A method for detecting fusarium pseudograminearum by PCR and application thereof

By designing specific primer combinations and optimizing PCR reaction conditions, a rapid, specific, and sensitive detection of Fusarium brevesii was achieved, overcoming the shortcomings of existing detection methods and making it suitable for the identification of soil-borne diseases in tomatoes.

CN116377119BActive Publication Date: 2026-05-12INST OF PLANT PROTECTION & SOIL FERTILIZER HUBEI ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF PLANT PROTECTION & SOIL FERTILIZER HUBEI ACAD OF AGRI SCI
Filing Date
2023-05-29
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The lack of rapid, specific, and sensitive PCR detection methods for Fusarium breviculae in existing technologies makes it difficult to effectively identify soil-borne diseases of tomatoes, which may lead to serious economic losses.

Method used

设计特异性引物组合(上游引物Fb-F和下游引物Fb-R),用于PCR检测短柄镰刀菌,结合适当的反应条件(94℃变性30s,60℃退火30s,72℃延伸30s的循环),并通过琼脂糖凝胶电泳判定结果。

Benefits of technology

It achieves rapid, specific and sensitive detection of Fusarium breviculae, can specifically amplify a 283bp DNA band in tomato samples, and can detect pathogen genomic DNA as low as 10 pg/μL, making it suitable for pathogen identification in field samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116377119B_ABST
    Figure CN116377119B_ABST
Patent Text Reader

Abstract

The application discloses a PCR (Polymerase Chain Reaction) detection method of Fusarium pseudograminearum and application thereof, and belongs to the technical field of biological detection and identification. The primer set used in the PCR detection method comprises an upstream primer and a downstream primer. The sequence of the upstream primer is shown as SEQ ID NO. 1. The sequence of the downstream primer is shown as SEQ ID NO. 2. The PCR detection method has good specificity, can only amplify the Fusarium pseudograminearum from 23 test strains, and can detect pathogenic bacterial genomic DNA as low as 10 pg / microL. Therefore, the primer and the detection method designed in the application can quickly, specifically and sensitively identify the Fusarium pseudograminearum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection and identification technology, and in particular relates to a PCR detection method for Fusarium brevis and its application. Background Technology

[0002] Tomatoes are widely cultivated in various regions of my country. With the gradual expansion of planting area and the increasing multiple cropping index year after year, the occurrence and damage of soil-borne diseases are also showing a trend of increasing severity annually. Common soil-borne diseases of tomatoes include bacterial wilt, Fusarium wilt, root rot, Verticillium wilt, brown root rot, and damping-off, with the dominant pathogens being *Ralstonia solanacearum*, *Fusarium oxysporum*, *Fusarium solani*, *Verticillium dahliae*, *Pyrenochaeta lycopersici*, and *Rhizoctonia solani*, respectively. These diseases have caused serious economic losses to solanaceous crop producing areas throughout my country. Recently, during a survey of soil-borne diseases of tomato, the first report of *Fusarium brachygibbosum* causing tomato wilt symptoms in China was published (Jun Liu, Yi Si Deng, Wei Chang, and Hua Wang. 2023. First report of tomato wilt caused by *Fusarium brachygibbosum* in China. https: / / doi.org / 10.1094 / PDIS-01-23-0076-PDN). This pathogen can pose a serious threat to tomato cultivation and potentially cause significant economic losses to the tomato industry. Therefore, rapid identification of this pathogen will help in the research of effective disease management strategies to prevent severe tomato yield reduction. However, rapid PCR molecular detection studies of *Fusarium brachygibbosum* have not yet been reported.

[0003] With the rapid development of molecular biology techniques, many molecular detection methods for pathogens based on molecular biology have been developed. Compared with traditional detection methods based on isolation, culture, and morphological observation, molecular identification methods for pathogens are more accurate and efficient. Summary of the Invention

[0004] One objective of this invention is to provide a primer set for PCR detection of Fusarium brevis, the primer set comprising an upstream primer and a downstream primer; the sequence of the upstream primer is shown in SEQ ID NO.1; and the sequence of the downstream primer is shown in SEQ ID NO.2.

[0005] A second objective of this invention is to provide a reagent for detecting Fusarium brevis, the reagent containing the primer sets SEQ ID NO.1 and SEQ ID NO.2 described above.

[0006] A third objective of this invention is to provide a kit for detecting Fusarium brevis, wherein the kit contains the primer set SEQ ID NO.1 and SEQ ID NO.2 or the reagents described above.

[0007] The fourth objective of this invention is to provide a PCR identification method for Fusarium brevis, wherein the identification method uses total DNA from the sample as a template, performs PCR amplification using the primer set SEQ ID NO.1 and SEQ ID NO.2 mentioned above, and determines the results based on agarose gel electrophoresis after the reaction.

[0008] Preferably, the PCR reaction program is as follows: pre-denaturation at 94℃ for 5 min; then cycling, denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, for 35 cycles; and finally extension at 72℃ for 10 min.

[0009] More preferably, the total volume of the PCR reaction system is 25 μL, including: 2.5 μL of 10× PCR buffer, 1.5 μL of 25 mM MgSO4. 2+ 2 μL 10 mM dNTP, 0.125 μL 5 U / μL Taq DNA polymerase, 1 μL of 10 μM upstream primer SEQ ID NO.1, 1 μL of 10 μM downstream primer SEQ ID NO.2, 1 μL DNA template, 15.875 μL ddH2O.

[0010] More preferably, the DNA template is extracted from tomatoes.

[0011] The fifth objective of this invention is to provide the application of the above-mentioned primer sets SEQ ID NO.1 and SEQ ID NO.2, or the above-mentioned reagents or kits, in the identification of Fusarium brevis.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] The advantage of this invention is that the designed primer combination can rapidly detect the presence or absence of *Fusarium brevesii* in tomato samples. The PCR detection exhibits excellent specificity, amplifying only *Fusarium brevesii* from 23 test strains, and can detect pathogenic genomic DNA as low as 10 pg / μL. Therefore, the primers and detection method designed in this invention can rapidly, specifically, and sensitively identify *Fusarium brevesii*. Attached Figure Description

[0014] Figure 1This is an agarose gel electrophoresis image of the specific detection of *Fusarium brevis* using the PCR primers in Example 2. M: 2000bp DNA Marker; NC: sterile water, negative control; PC: *Fusarium brevis* DNA, positive control; Lane 1: *Fusarium oxysporum* DNA; Lane 2: *Fusarium verticillatum* DNA; Lane 3: *Fusarium effusum* DNA; Lane 4: *Fusarium graminearum* DNA; Lane 5: *Fusarium pseudograminearum* DNA; Lane 6: *Fusarium solani* DNA; Lane 7: *Fusarium rosenbergii* DNA; Lane 8: *Fusarium equisetifolium* DNA; Lane 9: *Fusarium asiaticum* DNA; Lane 10: *Fusarium fusiforme* DNA. Lane 11: Fusarium scutellatus DNA; Lane 12: Alternaria alternata DNA; Lane 13: Sclerotium sclerotiorum DNA; Lane 14: Sclerotium sclerotiorum DNA; Lane 15: Rhizoctonia graminearum DNA; Lane 16: Prunella vulgaris DNA; Lane 17: Prunella tamariscina DNA; Lane 18: Verticillium dahliae DNA; Lane 19: Staphylococcus aureus DNA; Lane 20: Botrytis cinerea DNA; Lane 21: Cucurbita wilt DNA; Lane 22: Cucurbita anthracnose DNA.

[0015] Figure 2 This is an agarose gel electrophoresis image of the sensitivity detection of PCR primers against Fusarium brevis in Example 3, where M: 2000bp DNA Marker; Lane 1: 10ng / μL; Lane 2: 1ng / μL; Lane 3: 100pg / μL; Lane 4: 10pg / μL; Lane 5: 1pg / μL; Lane 6: 100fg / μL; Lane 7: 10fg / μL.

[0016] Figure 3 This is an agarose gel electrophoresis image of field tomato samples detected by PCR in Example 4, where M: 2000bp DNA Marker; PC: Fusarium brevis DNA, positive control; NC: sterile water, negative control; lanes 1-22: field tomato samples. Detailed Implementation

[0017] Example 1

[0018] Establishment of a molecular detection method for Fusarium brevesti

[0019] 1. Primer design

[0020] Download the following Fusarium species from the NCBI (National Center for Biotechnology Information) database: Fusarium brachygibbosum HN-1 (GenBank Accession No. MU249523.1), Fusarium oxysporum (GenBank Accession No. NC_030986), F. proliferatum FP-A8 (GenBank Accession No. MRDB01000001.1), F. verticillioides 7600 (GenBank Accession No. CM000579.1), F. equiseti D25-1 (GenBank Accession No. QOHM01000001.1), F. solani JS-169 (GenBank Accession No. NGZQ01000001.1), and F. incarnatum MOD1-FUNGI18 (GenBank Accession No. 1). The whole genome sequences of *Fusarium asiaticum* (RBBZ01000100.1) and *F. asiaticum* KCTC 16664 (GenBank Accession No. CP088257.1) were obtained. Multi-genome alignment analysis of all whole genome sequences identified a 21 bp sequence located on the gene encoding carbamoyl phosphate synthase. This sequence was used as the upstream specific primer (Fb-F) for *Fusarium asiaticum* PCR, and a specific downstream primer (Fb-R) was designed after the upstream primer sequence. The designed specific upstream and downstream primers were compared in the NCBI database to preliminarily identify the specificity of the primer sequences. Finally, specific detection primers for *Fusarium asiaticum* PCR were obtained. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0021] Upstream primer:

[0022] Fb-F (SEQ ID NO.1): CAATTGCTGCCACTCGACCTG;

[0023] Downstream primer

[0024] Fb-R (SEQ ID NO. 2): TATTGTGGTGAGGAGGAGTCG.

[0025] 2. Extraction of pathogenic bacterial genomic DNA

[0026] Extraction was performed according to the instructions for the TIANGEN plant genome extraction kit.

[0027] 3. PCR molecular detection of Fusarium brevesii

[0028] PCR amplification was performed using the sample DNA as a template. The total volume of the PCR reaction system was 25 μL, including: 2.5 μL 10× PCR buffer, 1.5 μL MgSO4, and MgSO4. 2+ The following reagents were used: 2 μL dNTP (concentration 25 mM), 0.125 μL Taq DNA polymerase (5 U / μL), 1 μL upstream primer Fb-F (concentration 10 μM) and 1 μL downstream primer Fb-R (concentration 10 μM), 1 μL Fusarium brevis DNA template, and 15.875 μL ddH2O. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; then cycling, 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; final extension at 72℃ for 10 min; amplification was completed, and the amplified product was stored at 4℃. 5 μL of the PCR product was electrophoresed on a 1% m / v agarose gel, stained with ethidium bromide, and the size of the amplified product was observed under UV light. The amplified 283 bp DNA band was identified as Fusarium brevis.

[0029] Example 2

[0030] Specificity verification of primers for Fusarium brevis PCR detection

[0031] 1. DNA extraction from the sample to be tested

[0032] DNA was extracted from *Fusarium brevesti*, *Fusarium oxysporum*, *Fusarium verticillatum*, *Fusarium moniliforme*, *Fusarium graminearum*, *Fusarium pseudograminearum*, *Fusarium rotundum*, *Fusarium rosenbergii*, *Fusarium equisetifolium*, *Fusarium asiaticum*, *Fusarium truncatum*, *Fusarium scutellatus*, *Alternaria alternata*, *Sclerotium sclerotiorum*, *Rhizoctonia graminearum*, *Pseudomonas auriculatus*, *Pseudomonas pulmonarius*, *Pseudomonas chamaejasminoides*, *Verticillium dahliae*, *Botrytis cinerea*, *Botrytis cinerea*, *Cyclocarya paliurus*, and *Anthracnose causal agent of cucurbits* using the methods described above.

[0033] 2. Specific detection

[0034] PCR amplification was performed using the genomic DNA of the tested fungi as templates. The total volume of the PCR reaction system was 25 μL, including: 2.5 μL 10× PCR buffer, 1.5 μL MgSO4, and MgSO4. 2+The following reagents were added: 2 μL dNTP (concentration 25 mM), 0.125 μL Taq DNA polymerase (5 U / μL), 1 μL upstream primer Fb-F (concentration 10 μM) and 1 μL downstream primer Fb-R (concentration 10 μM), 1 μL Fusarium brevis DNA template, and 15.875 μL ddH2O. The PCR reaction program was: 94℃ pre-denaturation for 5 min; then cycling, 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; final extension at 72℃ for 10 min; amplification was completed, and the amplified products were stored at 4℃. 5 μL of the PCR product was electrophoresed on a 1% m / v agarose gel, stained with ethidium bromide, and the size of the amplified products was observed under UV light. Figure 1 As shown, multiplex PCR could only specifically amplify Fusarium brevicorum with a 283 bp DNA band, while no amplification band was obtained for other strains.

[0035] Example 3

[0036] Sensitivity verification of primers for PCR detection of Fusarium brevis

[0037] 1. DNA extraction from the sample to be tested

[0038] DNA was extracted from Fusarium brevis using the method described above.

[0039] 2. Sensitivity Detection

[0040] The concentration of the genomic DNA was determined using a NanoDrop micro-volume spectrophotometer and serially diluted with ddH2O to 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL, respectively. PCR amplification was performed using these different concentrations of DNA as templates. The total volume of the PCR reaction system was 25 μL, including: 2.5 μL 10× PCR buffer, 1.5 μL MgSO4, and 10 fg / μL MgSO4. 2+ The following reagents were added: 2 μL dNTP (concentration 25 mM), 0.125 μL Taq DNA polymerase (5 U / μL), 1 μL upstream primer Fb-F (concentration 10 μM) and 1 μL downstream primer Fb-R (concentration 10 μM), 1 μL Fusarium brevis DNA template, and 15.875 μL ddH2O. The PCR reaction program was: 94℃ pre-denaturation for 5 min; then cycling, 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; final extension at 72℃ for 10 min; amplification was completed, and the amplified products were stored at 4℃. 5 μL of the PCR product was electrophoresed on a 1% m / v agarose gel, stained with ethidium bromide, and the size of the amplified products was observed under UV light. Figure 2As shown, the sensitivity verification results indicate that the minimum limit for multiplex PCR detection of Fusarium brevis DNA concentration is 10 pg / μL.

[0041] Example 4

[0042] Actual testing of tomato samples from the field

[0043] 1. Extraction of total DNA from the plant material to be tested

[0044] Take about 0.5g of tomato root, grind it into powder in liquid nitrogen, and then extract it according to the instructions of TIANGEN's Plant Genome Extraction Kit.

[0045] 2. Pathogen detection of tomato samples from the field

[0046] PCR amplification was performed using the tomato sample DNA as a template. The total volume of the PCR reaction system was 25 μL, including: 2.5 μL 10× PCR buffer, 1.5 μL MgSO4, and MgSO4. 2+ The following reagents were added: 2 μL dNTP (concentration 25 mM), 0.125 μL Taq DNA polymerase (5 U / μL), 1 μL upstream primer Fb-F (concentration 10 μM) and 1 μL downstream primer Fb-R (concentration 10 μM), 1 μL Fusarium brevis DNA template, and 15.875 μL ddH2O. The PCR reaction program was: 94℃ pre-denaturation for 5 min; followed by cycling: 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles; final extension at 72℃ for 10 min; amplification was completed, and the amplified products were stored at 4℃. 5 μL of the PCR product was electrophoresed on a 1% m / v agarose gel, stained with ethidium bromide, and the size of the amplified products was observed under UV light. Figure 3 As shown, the 283bp DNA band amplified was Fusarium brevicorum, and Fusarium brevicorum was identified in 14 out of 22 field tomato samples.

[0047] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer set for PCR detection of Fusarium brevis, characterized in that, The primer set includes an upstream primer and a downstream primer; the sequence of the upstream primer is shown in SEQ ID NO.1; and the sequence of the downstream primer is shown in SEQ ID NO.

2.

2. A reagent for detecting Fusarium brevesti, characterized in that, The reagent contains the primer set as described in claim 1.

3. A kit for detecting Fusarium brevesti, characterized in that, The kit contains the primer set as described in claim 1 or the reagent as described in claim 2.

4. A PCR identification method for Fusarium brevis, characterized in that, The identification method uses total DNA from the sample as a template and performs PCR amplification using the primer set described in claim 1. After the reaction, the results are determined by agarose gel electrophoresis.

5. The PCR identification method according to claim 4, characterized in that, The PCR reaction program was as follows: pre-denaturation at 94℃ for 5 min; then cycling, denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, for 35 cycles; and finally extension at 72℃ for 10 min.

6. The PCR identification method according to claim 5, characterized in that, The total volume of the PCR reaction system is 25 μL, including: 2.5 μL 10× PCR buffer, 1.5 μL 25 mM MgSO4. 2+ 2 μL 10 mM dNTP, 0.125 μL 5 U / μL Taq DNA polymerase, 1 μL SEQ ID NO.1 upstream primer at a concentration of 10 μM, 1 μL SEQ ID NO.2 downstream primer at a concentration of 10 μM, 1 μL DNA template, 15.875 μL ddH2O.

7. The PCR identification method according to claim 6, characterized in that, The DNA template was extracted from tomatoes.

8. The use of the primer set of claim 1, the reagent of claim 2, or the kit of claim 3 in the identification of Fusarium brevis.