RPA-LFS primer-probe combination for visual detection of Stenotrophomonas maltophilia and its application

Abstract

The present invention discloses an RPA-LFS primer-probe combination for visual detection of Stenotrophomonas maltophilia and its application. The present invention first designs 4 groups of candidate RPA primer pairs using the Stenotrophomonas maltophilia-specific sequence (NC_010943.1) as a template, detects the amplification performance of each primer pair and the formation of primer dimers by agarose gel electrophoresis, and screens out the best primer pair. According to the design of a specific probe sequence based on the best primer pair, when LFS detection is used, it is affected by primer dimers and produces a false positive signal; by introducing base mismatches into the primer and probe sequences, the primer dimers between the primer and the probe are eliminated, and no false positive signal is generated by LFS. The detection system was subjected to rigorous efficacy testing, thereby establishing an improved RPA-LFS system for detecting Stenotrophomonas maltophilia. Compared with PCR, the detection results of this method are accurate and consistent, the overlap rate with the culture-biochemical method is 99.07%, and the kappa index value is 0.9718.

Description

Technical Field

[0001] The present invention relates to the field of Stenotrophomonas maltophilia detection, and specifically to an RPA-LFS primer-probe combination for visual detection of Stenotrophomonas maltophilia and applications thereof. Background Art

[0002] Stenotrophomonas maltophilia (S. maltophilia, SMA) is a Gram-negative bacterium that is widely present in the natural environment. With the widespread use of broad-spectrum antimicrobial drugs and the increase in invasive procedures, the isolation rate of SMA has increased year by year, and it has become one of the important pathogens of hospital-acquired infections, ranking third among non-fermenting bacteria isolated from clinical settings. SMA is an important opportunistic pathogen in weakened hosts and can endanger the lives of people with compromised immune function. Patients with meningitis, cancer, chronic obstructive pulmonary disease or cystic fibrosis are susceptible to S. maltophilia, and the most common clinical manifestations are pneumonia, bacteremia, wound infections and urinary tract infections. In chronic infections, S. maltophilia can form small groups of variants that are difficult to detect in clinical specimens. The conventional detection method is the biochemical-culture method, but this method is time-consuming and can easily delay treatment. While molecular biological methods such as polymerase chain reaction (PCR) offer rapid detection and high accuracy, they are limited by the need for sophisticated instruments and specialized technicians, making them difficult to implement beyond laboratory walls and point-of-care testing (POCT). Therefore, developing a convenient, rapid, and sensitive detection method is crucial for the rapid diagnosis of Stenotrophomonas maltophilia.

[0003] Recombinant polymerase amplification (RPA) is a molecular technique developed by Piepengurg et al. in 2006. It is instrument-independent and can amplify target genes in a short time at a constant temperature of 37-42°C. Compared to other isothermal amplification techniques, RPA is more convenient to operate and has a simpler reaction system. The RPA reaction system primarily consists of key enzymes, an energy supply system (adenosine triphosphate), and a stabilization system (Tris, potassium acetate, and magnesium acetate). The key enzymes in the RPA reaction include DNA polymerase, T4 bacteriophage uvsX recombinase, the cofactor uvsY, and a single-stranded binding protein. With the help of the cofactor uvsY, the recombinase T4 uvsX binds to the primer, forming a DNA-nucleoprotein microfilament complex. The microfilament rapidly locates the target gene fragment, the primer binds tightly to its cognate sequence, and the uvsX is released. Subsequently, the target gene fragment is amplified by the action of DNApol. During this process, single-strand binding proteins bind to the displaced DNA strands, preventing them from reverting to double strands. This process continues in cycles, exponentially amplifying the target gene until the reaction system is depleted of energy. The RPA reaction requires two primers, which are longer than typical PCR primers, typically 30 to 35 base pairs. Tools such as Primer Primer and PrimerRPA are used to design candidate upstream and downstream primers. Primer pairs are then screened based on sensitivity, product yield, product-to-noise ratio, and amplification time to identify the optimal primer pair. For rapid RPA analysis, RPA amplicon length is typically limited to 500 base pairs, with an ideal length of 100 to 200 base pairs. Compared to traditional PCR, RPA does not require sophisticated equipment or specialized technicians, and amplification reactions can even be performed outdoors at room temperature.

[0004] Lateral flow strips (LFS) are paper-based, point-of-care testing devices that use colloidal gold nanoparticles (AuNPs) as signal tags. LFS, when used in conjunction with RPA, allows visual inspection of test results within minutes. The RPA-LFS reaction requires a specific probe and downstream primers. A tetrahydrofuran (THF) site is inserted into the middle of the probe, a blocking group is attached to the 3' end, and a fluorescent group is labeled at the 5' end. The downstream primer is labeled with biotin at the 5' end. The RPA-LFS reaction forms a binary complex product with a fluorescent label at the 5' end and a biotin label at the 3' end. When the product is applied dropwise to the nucleic acid test strip, the amplified product binds to a gold-labeled anti-fluorophore antibody, forming a ternary complex. When the ternary complex diffuses to the test line, it is captured by the anti-biotin antibody, causing color development on the test line. As the amplified product continues to flow to the control line, the gold-labeled antibody binds to the secondary antibody on the control line, causing color development on the control line. If both the test line and the control line show color, the test result is positive; if the test line does not show color but the control line does, the test result is negative. Data is unavailable if either of the following occurs on the test strip: 1. Both the control line and the test line do not show color; 2. The test line shows color but the control line does not.

[0005] Currently, RPA-LFS has been successfully used for molecular diagnosis of a variety of pathogens. However, a method for detecting Stenotrophomonas maltophilia using RPA-LFS has not yet been established. This present invention aims to develop an improved RPA-LFS technique for rapid detection of Stenotrophomonas maltophilia. Summary of the Invention

[0006] The purpose of the present invention is to address the defects of the prior art and provide an RPA-LFS primer-probe combination for visual detection of Stenotrophomonas maltophilia and its application, so as to solve the problems raised by the above background technology.

[0007] To achieve the above object, the present invention provides the following technical solutions: The present invention provides an RPA-LFS primer-probe combination for visual detection of Stenotrophomonas maltophilia, including an F / R / P primer-probe combination;

[0008] In the F / R / P primer probe combination;

[0009] The sequence of F (5′-3′) is: TGAGCGGAGGCAGGATCCACGGCTACATCTG;

[0010] The sequence of R (5′-3′) is: Biotin-CTGGCCATTCTATTCCATCGCCAGTTCT TC;

[0011] The sequence of P (5'-3') is: FITC-TGAGCGGAGGCAGGATCCACGGCTACAT CTG[THF]CAGGGCTTCAATCCGC- / C3-spacer / .

[0012] Application of the primer-probe combination for RPA-LFS detection of Stenotrophomonas maltophilia. The F / R / P primer-probe combination can be used for RPA-LFS detection of Stenotrophomonas maltophilia and is the optimal primer-probe combination.

[0013] The present invention uses RPA-LFS technology to develop a rapid visual detection method for Stenotrophomonas maltophilia that combines RPA and LFS technologies. This method can complete the identification of Stenotrophomonas maltophilia at 37°C and react for 8 minutes, and has good interspecies specificity and sensitivity. RPA-LFS, PCR and bacterial culture methods were used to test the consistency of clinical samples. The results showed that the detection results of RPA-LFS were the same as those of PCR, and the detection consistency with the culture method was 99.07%. RPA-LFS detection technology can realize rapid and portable detection of unknown bacterial species, with strong specificity and high sensitivity. It has good development prospects in POCT applications and is of great significance for the identification of Stenotrophomonas maltophilia.

[0014] The beneficial effects of the present invention are as follows: First, the present invention designed four sets of candidate primer pairs using the specific sequence of Stenotrophomonas maltophilia (NC_010943.1) as a template, and detected their amplification performance and primer dimer formation by agarose gel electrophoresis to screen out the optimal primer pair. Specific probes were designed based on the optimal primer pair. When using LFS detection, they were affected by primer dimers and produced false positive signals. By eliminating primer dimers through base mismatching between primers and probes, no false positive signals were produced by LFS. The detection system was rigorously tested for efficacy, thereby establishing an improved RPA-LFS system for detecting Stenotrophomonas maltophilia. Compared with PCR, this method achieved accurate and consistent detection results, with an overlap rate of 99.07% with the culture-biochemical method and a kappa index value of 0.9718. This method breaks free from the constraints of instrumentation and professional technology, has high sensitivity and specificity, and can achieve on-site instant detection of Stenotrophomonas maltophilia. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of the principle of the RPA-LFD method of the present invention;

[0016] Figure 2 Design of the optimal primer-probe combination of the present invention;

[0017] (A) Primer screening based on RPA amplification performance. Agarose gel image showing the amplification results of four primer pairs targeting the NC_010943.1 gene sequence, with the primer combination names indicated above the lanes; (B) Schematic diagram of base mismatches, with primer dimers before and after mismatches on the left and after and after mismatches on the right; (C) RPA-LFS detection results before and after mismatches, with primer-probe combinations indicated above the LFS.

[0018] Figure 3 Optimization of the RPA-LFS reaction conditions of the present invention;

[0019] (A) Optimization of the optimal reaction time for RPA-LFS reaction; (B) Optimization of the optimal reaction temperature for RPA-LFS reaction;

[0020] Figure 4 is the specificity of the RPA-LFS detection system of the present invention;

[0021] (A) RPA-LFS was performed on 12 common clinical standard strains. The strain ATCC number is marked on the top of each LFS line; (B) RPA-LFS was performed on 12 clinically isolated Stenotrophomonas maltophilia strains;

[0022] Figure 5 is the minimum detection limit of the RPA-LFS method of the present invention;

[0023] (A) Sensitivity of the RPA-LFS system was tested using different concentrations of the S. maltophilia genome; (B) The minimum detection limit of the RPA-LFS system was analyzed by SPSS software, with the horizontal dotted line indicating the 95% detection limit; (C) The anti-interference ability of RPA-LFS was tested by adding 10 ng of human genomic DNA to the reaction system. DETAILED DESCRIPTION

[0024] The preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the protection scope of the present invention.

[0025] Example:

[0026] Standard strains and clinical isolates:

[0027] A rapid RPA-LFS assay for the specific identification of Stenotrophomonas maltophilia was developed using Stenotrophomonas maltophilia. One standard strain and 12 clinical isolates of Stenotrophomonas maltophilia were collected from sputum, urine, and blood of patients. Twelve common clinical pathogens, including Staphylococcus haemolyticus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Acinetobacter baumannii, Haemophilus influenzae, Pseudomonas aeruginosa, Klebsiella pneumoniae, Enterococcus faecalis, Enterococcus faecium, Candida albicans, and Vibrio parahaemolyticus, were collected to test the specificity of the assay. All isolates were provided by the Department of Laboratory Medicine of Lianyungang Second People's Hospital and identified using reference culture-biochemical methods. Table 1 lists the strains used in this study.

[0028] Table 1: Standard strains and ATCC numbers used in the present invention

[0029]

[0030] To explore the applicability of the RPA-LFS detection method in clinical specimens, 108 clinical specimens were collected from the Microbiology Laboratory of the Laboratory Department of Lianyungang Second People's Hospital, including 57 from sputum, 30 from urine, and 21 from blood.

[0031] Extraction of microbial genomes:

[0032] Frozen Stenotrophomonas maltophilia was inoculated onto Columbia blood agar plates and incubated at 35°C in a microbiological incubator for 24 hours. A single colony was picked from the culture plate and placed in 5 mL of Luria-Bertani medium. The culture was shaken and incubated at 35°C in a shaking incubator for 12 hours. Genomic DNA from Stenotrophomonas maltophilia was extracted according to the instructions of a bacterial genomic extraction kit and stored at -20°C until use. The genomic DNA concentration was quantified using an ultramicrospectrophotometer. DNA from other strains and clinical samples was extracted using the boiling method. A bacterial lawn was placed in 100 μL of Tris-EDTA and boiled at 100°C for 10 minutes to release the genomic DNA. The supernatant was centrifuged at 12,000 rpm for 5 minutes, transferred to a sterile EP tube, and stored at -20°C until use.

[0033] RPA primer design:

[0034] The NCBI website was used to retrieve the sequence NC_010943.1 specific for Stenotrophomonas maltophilia. Primer pairs were designed using PrimerPremier 5 software and synthesized by General Biotech Co., Ltd. (China). Primer design principles were as follows: primer length 30-35 bp; GC content 30%-70%; amplicon length 100-500 bp; and maximum single nucleotide repeat length 5. The optimal primer pair was selected using a basic RPA kit.

[0035] RPA reaction:

[0036] To prepare a 50 μL RPA reaction system, add 29.4 μL of reaction buffer, 2.4 μL of a 10 μM upstream primer, 2.4 μL of a 10 μM downstream primer, 13.2 μL of genomic template, and 2.5 μL of 280 nM magnesium acetate solution to the reaction tube containing the enzyme components. Mix the contents of the reaction tube thoroughly by inverting and centrifuging briefly. Incubate the reaction tube in a 37°C water bath for 30 minutes. After the RPA reaction is complete, extract the RPA amplified product with an equal volume of a phenol-chloroform-isoamyl alcohol (25:24:1) mixture. Centrifuge at 12,000 rpm for 5 minutes, remove the supernatant, add an appropriate amount of DNA loading buffer, and separate the supernatant by electrophoresis on a 2% agarose gel (90 V for 30 minutes). Observe the RPA reaction products under UV light.

[0037] Design of probes for RPA-LFS reaction:

[0038] After selecting the optimal primer pair based on the RPA reaction, the upstream primer is extended 16 bp toward the 3' end to create the probe sequence. The 5' end of the probe is labeled with FITC, the 3' end is modified with a C3-spacer group (3'-Block), and one base in the middle of the probe is substituted with tetrahydrofuran (THF), with at least 30 bp located 5' of the THF site and at least 15 bp located 3'. The 5' end of the downstream primer is labeled with biotin.

[0039] RPA-LFS Program:

[0040] RPA-LFS reactions were performed using the nfo RPA kit (Anpu Future, China). To a 50 μL RPA-LFS reaction tube containing the enzyme components, 29.4 μL of reaction solution, 2.1 μL of a 10 μM upstream primer, 2.1 μL of a 10 μM downstream primer, 0.6 μL of a 10 μM probe, 13.2 μL of genomic template solution, and 2.5 μL of a 280 nM magnesium acetate solution were added. The tube was thoroughly mixed by inverting and centrifuging. The tube was incubated in a 37°C water bath for 12 minutes. The reaction product was diluted 20-fold with double-distilled water, and 50 μL of the dilution was added dropwise to the sample well of the test strip and allowed to develop color. A positive reaction resulted in two red lines, including the control line and the test line, while a negative reaction and the blank control reaction resulted in only the control line.

[0041] Optimization of RPA-LFS reaction conditions:

[0042] To optimize the RPA reaction conditions, the reaction time and temperature were modified. The reaction temperature was maintained at 37°C, and the reaction times were set to 0, 2, 4, 6, 8, 10, and 12 minutes, respectively. The optimal reaction time was screened based on LFS color development. RPA amplification was performed at 22, 27, 32, 37, 42, 47, and 52°C, and the optimal reaction temperature was screened based on LFS color development.

[0043] Limit of Detection (LOD) analysis:

[0044] The genomic DNA of Stenotrophomonas maltophilia was diluted with double distilled water (10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 CFU / mL) was used to test the sensitivity of the RPA-LFS system. 1 μL of genomic DNA dilution was added to the RPA-LFS reaction tube and filled with double distilled water to 13.2 μL, so that each reaction contained 10 4 , 10 3 , 10 2 , 10 1 , 10 0 , 10 -1 , 10 -2 The genome of CFU of Stenotrophomonas maltophilia was analyzed, and the remaining steps were as described above. Ten independent experiments were performed for each concentration group, and the limit of detection (LOD) of the method was determined by probabilistic regression analysis of the 10 independent experiments, that is, the lowest concentration with a 95% probability of detecting a positive product.

[0045] Testing clinical specimens:

[0046] The practical application value of RPA-LFS in clinical specimen testing was evaluated by comparison with microbial culture and qPCR. Clinical samples were cultured on Columbia blood agar plates and incubated in a 35°C microbiological incubator for 18-48 hours. Bacterial species were identified using the VITEK 2 fully automated microbiological analysis system. qPCR primers were designed based on the gene sequence NC_010943.1, and clinical samples were tested using qPCR. The agreement between the RPA-LFS method and the other two methods was calculated using the formula: (number of common positive samples + number of common negative samples) ÷ total number of samples × 100%. The Kappa index was used to evaluate the consistency of this method with the other methods.

[0047] Here are the results:

[0048] Design and screening of RPA primers:

[0049] Four sets of primer pairs were designed based on the specific gene sequence NC_010943.1 of Stenotrophomonas maltophilia (Table 2). Using the genome of Stenotrophomonas maltophilia as a template, the four candidate primer pairs were subjected to basic RPA reaction, and the target products were detected by 2% agarose gel electrophoresis ( Figure 2 A). All four primer pairs produced target bands consistent with the expected sizes: 470 bp, 163 bp, 369 bp, and 189 bp, respectively. However, a small amount of primer-dimer bands smaller than 100 bp appeared in the no-template control (NTC). In contrast, primer pair 1 produced a brighter target band with no visible primer-dimers. Therefore, primer pair 1 was selected for probe design.

[0050] Table 2: RPA primer pair sequences

[0051]

[0052] Note: F, upstream primer; R, downstream primer.

[0053] Improvement and determination of the optimal primer-probe combination in the RPA-LFS system;

[0054] The probe was designed based on the upstream primer of primer pair 1. The modified probe and primer are shown in Table 3. The amplification performance of the primer-probe combination F1 / R1 / P1 and whether there is a false positive were detected by RPA-LFS. Figure 2 As shown in B, the F1 / R1 / P1 primer-probe combination provides a correct positive signal (there are visible red bands on both the test line and the quality control line), which indicates that the F1 / R1 / P1 primer-probe combination has good amplification performance. However, in the no-template control group, a visible weakened red band is also shown on the test line, indicating that the F1 / R1 / P1 primer-probe combination has false-positive amplification. Taking into account the possibility of adverse primer interactions in the RPA reaction environment, resulting in the production of lower molecular weight DNA byproducts (<100bp), namely "primer noise". In order to reduce the generation of "primer noise", we appropriately introduced base mismatches in the primers. The mismatch principles are as follows: base mismatches are performed on regions with more than four consecutive paired bases; the three bases near the 3' end cannot be replaced; no more than five bases are replaced on each primer; there cannot be two consecutive base replacements; AG exchange and TC exchange are preferred. The primer dimers and base mismatches that can be produced by the F1 / R1 / P1 primer-probe combination are as follows: Figure 2 C. When appropriate base mismatches are introduced, the false positive signal of the no-template control group disappears ( Figure 2B), the modified primer-probe combination was named F / R / P. Overall, the optimal primer-probe combination was obtained as F / R / P, which can be used for RPA-LFS detection of Stenotrophomonas maltophilia.

[0055] Table 3: RPA-LFS probe sequences

[0056]

[0057] Note: F, upstream primer; R, downstream primer; P, probe; underline represents the base mutation site.

[0058] Optimization of RPA-LFS reaction conditions:

[0059] In order to optimize the RPA reaction conditions, the reaction time and temperature were improved. The reaction temperature was controlled at 37°C, and the reaction time was set to 0, 2, 4, 6, 8, 10, and 12 minutes ( Figure 3 A). The results showed that a weaker color band appeared on the detection line at 4 minutes of reaction, and a clear and bright band appeared on the detection line at 8 minutes. After 8 minutes, there was no significant change in the detection line as the reaction time increased. The reaction time was controlled and RPA amplification was performed at 22, 27, 32, 37, 42, 47, and 52°C ( Figure 3 B) At a reaction temperature of 22°C, the test line showed no bands, while at 27°C, a fainter band appeared. Within the reaction temperature range of 37-42°C, a clearer positive band was observed. At 52°C, the test line showed no bands. Considering both time and cost, the optimal reaction conditions for RPA-LFS are 37°C and 8 minutes.

[0060] Specificity analysis of RPA-LFS detection:

[0061] To evaluate whether the RPA-LFS assay can specifically detect Stenotrophomonas maltophilia, 12 common clinical pathogens and 12 clinical isolates of Stenotrophomonas maltophilia were used for RPA-LFS assay. Figure 4 As shown, when other pathogenic bacterial genomes were used as RPA-LFS reaction templates, no positive signal appeared on the test line. However, when clinically isolated Stenotrophomonas maltophilia genomic DNA was used as a template, a clear positive signal appeared on the test line. The RPA-LFS detection system established in the present invention has good specificity for Stenotrophomonas maltophilia and has no cross-reaction with other pathogens.

[0062] Detection limit of RPA-LFD method for Stenotrophomonas maltophilia:

[0063] To evaluate the minimum detection limit of the RPA-LFS method, a series of dilutions of Stenotrophomonas maltophilia genomic DNA (107 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 CFU / mL) is the reaction template. When the reaction system contains 104 CFU genome, a strong positive signal appears on the detection line. As the template concentration decreases, the color of the positive band weakens. When the concentration is as low as 10-1 CFU, the positive signal disappears completely ( Figure 5 A). In addition, to further determine the accurate LOD of RPA-LFS detection, 10 independent tests were performed for all concentrations. The results showed that when the genome content in the reaction system was 10 0 There were 9 positive results when the CFU was detected, and the genome content was 10 -1 When CFU was detected, one result was positive. The results of 10 tests were analyzed by probit regression analysis using SPSS software ( Figure 5 B). At a 95% probability of positive detection, the minimum detection limit of the RPA-LFS reaction was 1.107 CFU. To test whether the system could resist interference from the genomes of other species, in addition to the genome of Stenotrophomonas maltophilia, 10 ng of human genomic DNA was added to the reaction system. The results showed that the detection sensitivity of the method was not affected by human DNA ( Figure 5 C).

[0064] Application of RPA-LFS in clinical specimen testing:

[0065] The practical application value of the RPA-LFS method in clinical practice was evaluated by comparison with qPCR and traditional microbial culture methods (Table 4). Testing of 108 collected clinical specimens revealed that 23 of the 108 specimens tested positive for Stenotrophomonas maltophilia using both RPA-LFS and qPCR, while only 22 samples tested positive using microbial culture. The RPA-LFS method established in this invention had a 100% concordance rate with the qPCR method and a 99.07% concordance rate with the traditional culture-biochemical method, with a Kappa index value of 0.9718.

[0066] Table 4: Comparison of RPA-LFS, qPCR, and traditional microbial culture methods

[0067]

[0068] The instant and accurate diagnosis of pathogenic microorganisms is one of the difficulties that cannot be ignored in clinical testing. The present invention discloses an improved RPA-LFS method for detecting Stenotrophomonas maltophilia.

[0069] According to statistics, Stenotrophomonas maltophilia was one of the six most common pathogens isolated from clinical samples of pneumonia patients in intensive care units in the United States between 2015 and 2017. It often grows mixed with Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, and other bacteria. Traditional microbial isolation and culture techniques are challenging for identifying Stenotrophomonas maltophilia. PCR technology is rapid, accurate, and highly sensitive, but it requires complex reaction equipment and is time-consuming, making it unsuitable for on-site detection of pathogenic microorganisms. RPA amplification technology is a molecular amplification method based on recombinant polymerase. Compared to other molecular amplification technologies, RPA can be performed at lower temperatures and does not rely on precise temperature control of the instrument, which is conducive to the development of point-of-care testing (POCT). Combining RPA technology with the LFS detection method can achieve rapid visual detection of target genes in a short period of time.

[0070] The present invention designs primers and probes based on the Stenotrophomonas maltophilia-specific sequence NC_010943.1. This gene sequence was first identified by Fraser and other researchers in 2019 as a conserved sequence of Stenotrophomonas maltophilia and can be used to identify Stenotrophomonas maltophilia. In the process of designing the probe, it was found that primer dimers produced by downstream primers and probes would lead to the occurrence of false positive signals, so the present invention introduced base mismatches to avoid false positive signals. According to literature reports, the RPA reaction can allow the introduction of a small number of mismatched bases, but it is necessary to avoid introducing mismatches at the 3' end. After introducing mismatched bases, the present invention established a primer-probe sequence F / R / P suitable for specific detection of Stenotrophomonas maltophilia. By optimizing the reaction time and temperature, the optimal reaction conditions of the RPA-LFS system were determined to be 37°C and the amplification time was 8 minutes. According to probit regression analysis, using the gradient-dilution genome of Stenotrophomonas maltophilia as a template, it was determined that the minimum detection limit of this system for detecting Stenotrophomonas maltophilia was 1.107 CFU, and the sensitivity was not affected by the genomes of other species. By testing 108 clinically derived microbial samples to verify the clinical applicability, the RPA-LFS method established in the present invention was consistent with the qPCR detection results and was consistent. However, due to the shortened reaction time, the simplicity of the detection equipment, and the introduction of base mismatch sites, the sensitivity of the RPA-LFS system was slightly lower than that of the qPCR detection method. Compared with the traditional "gold standard" biochemical culture method, RPA-LFS is more sensitive, with a positive coincidence rate of 99.07%. The Kappa index value of the two detection methods was 0.9718, which has good consistency.

[0071] The above embodiments merely illustrate several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.

Claims

1. Use of a primer-probe combination in the preparation of an RPA-LFS detection kit for Stenotrophomonas maltophilia, characterized in that: Includes F / R / P primer probe combination; In the F / R / P primer probe combination; The sequence of F is: TGAGCGGAGGCAGGATCCACGGCTACATCTG; The sequence of R is: Biotin-CTGGCCATTCTATTCCATCGCCAGTTCTTC; The sequence of P is: FITC-TGAGCGGAGGCAGGATCCACGGCTACATCTG[THF]CAGGGCTTCAATCCGC- / C3-spacer / .

Images