encephalitis virus, Zika virus, ALKhurma hemorrhagic fever virus, Casanorr forest disease virus, lymphocytic choriomeningitis virus, Lassa virus, mammalian arenaviruses* (Guanareto virus (GTOV), Junin virus (JUNV), Machupo virus (MACV)), Ebola virus, sandfly virus, and 5 bacteria—Streptococcus suis, Yersinia pestis, Vibrio vulnificus, and Trauma vibrio vulnificus), the invention classifies the pathogens as pathogens associated with fever and hemorrhage. This invention comprehensively covers pathogens associated with fever and hemorrhage, including *Aeromonas* and *Leptospira* (such as *Leptospira renalis* and *Leptospira noguchi*). It employs 131 pairs of specific primers targeting highly conserved regions of these pathogens and establishes nucleic acid detection methods for 26 pathogens with fever and hemorrhage. The process involves first enriching the target pathogens through PCR amplification in an amplification tube (adjusting the primer pool concentration ratio in multiplex PCR to ensure high uniformity of sequencing data for each target gene region; the targeted amplification process is adaptable to both DNA and RNA, allowing for simultaneous detection of both DNA and RNA pathogens, reducing costs and complexity). A second round of PCR ligation distinguishes the sequencing adapters from the sample source. Sequencing is then performed on the KM MiniSeqDx-CN sequencing platform (which has obtained a Class III registration certificate). Finally, bioinformatics analysis is performed on the sequencing results. Since time is of the essence in infectious diseases, compared to the 24-hour detection time of metagenomic sequencing technology, this invention achieves rapid detection in as little as 15 hours (TAT), reducing mortality and improving precision medicine.
[0045] In one embodiment of the present invention, a primer for detecting pathogens causing fever accompanied by hemorrhagic disease is disclosed, comprising:
[0046] Primers for detecting Yersinia pestis, with sequences as shown in SEQ ID NO.1 to SEQ ID NO.12;
[0047] Primers for detecting Streptococcus suis, with sequences shown in SEQ ID NO.13 to SEQ ID NO.24;
[0048] Primers for detecting Vibrio vulnificus, with sequences shown in SEQ ID NO.25 to SEQ ID NO.36;
[0049] Primers for detecting Aeromonas spp., with sequences shown in SEQ ID NO.37 to SEQ ID NO.46;
[0050] Primers for detecting Leptospira* (Leptospira noguchi) with sequences as shown in SEQ ID NO.47 to SEQ ID NO.56;
[0051] Primers for detecting Leptospira genus* (Leptospira renalis) with sequences as shown in SEQ ID NO.57~SEQ ID NO.68;
[0052] Primers for detecting Hantavirus, with sequences shown in SEQ ID NO.69 to SEQ ID NO.74;
[0053] Primers for detecting Seoul virus, with sequences shown in SEQ ID NO.75 to SEQ ID NO.88;
[0054] Primers for detecting California encephalitis virus, with sequences shown in SEQ ID NO.89 to SEQ ID NO.100;
[0055] Primers for detecting Rift Valley fever virus, with sequences shown in SEQ ID NO.101 to SEQ ID NO.110;
[0056] Primers for detecting Crimean-Congo hemorrhagic fever virus, with sequences shown in SEQ ID NO.111 to SEQ ID NO.118;
[0057] Primers for detecting novel Bunyaviruses, with sequences shown in SEQ ID NO.119 to SEQ ID NO.126;
[0058] Primers for detecting yellow fever virus, with sequences shown in SEQ ID NO.127 to SEQ ID NO.134;
[0059] Primers for detecting dengue virus, with sequences shown in SEQ ID NO.135 to SEQ ID NO.140;
[0060] Primers for detecting Japanese encephalitis virus, with sequences shown in SEQ ID NO.141 to SEQ ID NO.150;
[0061] Primers for detecting West Nile virus, with sequences shown in SEQ ID NO.151 to SEQ ID NO.158;
[0062] Primers for detecting St. Louis encephalitis virus, with sequences shown in SEQ ID NO.159 to SEQ ID NO.166;
[0063] Primers for detecting Usutu virus, with sequences shown in SEQ ID NO.167 to SEQ ID NO.174;
[0064] Primers for detecting tick-borne encephalitis virus, with sequences shown in SEQ ID NO.175 to SEQ ID NO.180;
[0065] Primers for detecting Zika virus, with sequences shown in SEQ ID NO.181 to SEQ ID NO.192;
[0066] Primers for detecting ALKhurma hemorrhagic fever virus, with sequences shown in SEQ ID NO.193 to SEQ ID NO.200;
[0067] Primers for detecting lymphocytic choroid plexus meningitis virus, with sequences shown in SEQ ID NO.201 to SEQ ID NO.208;
[0068] Primers for detecting Lassa virus, with sequences shown in SEQ ID NO.209 to SEQ ID NO.218;
[0069] Primers for detecting kuning virus (Mammalian arenavirus*) with sequences as shown in SEQ ID NO.219 to SEQ ID NO.226;
[0070] Primers for detecting Guanareto virus (Mammalian Arenavirus*) with sequences as shown in SEQ ID NO.227~SEQ ID NO.234;
[0071] Primers for detecting muschopovirus (Mammalian Arenavirus*) with sequences as shown in SEQ ID NO.235~SEQ ID NO.242;
[0072] Primers for detecting Ebola virus, with sequences shown in SEQ ID NO.243 to SEQ ID NO.246;
[0073] Primers for detecting sandfly virus, with sequences shown in SEQ ID NO.247 to SEQ ID NO.254;
[0074] Primers for detecting Casanor forest disease virus, with sequences shown in SEQ ID NO.255 to SEQ ID NO.262.
[0075] In other embodiments of the present invention, the use of the above-described primers for detecting pathogens of fever with hemorrhage is disclosed in the preparation of a kit for detecting pathogens of fever with hemorrhage.
[0076] In other embodiments of the present invention, a kit for detecting pathogens of fever with hemorrhage is disclosed, comprising the primers described above for detecting pathogens of fever with hemorrhage.
[0077] In some embodiments, the kit also includes a multi-PCR buffer and an RT Enzyme.
[0078] In some embodiments, the working concentrations of primers for detecting Yersinia pestis, Streptococcus suis, Vibrio vulnificus, Aeromonas hydrophila, Aeromonas daca, and Aeromonas hydrophila are all 180 nM to 220 nM; the working concentrations of primers for detecting Leptospira* (Leptospira noguchi and Leptospira renalis) are all 230 nM to 280 nM; and the working concentrations of primers for detecting Hantavirus, Seoul virus, California encephalitis virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, and novel coronavirus are all 180 nM to 220 nM. The working concentrations of primers for Bunyavirus, Yellow Fever Virus, Dengue Virus, Japanese Encephalitis Virus, West Nile Virus, St. Louis Encephalitis Virus, Usutu Virus, Tick-borne Encephalitis Virus, Zika Virus, Al-Khurma Hemorrhagic Fever Virus, Lymphocytic Choroid Meningitis Virus, Lassa Virus, Mammalian Arenaviruses* (Guining Virus, Guanareto Virus, Machupo Virus), Ebola Virus, Sandfly Virus, and Casanor Forest Disease Virus are all 380 nM to 420 nM.
[0079] In other embodiments of the present invention, a method for detecting pathogens of fever with hemorrhage is provided, comprising the following steps: using cDNA of the sample to be tested as a template and the primers for detecting pathogens of fever with hemorrhage as primers for multiplex PCR amplification.
[0080] In some embodiments, the cDNA is obtained by reverse transcription of the RNA of the sample to be tested. The reverse transcription reaction system is as follows: 14 μl template RNA, 2 μl Random hexamers, 2 μl 10×RT Mix, and 2 μl reverse transcriptase. The reverse transcription reaction program is as follows: 25℃ for 5 min, 37℃ for 45 min, and 85℃ for 5 s.
[0081] In some embodiments, the reaction system for the multiplex PCR amplification includes: 5 μl of 5x Multi-PCR buffer, 3 μl of RT Enzyme Mix, 7.5 μl of primer pool, and 9.5 μl of cDNA.
[0082] In some embodiments, the reaction program for the multiplex PCR amplification is as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 60°C annealing for 1 min, 72°C extension for 1 min, 28 cycles; and 72°C extension for 1 min after the cycle.
[0083] In some embodiments, the multiplex PCR amplification is followed by a second round of PCR amplification. The reaction system for the second round of PCR amplification includes: PCR mix 25 μl, Index N5 2.5 μl, Index N7 2.5 μl, and multiplex PCR amplification product 20 μl. The reaction program for the second round of PCR amplification is as follows: 95℃ for 5 min; 95℃ denaturation for 20 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 10 cyc; and 72℃ extension for 5 min after the cycle.
[0084] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0085] Example 1: Primers for detecting pathogens causing fever with hemorrhage
[0086] Primers were designed using the biological software Primer3 to target conserved regions of 26 pathogens associated with fever and hemorrhage. The design ensured that the primers were specific, amplifying only the corresponding sequence fragment per primer pair, and that there was no interference with other primers (i.e., no homology, complementarity, or hairpin formation). The screening criteria were as follows:
[0087] 1. Design as many available primers as possible for each target region;
[0088] 2. Based on the specificity of primer amplification, whether the primers contain simple repeat sequences, and whether there are high-frequency SNP sites on the primers;
[0089] 3. For primers that meet the filtering conditions in the previous step, select the pair of primers with the highest Primer3 score for each target region. The primers selected for different target regions should meet the principle of "minimizing primer-to-primer interactions", that is, minimizing the complementarity of the 3' ends of the primers and the overall primer complementarity.
[0090] Subsequently, the adapter sequence tcgtcggcagcgtcagatgtgtataagagacag was added to the 5' end of each forward primer, and the adapter sequence gtctcgtgggctcggagatgtgtataagagacag was added to the 5' end of each reverse primer. The amplification product was 100-200 bp. The specific sequences of the specific primers are shown in Table 1.
[0091] Table 1. Specific primers for 26 pathogens associated with fever and hemorrhage.
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105] Example 2: Method for detecting pathogens causing fever with hemorrhage
[0106] Includes the following steps:
[0107] I. Nucleic Acid Extraction
[0108] 1. Cerebrospinal fluid pretreatment
[0109] a) Place the sampling tube on a vortex mixer and vortex for 30 seconds. Then, take 1.3 mL of the sample and centrifuge at 12,000 rpm for 5 minutes to enrich the pathogens.
[0110] b) After centrifugation, discard the supernatant, retain 400 μL of sample, and mix thoroughly by pipetting.
[0111] c) Take 400 μL of sample into the bead milling tube of the extraction kit, add 40 μL of SDS, tighten the cap, and put it into the cell wall breaker for cell wall breaker treatment (4700 rpm, shake for 45 s, pause for 20 s, repeat 2 times, shake for a total of 3 times, time is 135 s).
[0112] d) After the cell wall disruption process is completed, centrifuge at 12,000 rpm for 5 min, and take 400 μL (manual extraction) or 250 μL (automatic extraction) of the supernatant for nucleic acid extraction;
[0113] 2. Nucleic acid extraction
[0114] Manual extraction was performed using "Nucleic Acid Extraction or Purification Reagent" (Guangzhou Meiji Biotechnology Co., Ltd., catalog number: R6672-01B); or automated extraction was performed on an automated extraction workstation, KingFisher flex, using "Nucleic Acid Extraction or Purification Reagent" (Guangzhou Meiji Biotechnology Co., Ltd., catalog numbers: R6672B-F-24, R6672B-F-48, R6672B-F-96). Nuclease-free water was used as a pure water quality control (NTC1) and extracted along with the sample to control contamination throughout the test.
[0115] 3. Nucleic acid concentration detection
[0116] The nucleic acid concentration of the sample was determined using a Qubit 3.0 / 4.0 spectrophotometer, following the instructions for the Equalbit DNAHSAssay Kit, and the concentration was recorded. Alternatively, the nucleic acid concentration was determined using a spectrophotometer, following the instructions for the spectrophotometer, and the concentration was recorded.
[0117] II. Enrichment of Target Fragments
[0118] 1. Primer pool
[0119] The 131 primer pairs (SEQ ID NO.1 to SEQ ID NO.262) in Table 1 were mixed to form a Primer Pool, with concentrations as shown in Table 1 (SEQ ID NO.1 to SEQ ID NO.46 primers: 200 nM; SEQ ID NO.47 to SEQ ID NO.68 primers: 250 nM; SEQ ID NO.69 to SEQ ID NO.262 primers: 400 nM). The Primer Pool was used for the first round of PCR, i.e., enrichment of the target nucleic acid fragment, and for adding adapter sequences needed for the second round of amplification.
[0120] 2. Reverse transcription
[0121] Using the RNA extracted in step one as a template, reverse transcription was performed using NEB's reverse transcription reagent. The reverse transcription reaction system and procedure are shown in Table 2.
[0122] Table 2
[0123]
[0124]
[0125] 3. First round of multiplex PCR amplification
[0126] Using the DNA extracted in step one or the cDNA reverse transcribed above as a template, and the primer pool above as primers, the first round of multiplex PCR amplification was performed. The reaction system and procedure are shown in Table 3.
[0127] Table 3
[0128]
[0129] Add 25 μl of ddH2O to 25 μl of PCR product, mix well, then add 50 μl of AMpure XP Beads, mix well by pipetting, and let stand at room temperature for 5 min. Place on a magnetic rack, and after 5 min, discard the supernatant when the liquid becomes clear. Add 200 μl of freshly prepared 80% ethanol, let stand on a magnetic rack for 30 s, then discard the supernatant. Repeat once. Remove any residual ethanol, open the lid, and air dry at room temperature for about 5 min. Once the magnetic beads are dry, add 23 μl of ddH2O to elute the DNA. Mix well by pipetting, let stand at room temperature for 3 min, and then use 20 μl for the second amplification.
[0130] 4. Second round of PCR amplification
[0131] Using the first-round PCR product as a template, a second-round PCR amplification was performed (using NEB's secondary amplification index primers). The reaction system and procedure are shown in Table 4.
[0132] Table 4
[0133]
[0134] Add 50 μl of AMpure XP Beads to 50 μl of PCR product, mix well by pipetting, and let stand at room temperature for 5 min. Place on a magnetic rack and wait for the liquid to clear for 5 min, then discard the supernatant. Add 200 μl of freshly prepared 80% ethanol, let stand on a magnetic rack for 30 s, then discard the supernatant. Repeat once. Remove any residual ethanol, open the cap and air dry at room temperature for about 5 min. Once the magnetic beads are dry, add 23 μl of ddH2O to elute the DNA. Mix well by pipetting, let stand at room temperature for 3 min, and then use 21 μl for the second amplification.
[0135] 5. Sequencing library pooling and sequencing
[0136] The purified products from the second PCR amplification were pooled at 50 ng per sample. Quantification was performed using qubit sequencing, and the qualified libraries were then sequenced using Miniseq.
[0137] Experimental Example 1: Methodological Validation of the Detection Method of the Invention
[0138] 1. Accuracy
[0139] The positive concordance rate was used to evaluate the accuracy of the test results. Using the detection method described in Example 2, 30 clinical metagenomic sequencing tests were performed. Samples with positive results were then tested, and the consistency with known results was compared. The positive concordance rate results are shown in Table 5.
[0140] Table 5 Positive Concordance Rate
[0141]
[0142]
[0143] As shown in Table 5, all 30 positive samples passed quality control and the verification results were completely consistent, with a positive compliance rate of 100%.
[0144] 2. Specificity
[0145] The negative coincidence rate was used to evaluate the specificity of the test results. Using the detection method described in Example 2, 17 samples with negative results from clinical metagenomic sequencing were tested, and the consistency with known results was compared. The negative coincidence rate results are shown in Table 6.
[0146] Table 6 Negative Concordance Rate
[0147]
[0148]
[0149] As shown in Table 6, all 17 negative samples passed quality control and were all negative, with a negative compliance rate of 100%.
[0150] 3. Detection limit
[0151] Prepare 10 4 copy / ml-10 1 Twenty pathogens (purchased from a microbial culture center) at different concentrations per copy / ml were tested for detection limits. All pathogens were detected, which served as the lowest detection limit standard.
[0152] The results are as follows Figure 1 As shown. Figure 1 The results showed that a concentration of 10 2 The sample size was [copy / ml], and all pathogens could be detected; therefore, the limit of detection was 10. 2 copy / ml.
[0153] Experiment Example 2: Primer Concentration Optimization Experiment
[0154] Twenty-six samples were selected, corresponding to the 26 pathogens described in this invention. The primer pool for the first round of PCR contained 131 primer pairs, corresponding to 131 amplicon numbers. The primers were divided into three groups: group M1 included primers SEQ ID NO.1–SEQ ID NO.46, group M2 included primers SEQ ID NO.47–SEQ ID NO.68, and group M3 included primers SEQ NO.69–SEQ ID NO.262. The three groups of primers were mixed according to their respective concentration ratios. The amplification efficiency of the primers was determined based on the amplicon detection results, following the method described in Example 2 of this invention.
[0155] Table 7
[0156]
[0157] As shown in Table 7, when using Scheme 2, i.e., when the concentration of M1 (SEQ ID NO.1~SEQ ID NO.46) is 200 nM, the concentration of M2 (SEQ NO.47~SEQ ID NO.68) is 250 nM, and the concentration of M3 (SEQ NO.69~SEQ ID NO.262) is 400 nM, each amplicon can be detected.
[0158] Experiment Example 3: Optimization Experiment of Reaction Procedure
[0159] Using the method of Example 2 of this invention, a sample containing four pathogens (Streptococcus suis, Vibrio vulnificus, Aeromonas spp., and Leptospira renalis) was tested during multiplex PCR amplification at PCR cycle numbers of 25 cyc, 26 cyc, 28 cyc, 30 cyc, and 32 cyc (samples 1-4). The library concentration and detected pathogens are shown in Table 8.
[0160] Table 8
[0161]
[0162] As shown in Table 8, the library concentrations at 25 and 26 cycles were too low, resulting in the failure to detect some pathogens. At 28-32 cycles, all pathogens could be detected while maintaining sufficient library concentration. To minimize the time required, the optimal number of cycles was set to 28 cycles.
[0163] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0164] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A primer for detecting pathogens causing fever accompanied by hemorrhagic disease, characterized in that, include: Primers for detecting Yersinia pestis, with sequences as shown in SEQ ID NO.1~SEQ ID NO.12; Primers for detecting Streptococcus suis, with sequences shown in SEQ ID NO.13~SEQ ID NO.24; Primers for detecting Vibrio vulnificus, with sequences shown in SEQ ID NO.25~SEQ ID NO.36; Primers for detecting Aeromonas spp., with sequences as shown in SEQ ID NO.37~SEQ ID NO.46; Primers for detecting Leptospira noguchi, with sequences as shown in SEQ ID NO.47~SEQ ID NO.56; Primers for detecting Leptospira in the kidney, with sequences shown in SEQ ID NO.57~SEQ ID NO.68; Primers for detecting Hantavirus, with sequences shown in SEQ ID NO.69~SEQ ID NO.74; Primers for detecting Seoul virus, with sequences shown in SEQ ID NO.75~SEQ ID NO.88; Primers for detecting California encephalitis virus, with sequences shown in SEQ ID NO.89~SEQ ID NO.100; Primers for detecting Rift Valley fever virus, with sequences shown in SEQ ID NO.101~SEQ ID NO.110; Primers for detecting Crimean-Congo hemorrhagic fever virus, with sequences shown in SEQ ID NO.111~SEQ ID NO.118; Primers for detecting novel Bunyaviruses, with sequences shown in SEQ ID NO.119~SEQ ID NO.126; Primers for detecting yellow fever virus, with sequences as shown in SEQ ID NO.127~SEQ ID NO.130 and SEQ ID NO.133~SEQ ID NO.134; Primers for detecting dengue virus, with sequences shown in SEQ ID NO.135~SEQ ID NO.140; Primers for detecting Japanese encephalitis virus, with sequences shown in SEQ ID NO.141~SEQ ID NO.150; Primers for detecting West Nile virus, with sequences shown in SEQ ID NO.151~SEQ ID NO.158; Primers for detecting St. Louis encephalitis virus, with sequences shown in SEQ ID NO.159~SEQ ID NO.166; Primers for detecting Usutu virus, with sequences shown in SEQ ID NO.167~SEQ ID NO.174; Primers for detecting tick-borne encephalitis virus, with sequences shown in SEQ ID NO.175~SEQ ID NO.180; Primers for detecting Zika virus, with sequences shown in SEQ ID NO.181~SEQ ID NO.192; Primers for detecting ALKhurma hemorrhagic fever virus, with sequences shown in SEQ ID NO.193~SEQ ID NO.200; Primers for detecting lymphocytic choroid plexus meningitis virus, with sequences shown in SEQ ID NO.201~SEQ ID NO.208; Primers for detecting Lassa virus, with sequences shown in SEQ ID NO.209~SEQ ID NO.218; Primers for detecting the quinine virus, with sequences shown in SEQ ID NO.219~SEQ ID NO.226; Primers for detecting Guanareto virus, with sequences shown in SEQ ID NO.227~SEQ ID NO.234; Primers for detecting machubovirus, with sequences shown in SEQ ID NO.235~SEQ ID NO.242; Primers for detecting Ebola virus, with sequences shown in SEQ ID NO.243~SEQ ID NO.246; Primers for detecting sandfly virus, with sequences shown in SEQ ID NO.247~SEQ ID NO.254; Primers for detecting Casanor forest disease virus, with sequences shown in SEQ ID NO.255~SEQ ID NO.
262.
2. The application of the primers for detecting pathogens of fever with hemorrhage as described in claim 1 in the preparation of a kit for detecting pathogens of fever with hemorrhage, wherein the pathogens of fever with hemorrhage are Yersinia pestis, Streptococcus suis, Vibrio vulnificus, Aeromonas spp., Leptospira noguchi, Leptospira renalis, Hantavirus, Seoul virus, California encephalitis virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever virus, novel Bunyavirus, yellow fever virus, dengue virus, Japanese encephalitis virus, West Nile virus, St. Louis encephalitis virus, Usutu virus, tick-borne encephalitis virus, Zika virus, Al-Khurma hemorrhagic fever virus, lymphocytic choriomeningitis virus, Lassa virus, Junin virus, Guanareto virus, Machupo virus, Ebola virus, sandfly virus, and Casanor forest disease virus.
3. A kit for detecting pathogens causing fever accompanied by hemorrhagic disease, characterized in that, The kit includes the primers for detecting pathogens with fever and hemorrhage as described in claim 1.
4. The kit for detecting pathogens causing fever accompanied by hemorrhagic disease according to claim 3, characterized in that, The kit also includes a multi-PCR buffer and an RT Enzyme.
Citation Information
Patent Citations
Suspension-array multiple non-diagnostic detection method for mouse-borne pathogens
CN103173566A
KR20220052483A