Nucleic acid products, kits and uses for detecting esophageal cancer or precancerous lesions
By detecting the methylation level in esophageal cancer or precancerous lesions, and using nucleic acid combinations and kits, the limitations of sensitivity and specificity in existing detection methods have been addressed, enabling efficient early diagnosis.
Patent Information
- Application Number
- CN202211702205.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-29
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2042-12-29
AI Technical Summary
Existing methods for detecting esophageal cancer and precancerous lesions lack highly sensitive and specific detection techniques, leading to missed diagnoses and overdiagnoses, making it difficult to achieve early and accurate diagnosis.
Nucleic acid synthesis detection of esophageal cancer or precancerous lesions was performed by detecting the methylation levels of the Chr18:3012367-3012756bp and Chr7:155459949-155460426bp regions using nucleic acid synthesis kits, including specific primers and probes.
It has improved the detection rate of esophageal squamous cell carcinoma and precancerous lesions, and achieved rapid, simple, stable, highly sensitive and specific detection, supporting early diagnosis.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This application relates to the field of molecular biology, and in particular to nucleic acid products, kits, and applications for the detection of esophageal cancer or precancerous lesions. Background Technology
[0002] Esophageal cancer is the eighth most common cancer worldwide, ranking sixth in mortality among all cancer types, with a 5-year survival rate of <20%. Esophageal adenocarcinoma (EAC) and esophageal squamous cell carcinoma (ESCC) are two major subtypes of esophageal malignancies, each with distinct epidemiological and pathophysiological characteristics. ESCC arises from the malignant transformation of esophageal epithelial cells, and geographical location is a significant factor influencing its incidence. Globally, the incidence of ESCC varies by as much as 16 times, making early diagnosis and treatment of esophageal squamous cell carcinoma crucial.
[0003] Patients with ESCC typically present with dysphagia and weight loss, usually at an advanced stage of the disease. While some abnormalities in routine examinations may suggest the presence of ESCC, the gold standard for diagnosis remains endoscopy and biopsy. However, endoscopy is invasive, leading to low patient compliance. Although in some clinical cases, direct endoscopic visualization of a mass almost definitively establishes the possibility of a tumor, a biopsy of the lesion is essential to confirm the diagnosis through histological examination of intraepithelial neoplasia (indeterminate, low-grade, or high-grade; the latter two are considered precancerous precursors to ESCC) or ESCC, as well as the tumor differentiation status. Besides traditional endoscopy, various techniques have been developed to enhance the detection of esophageal cancer, such as tumor marker (squamous cell carcinoma antigen) testing and barium swallow X-ray examination. However, while SCC antigen testing can detect various squamous cell carcinomas, such as lung cancer, head and neck squamous cell carcinoma, and cervical epithelial carcinoma, it lacks the specificity to detect esophageal squamous cell carcinoma. Furthermore, preoperative anesthesia can increase SCC test values, leading to insufficient accuracy. Barium swallow X-ray examination, besides involving some radioactivity, can only serve as a diagnostic reference and cannot directly determine whether cancer is present. These shortcomings in testing methods have resulted in missed and overdiagnosed cases, which have long plagued clinical practice. There is an urgent need for new, stable, sensitive, and specific testing methods to accurately identify high-grade lesions for the early diagnosis or auxiliary diagnosis of esophageal cancer and precancerous lesions. Summary of the Invention
[0004] Therefore, it is necessary to provide a nucleic acid combination and kit for detecting esophageal cancer or precancerous lesions, which can effectively distinguish healthy people from patients with esophageal cancer and esophageal intraepithelial neoplasia.
[0005] The specific technical solution is as follows:
[0006] A nucleic acid combination for detecting esophageal cancer or precancerous lesions, the nucleic acid combination comprising a nucleic acid combination for detecting the methylation level of a target sequence, the target sequence comprising a first target sequence and / or a second target sequence, wherein, with reference to GRCh38.p14, the first target sequence comprises the full length or a portion thereof of the Chr18:3012367-3012756 region; the second target sequence comprises the full length or a portion thereof of the Chr7:155459949-155460426 region.
[0007] In one embodiment, a portion of the Chr18:3012367-3012756 region includes one or more of region 1, region 2, region 3, and region 4; and / or, a portion of the Chr7:155459949-155460426 region includes one or more of region 5, region 6, region 7, and region 8.
[0008] Specifically, region 1 is a positive chain of Chr18:3012374-3012558; region 2 is a positive chain of Chr18:3012539-3012718; region 3 is a negative chain of Chr18:3012566-3012756; region 4 is a negative chain of Chr18:3012367-3012565bp; region 5 is a positive chain of Chr7:155459949-155460122; region 6 is a positive chain of Chr7:155460212-155460376; region 7 is a negative chain of Chr7:155460291-155460426; and region 8 is a negative chain of Chr7:155459956-155460122.
[0009] In one embodiment, the nucleic acid combination for detecting the methylation level of the first target sequence includes at least one of a first nucleic acid combination, a second nucleic acid combination, a third nucleic acid combination, and a fourth nucleic acid combination.
[0010] In one embodiment, the nucleic acid combination for detecting the methylation level of the second target sequence includes at least one of a fifth nucleic acid combination, a sixth nucleic acid combination, a seventh nucleic acid combination, and an eighth nucleic acid combination.
[0011] In one embodiment, the first nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 1-2; the second nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 4-5; the third nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 7-8; the fourth nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 10-11; the fifth nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 13-14; the sixth nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 16-17; the seventh nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 19-20; and the eighth nucleic acid combination comprises primer pairs with nucleotide sequences as shown in SEQ ID NO. 22-23.
[0012] In one embodiment, the first nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.3; the second nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.6; the third nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.9; the fourth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.12; the fifth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.15; the sixth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.18; the seventh nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.21; and the eighth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.24.
[0013] A kit for detecting esophageal cancer or precancerous lesions, comprising the nucleic acid combination for detecting esophageal cancer or precancerous lesions as described in any of the above claims.
[0014] In one embodiment, the kit further includes at least one of a sample sampling device, a nucleic acid extraction reagent, and a nucleic acid purification reagent.
[0015] The nucleic acid combination is used in the preparation of any of the following products: (a) diagnosing esophageal cancer or precancerous lesions; (b) differentiating esophageal cancer samples from esophagitis samples; (c) differentiating esophageal precancerous lesion samples from esophagitis samples, wherein the nucleic acid combination comprises a nucleic acid combination for detecting the methylation level of a target sequence, the target sequence comprising a first target sequence and / or a second target sequence, wherein the first target sequence comprises the full length or a portion thereof of the Chr18:3012367-3012756 region; and the second target sequence comprises the full length or a portion thereof of the Chr7:155459949-155460426 region.
[0016] In one embodiment, a portion of the Chr18:3012367-3012756 region includes one or more of region 1, region 2, region 3, and region 4.
[0017] In one embodiment, a portion of the Chr7:155459949-155460426 region includes one or more of region 5, region 6, region 7, and region 8.
[0018] In one embodiment, region 1 is a positive chain of Chr18:3012374-3012558; region 2 is a positive chain of Chr18:3012539-3012718; region 3 is a negative chain of Chr18:3012566-3012756; region 4 is a negative chain of Chr18:3012367-3012565bp; region 5 is a positive chain of Chr7:155459949-155460122; region 6 is a positive chain of Chr7:155460212-155460376; region 7 is a negative chain of Chr7:155460291-155460426; and region 8 is a negative chain of Chr7:155459956-155460122.
[0019] In one embodiment, the target sequence includes at least one of regions 1 to 8.
[0020] Optionally, the target sequence includes at least one of regions 1 to 4, and includes at least one of regions 5 to 8.
[0021] In one embodiment, the nucleic acid combination includes at least one of a first nucleic acid combination, a second nucleic acid combination, a third nucleic acid combination, a fourth nucleic acid combination, a fifth nucleic acid combination, a sixth nucleic acid combination, a seventh nucleic acid combination, and an eighth nucleic acid combination.
[0022] The first nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 1-2; the second nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 4-5; the third nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 7-8; the fourth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 10-11; the fifth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 13-14; the sixth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 16-17; the seventh nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 19-20; and the eighth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 22-23.
[0023] Optionally, the first nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.3; the second nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.6; the third nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.9; the fourth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.12; the fifth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.15; the sixth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.18; the seventh nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.21; and the eighth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.24.
[0024] In one embodiment, the esophageal cancer includes esophageal squamous cell carcinoma, and the precancerous lesion includes esophageal intraepithelial neoplasia.
[0025] Compared with the prior art, this application has the following beneficial effects:
[0026] This application can diagnose or assist in the diagnosis of esophageal squamous cell carcinoma and precancerous lesions by detecting changes in the methylation level of the Chr18:3012367-3012756bp and / or Chr7:155459949-155460426bp regions. It has high sensitivity and specificity and can effectively improve the detection rate of esophageal squamous cell carcinoma and precancerous lesions.
[0027] The reagents or kits provided in this application can be used for rapid and simple testing, with stable detection, high sensitivity, and high specificity, which can help in the early diagnosis of esophageal squamous cell carcinoma and precancerous lesions. Detailed Implementation
[0028] To facilitate understanding of this application, a more complete description will be provided below. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of this application will be more thorough and complete.
[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.
[0030] Terminology Explanation
[0031] The term "and / or" refers to any and all combinations of one or more of the related listed items.
[0032] The term "diagnosis" includes aspects such as auxiliary diagnosis, recurrence risk assessment, assessment of cancer risk and degree, and prognosis.
[0033] The term "gene" refers to a segment of DNA that encodes a polypeptide chain that produces amino acids. It includes sequences located in coding and non-coding regions that are involved in gene transcription / translation and transcription / translation regulation, as well as exon and intron sequences.
[0034] The terms "oligonucleotide," "polynucleotide," "nucleotide," or "nucleic acid" refer to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the final function or use of the oligonucleotide. Oligonucleotides can be produced in any way, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine, and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine, and guanine.
[0035] The term "methylation" is a form of DNA chemical modification that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in a CpG dinucleotide of the genome, under the action of DNA methyltransferases. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.
[0036] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides within a DNA sequence is methylated, or the frequency / proportion / percentage of methylation. It represents both a qualitative and quantitative concept. In practical applications, different detection indicators can be used to compare DNA methylation levels depending on the specific circumstances. For example, in some cases, comparisons can be made based on the Ct values of the samples; in others, the proportion of gene methylation in the sample can be calculated as (number of methylated molecules / (number of methylated molecules + number of unmethylated molecules)) × 100%, and then compared; in still others, statistical analysis and integration of various indicators are necessary to arrive at a final judgment criterion.
[0037] The term "primer" refers to an oligonucleotide that can be used in amplification methods (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a region thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific to that polynucleotide sequence. The exact length of a primer depends on many factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least 10, 15, 20, 25, or more nucleotides, depending on the complexity of the target sequence, but may also contain fewer nucleotides. In this disclosure, the term "primer" refers to a pair of primers capable of hybridizing to the double strand of a target DNA molecule or to regions of the target DNA molecule located on either side of the nucleotide sequence to be amplified.
[0038] The term "TaqMan probe" refers to an oligonucleotide sequence containing a 5' fluorescent group and a 3' quencher group. When the probe binds to the corresponding site on DNA, it does not fluoresce because of the presence of the quencher group near the fluorescent group. During amplification, if the probe binds to the strand being amplified, the 5'-3' exonuclease activity of a DNA polymerase (such as Taq polymerase) digests the probe. Since the fluorescent group is far from the quencher group, its energy is not absorbed, thus producing a fluorescent signal. With each PCR cycle, the fluorescence signal, like the target fragment, undergoes a synchronous exponential growth process.
[0039] One embodiment of this application provides a nucleic acid combination for detecting esophageal cancer or precancerous lesions. The nucleic acid combination includes a combination for detecting the methylation level of target sequences. The target sequences include a first target sequence and / or a second target sequence. The first target sequence includes the full length or a portion of the Chr18:3012367-3012756 region on the LPIN2 gene, and the second target sequence includes the full length or a portion of the Chr7:155459949-155460426 region on the EN2 gene. The positions of the sites or regions mentioned in this application are all referenced to GRCh38.p14.
[0040] The LPIN2 gene is located on human chromosome 18, specifically at 2916994-3013144 bp. Mouse studies have shown that this gene plays a role in the development of normal adipose tissue and may also play a role in human triglyceride metabolism. This gene may be associated with human lipodystrophy.
[0041] The EN2 gene is located on human chromosome 7, specifically at 155458129-155464831 bp. This gene is involved in the control of pattern formation during the development of the human central nervous system.
[0042] In a specific example, a portion of the region Chr18:3012367-3012756 includes one or more of regions 1, 2, 3, and 4; and / or, a portion of the region Chr7:155459949-155460426 includes one or more of regions 5, 6, 7, and 8.
[0043] Specifically, region 1 is a positive chain of Chr18:3012374-3012558; region 2 is a positive chain of Chr18:3012539-3012718; region 3 is a negative chain of Chr18:3012566-3012756; region 4 is a negative chain of Chr18:3012367-3012565bp; region 5 is a positive chain of Chr7:155459949-155460122; region 6 is a positive chain of Chr7:155460212-155460376; region 7 is a negative chain of Chr7:155460291-155460426; and region 8 is a negative chain of Chr7:155459956-155460122.
[0044] In a specific example, the nucleic acid combination for detecting the methylation level of the first target sequence includes at least one of a first nucleic acid combination, a second nucleic acid combination, a third nucleic acid combination, and a fourth nucleic acid combination.
[0045] In a specific example, the nucleic acid combination for detecting the methylation level of the second target sequence includes at least one of the fifth, sixth, seventh, and eighth nucleic acid combinations.
[0046] In one specific example, the first nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 1–2; the second nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 4–5; the third nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 7–8; the fourth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 10–11; the fifth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 13–14; the sixth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 16–17; the seventh nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 19–20; and the eighth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 22–23.
[0047] In one specific example, the first nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.3; the second nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.6; the third nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.9; the fourth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.12; the fifth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.15; the sixth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.18; the seventh nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.21; and the eighth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.24.
[0048] In a specific example, the probe of this application can be a TaqMan probe, with a fluorescent group attached to its 5' end and a fluorescence quenching group attached to its 3' end.
[0049] One embodiment of this application provides a kit for detecting esophageal cancer or precancerous lesions, comprising the nucleic acid combination for detecting esophageal cancer or precancerous lesions as described in any of the above claims.
[0050] In one specific example, the kit also includes at least one of a sample collection device, a nucleic acid extraction reagent, and a nucleic acid purification reagent. Optionally, the kit also includes a reagent for converting unmethylated cytosine bases of a gene into uracil, for example, the reagent may be a bisulfite.
[0051] In one specific example, the kit detects methylation of the target sequence through one or more of the following methods:
[0052] Methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-sensitive restriction endonuclease method, and quantitative fluorescence method.
[0053] This application also provides the use of nucleic acid combinations in the preparation of any one of the following products (a) to (c):
[0054] (a) Use in the preparation of products for diagnosing esophageal cancer or precancerous lesions;
[0055] (b) Application in the preparation of products that distinguish between esophageal cancer samples and esophagitis samples;
[0056] (c) Application in the preparation of products that distinguish between samples of precancerous esophageal lesions and samples of esophagitis.
[0057] The nucleic acid combination includes a combination of nucleic acids for detecting the methylation level of target sequences. The target sequences include a first target sequence and / or a second target sequence, wherein the first target sequence includes the full length or a portion of the Chr18:3012367-3012756 region, and the second target sequence includes the full length or a portion of the Chr7:155459949-155460426 region.
[0058] In a specific example, a portion of the Chr18:3012367-3012756 region includes one or more of region 1, region 2, region 3, and region 4. A portion of the Chr7:155459949-155460426 region includes one or more of region 5, region 6, region 7, and region 8.
[0059] Specifically, region 1 is the positive chain of Chr18:3012374-3012558; region 2 is the positive chain of Chr18:3012539-3012718; region 3 is the negative chain of Chr18:3012566-3012756; region 4 is the negative chain of Chr18:3012367-3012565bp; region 5 is the positive chain of Chr7:155459949-155460122; region 6 is the positive chain of Chr7:155460212-155460376; region 7 is the negative chain of Chr7:155460291-155460426; and region 8 is the negative chain of Chr7:155459956-155460122.
[0060] In one specific example, the target sequence includes at least one of regions 1 through 8. Optionally, the target sequence includes at least one of regions 1 through 4, and contains at least one of regions 5 through 8. When the target sequence is a combination of two or more regions, the diagnostic effect on esophageal cancer or precancerous lesions is better.
[0061] For tissue samples, the sensitivity of this regional combination for diagnosing esophageal cancer and esophageal intraepithelial neoplasia is significantly improved, reaching up to 96.77% and 86.54%, respectively. In addition, the specificity of the regional combination for detecting adjacent normal tissue can reach up to 85%.
[0062] For exfoliated cell samples, this combination of regions achieved a sensitivity of 94.29% for esophageal squamous cell carcinoma and 82.14% for intraepithelial neoplasia. In non-cancer patient samples, the combination of regions demonstrated good specificity, reaching as high as 96.15%.
[0063] For plasma samples, this combined regional assay achieves a sensitivity of up to 90% for esophageal squamous cell carcinoma and a maximum sensitivity of 84.31% for intraepithelial neoplasia. Furthermore, the specificity in healthy individuals can reach as high as 99.09%.
[0064] An embodiment of this application also provides a method for diagnosing esophageal cancer or precancerous lesions using the methylation level of the above-mentioned target sequence, comprising the following steps:
[0065] Detecting the methylation level of the above target sequences; and
[0066] The methylation level of the target sequence determines whether the sample is positive.
[0067] Optionally, when the target sequence consists of a combination of multiple regions, the determination method is that if the Ct value of at least one region is less than or equal to a threshold, the sample is considered a positive sample, i.e., positive for esophageal cancer or precancerous lesions. The threshold is selected by those skilled in the art through ROC curve analysis of sample sets of patients with esophageal cancer or precancerous lesions and healthy individuals, choosing the cutoff value at which the Youden index is maximized as the threshold. The threshold selected may differ for different types of samples. Specific Implementation
[0069] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.
[0070] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.
[0071] Example 1
[0072] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 1, which includes the nucleotides shown in SEQ ID NO. 1-3, the specific sequences of which are shown in Table 1. This nucleotide combination 1 can detect methylation of the positive strand (region 1) of the Chr18:3012374-3012558bp region on the LPIN2 gene.
[0073] The positive-strand base sequence of region 1 is shown in SEQ ID NO.28 (5'-3'):
[0074] TTAAAATGTTCAGGCGAGTGGAGAAAATGGTGATCCGCTGGCGTTAGAAGTGGACAGAGAGGCT CTCAGTACAAACTGTATCTGAACGTGTTCCTCACAAATTAAGATCTGCACCGGGGGCTGGGGGGCTTT GAGAAAACTAACCACATTTGAATCCGGTCCACACAGCTTGAAGGCGGAGGTAC.
[0075] The sequence of the fully methylated region 1 after bisulfite conversion is shown in SEQ ID NO.36 (5'-3'):
[0076] TTAAAATGTTTAGGCGAGTGGAGAAAATGGTGATTCGTTGGCGTTAGAAGTGGATAGAGAGGTTT TTAGTATAAATTGTATTTGAACGTGTTTTTTATAAATTAAGATTTGTATCGGGGGTTGGGGGGTTTTGAG AAAATTAATTATATTTGAATTCGGTTTATATAGTTTGAAGGCGGAGGTAC.
[0077] The nucleotides shown in SEQ ID NO.1-3 can detect methylation of cytosine at positions Chr18:3012388, Chr18:3012409, Chr18:3012415, Chr18:3012550, and Chr18:3012558 on the positive strand of this region.
[0078] Example 2
[0079] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 2, which includes the nucleotides shown in SEQ ID NO. 4-6, the specific sequences of which are shown in Table 1. This nucleotide combination 2 can detect methylation of the positive strand (region 2) of the Chr18:3012539-3012718bp region on the LPIN2 gene.
[0080] The positive-chain base sequence of region 2 is shown in SEQ ID NO.29 (5'-3'):
[0081] CAGCTTGAAGGCCGGAGGTACGGGGCAAAGCGCGGCGGGGAAGAAACACCAGCAACTCGGCGG CCCCCGCCTCGCCGCAGATCACGTGCCCGGCGCCCCCTCCCGCAGGGCCGGGGGCGGGATGGAGAC GCGGCCTCCCGCGCGCCTTCCGCACTCCCCTCCGCGCCCCAAACCCAGGGGT.
[0082] The sequence of the fully methylated region 2 after bisulfite conversion is shown in SEQ ID NO.37 (5'-3'):
[0083] TAGTTTTGAAGGCGGAGGTACGGGGTAAAGCGCGGCGGGGAAGAAATATTAGTAATTCGGCGGTT TTCGTTTCGTCGTAGATTACGTGTTCGGCGTTTTTTCGTAGGGTCGGGGGCGGGATGGAGACGCGG TTTTTCGCGCGTTTTTCGTATTTTTTTTCGCGTTTTAAATTTAGGGGT.
[0084] The nucleotides shown in SEQ ID NO.4-6 can detect methylation of cytosine at the positions Chr18:3012550, Chr18:3012558, Chr18:3012595, Chr18:3012598, Chr18:3012605, Chr18:3012610, Chr18:3012613, Chr18:3012699, and Chr18:3012701 on the positive strand of this region.
[0085] Example 3
[0086] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 3, which includes the nucleotides shown in SEQ ID NO. 7-9, the specific sequences of which are shown in Table 1. This nucleotide combination 3 can detect methylation of the negative strand (region 3) of the Chr18:3012566-3012756bp region on the LPIN2 gene.
[0087] The negative chain base sequence in region 3 is shown in SEQ ID NO.30 (5'-3'):
[0088] CGCCGCCGCCCTGGGGATGGTTACCCGAGACCACCCCTACCCCTGGGTTTGGGGCGCGGAGGGG AGTGCGGAAGGCGCGGGAGGCCGCGTCTCCATCCCGCCCCCGGCCCTGCGGGAGGGGGCGCCGG GCACGTGATCTGCGGCGAGGCGGGGGCCGCCGAGTTGCTGGTTTTCTCCCCGCCGCGCT.
[0089] The sequence of the fully methylated region 3 after bisulfite conversion is shown in SEQ ID NO.38 (5'-3'):
[0090] CGTCGTCGTTTTGGGGATGGTTATTCGAGATTATTTTTATTTTTGGGTTTGGGGCCGGAGGGGAG TGCGGAAGGCGCGCGGGAGGTCGCGTTTTTATTTCGTTTTCGGTTTTGCGGGAGGGGGCGTCGGGTA CGTGATTTGCGGCGAGGCGGGGGTCGTCGAGTTGTTGGTGTTTTTTTTTCGTCGCGTT.
[0091] The nucleotides shown in GSEQ ID NO.7-9 can detect methylation of cytosine at the positions Chr18:3012569, Chr18:3012571, Chr18:3012574, Chr18:3012642, Chr18:3012650, Chr18:3012656, Chr18:3012753, and Chr18:3012756 on the negative strand of this region.
[0092] Example 4
[0093] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 4, which includes the nucleotides shown in SEQ ID NO. 10-12, the specific sequences of which are shown in Table 1. This nucleotide combination 4 can detect methylation of the negative strand (region 4) of the Chr18:3012367-3012565bp region on the LPIN2 gene.
[0094] The negative chain base sequence in region 4 is shown in SEQ ID NO.31 (5'-3'):
[0095] TTGCCCCGTACCTCCGCCTTCAAGCTGTGTGGACCGGATTCAAATGTGGTTTAGTTTTCTCAAAGC CCCCCAGCCCCCGGTGCAGATCTTAATTTGTGAGGAACACGTTCAGATACAGTTTGTACTGAGAGCCT CTCTGTCCACTTCTAACGCCAGCGGATCACCATTTTCTCCACTCGCCTGAACATTTTAAGACTCTT.
[0096] The sequence of the fully methylated region 4 after bisulfite conversion is shown in SEQ ID NO.39 (5'-3'):
[0097] TTGTTTCGTATTTTCGTTTTTAAGTTGTGTGGATCGGATTTAAATGTGGTTAGTTTTTTTAAAGTTTTTTAGTTTTCGGTGTAGATTTTAATTTGTGAGGAATACGTTTAGATATAGTTTGTATTGAGAGTTTTTTTGT TTATTTTTAACGTTAGCGGATTATTTTTTTTATTCGTTTTGAATATTTTAAGATTTTT.
[0098] The nucleotides shown in SEQ ID NO.10-12 can detect methylation of cytosine at the positions Chr18:3012389, Chr18:3012410, Chr18:3012416, Chr18:3012551, and Chr18:3012559 on the negative strand of this region.
[0099] Example 5
[0100] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 5, which includes the nucleotides shown in SEQ ID NO. 13-15, the specific sequences of which are shown in Table 1. This nucleotide combination 5 can detect methylation of the positive strand (region 5) of the Chr7:155459949-155460122bp region on the EN2 gene.
[0101] The positive-chain base sequence of region 5 is shown in SEQ ID NO.32 (5'-3'):
[0102] TGCATTCCATGCGGGTCTGCGGCTGGGAACCGCCATTAGAAGTGGACTGTTTGACCCCGAGCTG GCAGCGGATCCCCGCTGCCCCCAAACCCTCAACTATTTTGCGGGGTCATTTGCCCAGATCACAGCAG GAGTGAGCCAACCCTTGGGCCGCCATCCCGCAGAACTATGCG.
[0103] The sequence of the fully methylated region 5 after bisulfite conversion is shown in SEQ ID NO.40 (5'-3'):
[0104] TGTATTTTATGCGGGTTTGCGGTTGGGAATCGTTATTAGAAGTGGATTGTTTGATTTCGAGTTGGTAGCGGATTTTCGTTGTTTTTAAATTTTTAATTATTTTGCGGGGGTTATTTGTTTAGATTATAGTAGGAGTGA GTTAATTTTTGGGTCGTTATTTCGTAGAATTATGCG.
[0105] The nucleotides shown in SEQ ID NO.13-15 can detect methylation of cytosine at the positions Chr7:155459960, Chr7:155459968, Chr7:155460006, Chr7:155460017, Chr7:155460025, Chr7:155460101, Chr7:155460109, and Chr7:155460121 on the negative strand of this region.
[0106] Example 6
[0107] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 6, which includes the nucleotides shown in SEQ ID NO. 16-18, the specific sequences of which are shown in Table 1. This nucleotide combination 6 can detect methylation of the positive strand (region 6) of the Chr7:155460212-155460376bp region on the EN2 gene.
[0108] The positive-chain base sequence of region 6 is shown in SEQ ID NO.33 (5'-3'):
[0109] ACATACAGGCTCACAATGCCGGGCGAGGAGACTCGGCCGGGCTTTGTGCGGCGGGAGTTCGC TGAGCCAGCCCCCAACGGCCCGGGAGCTGGGCAGCACCGCCCGGCCCGGCCTGGCCCGGCCCAGCT CAGCCCAGCCCAAGTCGCCTATCTTCATGGGCTTT.
[0110] The sequence of the fully methylated region 6 after bisulfite conversion is shown in SEQ ID NO.41 (5'-3'):
[0111] ATATATAGGTTTATAATGTCGGGCGAGGAGATTCGGTCGGGTTTTGTGCGGCGCGGGAGTTCGTTG AGTTAGTTTTTAACGGTTCGGGAGTTGGGTAGTATCGTTCGGTTCGGTTTGGTTCGGTTTAGTTTAGTTTAGTTTAAGTCGTTTATTTTTATGGGTTTT.
[0112] The nucleotides shown in SEQ ID NO.16-18 can detect methylation of cytosine at positions Chr7:155460231, Chr7:155460235, Chr7:155460313, Chr7:155460317, Chr7:155460322, Chr7:155460332, and Chr7:155460357 on the positive strand of this region.
[0113] Example 7
[0114] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 7, which includes the nucleotides shown in SEQ ID NO. 19-21, the specific sequences of which are shown in Table 1. This nucleotide combination 7 can detect methylation of the negative strand (region 7) of the Chr7:155460291-155460426bp region on the EN2 gene.
[0115] The negative chain base sequence in region 7 is shown in SEQ ID NO.34 (5'-3'):
[0116] CGGAGAAACCAAAGAACAGAAACATTATCTTGCAGGGATATTTTAAAGCCCATGAAGATAGGCG ACTTGGGCTGGGCTGAGCTGGGCCGGGCCAGGCCGGGCCGGGCGGTGCTGCCCAGCTCCCGGGCCG.
[0117] The sequence of the fully methylated region 7 after bisulfite conversion is shown in SEQ ID NO.42 (5'-3'):
[0118] CGGAGAAATTAAAGAATAGAAATATTATTTTGTAGGGATATTTTAAAGTTTATGAAGATAGGCGATTTGGGTTGGGTTGAGTTGGGTCGGGTTAGGTCGGGTCGGGCGGTGTTGTTTAGTTTTCGGGTCG.
[0119] The nucleotides shown in SEQ ID NO.19-21 can detect methylation of cytosine at positions Chr7:155460292, Chr7:155460297, Chr7:155460314, Chr7:155460318, Chr7:155460323, Chr7:155460333, and Chr7:155460420 on the negative strand of this region.
[0120] Example 8
[0121] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of esophageal squamous cell carcinoma and precancerous lesions, comprising nucleotide combination 8, which includes the nucleotides shown in SEQ ID NO. 22-24, the specific sequences of which are shown in Table 1. This nucleotide combination 8 can detect methylation of the negative strand (region 8) of the Chr7:155459956-155460122bp region on the EN2 gene.
[0122] The negative chain base sequence in region 8 is shown in SEQ ID NO.35 (5'-3'):
[0123] CGCATAGTTCTGCGGGATGGCGGCCCAAGGGTTGGCTCACTCCTGCTGTGATCTGGGCAAATGAC CCCCGCAAAATAGTTGAGGGTTTGGGGGCAGCGGGGATCCGCTGCCAGCTCGGGGTCAAACAGTCCA CTTCTAATGGCGGTTCCCAGCCGCAGACCCGCATG.
[0124] The sequence of the fully methylated region 8 after bisulfite conversion is shown in SEQ ID NO.43 (5'-3'):
[0125] CGTATAGTTTTGCGGGATGGCGGTTTAAGGGTTGGTTTATTTTTGTTGTGATTTGGGTAAATGATTTTCGTAAAATAGTTGAGGGTTTGGGGGTAGCGGGGATTCGTTGTTAGTTCGGGGTTAAATAGTTTATTTTTAATGGCGGTTTTTAGTCGTAGATTCGTATG.
[0126] The nucleotides shown in SEQ ID NO.22-24 can detect methylation of cytosine at the positions Chr7:155459961, Chr7:155459969, Chr7:155459980, Chr7:155460007, Chr7:155460018, Chr7:155460102, Chr7:155460110, and Chr7:155460122 on the negative strand of this region.
[0127] Table 1 Primer and probe sequences for each target gene region.
[0128]
[0129] Example 9
[0130] The performance of methylation-based quantitative PCR in diagnosing esophageal squamous cell carcinoma tissue samples in the target region was analyzed.
[0131] The inventors discovered that by detecting the methylation levels of one or more regions selected from Chr18:3012367-3012756bp and / or Chr7:155459949-155460426bp in tumor tissue samples from patients with esophageal squamous cell carcinoma, it is possible to effectively distinguish between esophageal squamous cell carcinoma samples and healthy tissue samples. The specific detection process is as follows.
[0132] 1. Collection of tissue samples
[0133] A total of 62 patients diagnosed with esophageal squamous cell carcinoma by pathological examination, along with 62 adjacent normal tissue samples and 52 samples of esophageal intraepithelial neoplasia tissue, were collected. All samples were formalin-soaked and paraffin-embedded. The collection process was approved by the ethics committee, all volunteers signed informed consent forms, and all samples were anonymized.
[0134] 2. Extraction of sample DNA
[0135] DNA was extracted from tissue samples using the QIAamp DNAFFPE Tissue Kit (Cat:56404), following the kit's instructions.
[0136] 3. Transformation and purification of sample DNA
[0137] The kits used for the transformation and purification of sample DNA were all nucleic acid purification reagents from Wuhan Aimeisen Life Science Technology Co., Ltd. (EHanxie Medical Device Registration No. 20200843). For specific steps, please refer to the kit instructions.
[0138] 4. Methylation-based quantitative PCR reaction
[0139] To ensure that the amplification efficiency of the real-time PCR reaction is between 95% and 105%, and that there is no non-specific amplification or primer dimer, multiple primer pairs for methylation real-time PCR reactions were designed using the bisulfite-converted Chr18:3012367-3012756bp and Chr7:155459949-155460426bp regions as templates. The primer pairs were then validated. The target fragment was amplified using the SYBR Green PCR system. Melting curve and standard curve analyses identified four primer pairs suitable for amplifying partial regions of Chr18 (3012367-3012756 bp) and four primer pairs suitable for amplifying partial regions of Chr7 (155459949-155460426 bp). A corresponding TaqMan detection probe was designed for each primer pair for use in the TaqMan PCR reaction system. The specific amplification reaction system was as follows: 5 μL of 5× Platinum II PCR buffer, 0.5 μL of 10 μM upstream primer for the target region, 0.5 μL of 10 μM downstream primer for the target region, 0.5 μL of 10 μM target region probe, 0.5 μL of 10 μM upstream primer for ACTB, 0.5 μL of 10 μM downstream primer for ACTB, 0.5 μL of 10 μM ACTB detection probe, and Platinum II Taq Hot-Start DNA Polymerase. 0.5 μL of 10 mM dNTPs, 1 μL of the sample DNA, and purified water were added to a final volume of 25 μL. The reaction conditions were: 98℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 5 min (fluorescence was collected during annealing and extension), for a total of 47 cycles; stored at 4℃. The sequences of each primer pair and probe, and their target regions, are shown in Table 1.
[0140] Negative and positive controls: When performing PCR testing on samples, negative and positive controls should also be tested simultaneously. The DNA template for the negative control tube is TE buffer. The DNA template for the positive control tube is prepared as follows: the sequence corresponding to the amplified region of the ACTB gene after complete bisulfite conversion is artificially synthesized and cloned into a vector to form an artificially synthesized plasmid; the target region is artificially synthesized and cloned into a vector to form an artificially synthesized plasmid. If only the methylation level of a single region is to be detected, the positive control DNA template is 10... 3 Copies / µL of artificially synthesized plasmids containing transformed ACTB, 10 3 A 1:1 mixture of two synthetic plasmids containing the detection region, at a ratio of 1 copy / µL; if the methylation level of the composition is to be detected according to Table 3, the positive control DNA template is 10. 3Copies / µL of artificially synthesized plasmids containing transformed ACTB, 10 3 Copies / µL of artificially synthesized plasmid containing one target region and 10 3 A 1:1:1 mixture of three artificially synthesized plasmids containing another target region, one copy per microliter.
[0141] Ct value reading: After PCR is completed, adjust the baseline. Set the fluorescence value 1-2 cycles in advance of the minimum Ct value of the sample in one PCR as the baseline value. Set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.
[0142] Quality control: The negative control should show no amplification, the positive control should show a clear exponential growth phase, and the Ct values of each gene in the positive control should be between 26 and 30. The Ct value of the internal reference gene in the sample to be tested should be ≤35. If the negative control, positive control, and internal reference gene all meet the above requirements, the experiment is considered valid, and the next step of sample result determination can proceed. Otherwise, the experiment is invalid and must be repeated.
[0143] 5. PCR Result Analysis
[0144] The methylation level of the sample is determined based on the Ct values detected in each target region. For tissue samples, if the Ct value of amplified region is ≤38, that region is considered methylated positive; if the Ct value of amplified region is >38, that region is considered methylated negative. When detecting a single region, if the sample is methylated positive in that region, it is considered a cancer-positive sample; if it is methylated negative in that region, it is considered a cancer-negative sample. When detecting a combination, if the sample is methylated positive in at least one region of the combination, it is considered a cancer-positive sample; only if the sample is methylated negative in both regions constituting the combination is it considered a cancer-negative sample.
[0145] The sensitivity and specificity of using quantitative real-time PCR to detect methylation levels in regions 1-8 to diagnose esophageal squamous cell carcinoma tissue samples and adjacent normal tissue samples are shown in Table 2. The sensitivity and specificity of using the detection of methylation levels in combinations of regions 1-4 with any of regions 5-8 to diagnose esophageal squamous cell carcinoma tissue samples and adjacent normal tissue samples are shown in Table 3.
[0146] Table 2. Methylation status of regions 1-8 in tissue samples and their diagnostic sensitivity and specificity.
[0147]
[0148]
[0149] Table 3. Methylation status of the composition in tissue samples and its diagnostic sensitivity and specificity.
[0150]
[0151] Table 2 shows that regions 1-8 exhibit the highest sensitivity (95.16%) for detecting esophageal squamous cell carcinoma, the highest sensitivity (78.85%) for detecting precancerous lesions, and the highest specificity (88.71%) for detecting adjacent normal tissue, indicating good overall detection performance. Table 3 shows that when the methylation levels of combinations of regions 1-4 with regions 5-8 are used, the sensitivity for diagnosing esophageal squamous cell carcinoma tissue samples is significantly improved compared to single-region detection. The B and M, N, P combinations show the highest sensitivity, reaching 96.77% for cancerous tissue. Simultaneously, the dominant detection region also achieves 86.54% sensitivity for detecting intraepithelial neoplasia. Furthermore, the specificity of the combination for detecting adjacent normal tissue can reach up to 85%.
[0152] Example 10
[0153] The performance of the composition in diagnosing esophageal exfoliated cells from patients with esophageal squamous cell carcinoma and precancerous lesions was analyzed using methylation-based quantitative PCR.
[0154] By detecting the methylation level of a combination of one or more regions of Chr18:3012367-3012756bp and / or Chr7:155459949-155460426bp in exfoliated esophageal cells from patients with esophageal squamous cell carcinoma and precancerous lesions, it is possible to effectively distinguish between patients with esophageal squamous cell carcinoma, precancerous lesions, and non-cancerous patients. The specific detection process is as follows.
[0155] 1. Collection of esophageal exfoliated cell samples
[0156] Esophageal exfoliated cells were sampled using an esophageal cell sampling kit.
[0157] A total of 35 esophageal exfoliated cells were collected from patients with pathologically confirmed esophageal squamous cell carcinoma, 28 from patients with esophageal epithelial neoplasia, and 26 from patients with esophagitis. All sample collection procedures were approved by the ethics committee, all volunteers signed informed consent forms, and all samples were anonymized.
[0158] 2. Sample DNA extraction
[0159] DNA was extracted from exfoliated cell samples using the nucleic acid extraction kit (EHanxie Medical Device Registration No. 20210836) from Wuhan Aimeisen Life Science Technology Co., Ltd. Specific steps are detailed in the kit's instruction manual.
[0160] 3. The sample DNA transformation and purification methods are the same as in Example 9.
[0161] 4. The detection method for methylation fluorescence quantitative PCR is the same as in Example 9.
[0162] 5. Analysis of methylation-based quantitative PCR results
[0163] The reading and quality control of Ct values are the same as in Example 9.
[0164] PCR result analysis and interpretation methods: For exfoliated cell samples, if the Ct value of the sample in a certain detection region is ≤38, the sample is considered methylated positive in that region; if the Ct value of the sample in a certain detection region is >38, the sample is considered methylated negative in that region. When detecting a single region, if the sample is methylated positive in that region, it is a cancer-positive sample; if it is methylated negative in that region, it is a cancer-negative sample. When detecting a combination, if the sample is methylated positive in at least one region of the combination, it is a cancer-positive sample; only if the sample is methylated negative in both regions constituting the combination is it a cancer-negative sample.
[0165] Table 4. Methylation status of regions 1-8 in exfoliated cell samples and their diagnostic sensitivity and specificity.
[0166]
[0167] Table 5. Methylation status of the composition in exfoliated cell samples and its diagnostic sensitivity and specificity.
[0168]
[0169]
[0170] Table 4 shows the methylation status and diagnostic sensitivity and specificity of regions 1-8 in exfoliated cell samples. As can be seen from Table 4, the sensitivity of each region (1-8) for detecting esophageal squamous cell carcinoma is above 80%, with regions 1, 5, 6, and 7 showing the best sensitivity at 91.43%. Regions 1 and 5 have a sensitivity of 78.57% for detecting precancerous lesions, and regions 1, 4, 6, and 7 have a specificity of 100% for detecting non-cancerous samples.
[0171] Table 5 examines the methylation status of the composition in exfoliated cell samples and assesses its diagnostic sensitivity and specificity. Table 5 shows that when the methylation levels of the composition in regions 1-4 are simultaneously detected with any of regions 5-8, its diagnostic efficacy for esophageal squamous cell carcinoma is significant. The highest sensitivity (94.29%) is achieved when regions 1 and 4 are combined with regions 5-8. Simultaneously, this composition also demonstrates advantages in detecting precancerous lesions, with a maximum sensitivity of 82.14% for intraepithelial neoplasia. In non-cancerous patient samples, the composition exhibits good specificity, with the optimal composition achieving an overall specificity of 96.15%. In summary, detecting the methylation levels of the composition using the combination of AD and MP yields the best diagnostic performance.
[0172] Example 11
[0173] The performance of the composition in diagnosing esophageal squamous cell carcinoma and precancerous lesions in plasma samples was analyzed using methylation-based quantitative PCR.
[0174] 1. Collection of plasma samples
[0175] A total of 60 plasma samples were collected from patients with esophageal squamous cell carcinoma, 51 from patients with esophageal intraepithelial neoplasia, and 110 from healthy individuals. All samples were collected by professional medical personnel and approved by the ethics committee. All volunteers signed informed consent forms, and all samples were anonymized.
[0176] 2. DNA template extraction:
[0177] Plasma cfDNA extraction was performed using the magnetic bead-based serum / plasma cell-free DNA (cfDNA) extraction kit (DP709) from Tiangen Biotech (Beijing) Co., Ltd. Specific procedures are detailed in the kit's instruction manual.
[0178] 3. The detection method for methylation fluorescence quantitative PCR is the same as in Example 9.
[0179] 4. Analysis of methylation-based quantitative PCR results
[0180] The reading and quality control of Ct values are the same as in Example 9.
[0181] PCR result analysis and interpretation methods: If the Ct value of a sample in a certain detection region is ≤45, the sample is considered methylated positive in that region; if the Ct value of a sample in a certain detection region is >45, the sample is considered methylated negative in that region. When detecting a single region, if the sample is methylated positive in that region, it is a cancer-positive sample; if it is methylated negative in that region, it is a cancer-negative sample. When detecting a combination, if the sample is methylated positive in at least one region of the combination, it is a cancer-positive sample; only if the sample is methylated negative in both regions constituting the combination is it a cancer-negative sample.
[0182] Table 6. Methylation status of regions 1-8 in exfoliated cell samples and their diagnostic sensitivity and specificity.
[0183]
[0184] Table 7. Methylation status of the composition in plasma samples and its diagnostic sensitivity and specificity.
[0185]
[0186] As shown in Table 6, the single-region detection showed the highest sensitivity (88.33%) for esophageal squamous cell carcinoma, the highest sensitivity (82.35%) for precancerous lesions, and the highest specificity (100%) for healthy plasma, all reaching high levels. Table 7 shows that the regional combinations effectively distinguished between esophageal squamous cell carcinoma plasma samples and healthy plasma samples. Compared to single-region detection, although specificity decreased slightly, sensitivity increased slightly. The sensitivity for detecting esophageal squamous cell carcinoma in each region was above 86%, with the A, B, D, N, O, and P combinations showing significantly higher sensitivity (90%) than other regions. The highest sensitivity (84.31%) was observed in plasma samples from patients with intraepithelial neoplasia. Furthermore, the specificity of these combinations was also high in healthy plasma samples, with the O and P combination achieving a specificity of 99.09%.
[0187] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0188] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification can be used to interpret the content of the claims.
Claims
1. A nucleic acid combination for detecting esophageal cancer or precancerous lesions, characterized in that, The nucleic acid combination includes a nucleic acid combination for detecting the methylation level of a target sequence, wherein the target sequence includes region 4; Referring to GRCh38.p14, region 4 is the negative chain of Chr18: 3012367-3012565; The nucleic acid combinations used to detect the 4-methylation level in the region include a fourth nucleic acid combination; The fourth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 10-11 and probes as shown in SEQ ID NO. 12; The esophageal cancer is esophageal squamous cell carcinoma, and the precancerous lesion is esophageal intraepithelial neoplasia.
2. The nucleic acid combination according to claim 1, characterized in that, The target sequence further includes a second target sequence; the second target sequence includes any one of region 5, region 6, region 7, and region 8; Referring to GRCh38.p14, region 5 is the positive strand of Chr7: 155459949-155460122; region 6 is the positive strand of Chr7: 155460212-155460376; region 7 is the negative strand of Chr7: 155460291-155460426; and region 8 is the negative strand of Chr7: 155459956-155460122. The nucleic acid combination for detecting the methylation level of the second target sequence includes any one of the fifth, sixth, seventh, and eighth nucleic acid combinations. The fifth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.13-14; The sixth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.16-17; The seventh nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.19-20; The eighth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.22-23; The fifth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.15; the sixth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.18; the seventh nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.21; and the eighth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.
24.
3. A kit for detecting esophageal cancer or precancerous lesions, characterized in that, The nucleic acid combination for detecting esophageal cancer or precancerous lesions as described in claim 1 or 2; wherein the esophageal cancer is esophageal squamous cell carcinoma, and the precancerous lesion is esophageal intraepithelial neoplasia.
4. The reagent kit according to claim 3, characterized in that, The kit also includes at least one of a sample collection device, a nucleic acid extraction reagent, and a nucleic acid purification reagent.
5. Application of nucleic acid combinations in the preparation of any one of the following products (a)-(c): (a) Diagnosis of esophageal cancer or precancerous lesions; (b) Differentiate between esophageal cancer samples and esophagitis samples; (c) Differentiate between esophageal precancerous lesion samples and esophagitis samples; The nucleic acid combination includes a nucleic acid combination for detecting the methylation level of a target sequence, wherein the target sequence includes region 4; The nucleic acid combinations used to detect the 4-methylation level in the region include a fourth nucleic acid combination; Referring to GRCh38.p14, region 4 is the negative chain of Chr18: 3012367-3012565; The fourth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 10-11 and probes as shown in SEQ ID NO. 12; The esophageal cancer is esophageal squamous cell carcinoma, and the precancerous lesion is esophageal intraepithelial neoplasia.
6. The application according to claim 5, characterized in that, The target sequence also includes any one of regions 5-8; Referring to GRCh38.p14, region 5 is the positive strand of Chr7: 155459949-155460122; region 6 is the positive strand of Chr7: 155460212-155460376; region 7 is the negative strand of Chr7: 155460291-155460426; region 8 is the negative strand of Chr7: 155459956-155460122; the nucleic acid combination includes any one of the fifth, sixth, seventh, and eighth nucleic acid combinations. The fifth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.13-14; The sixth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.16-17; The seventh nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.19-20; The eighth nucleic acid combination includes primer pairs with nucleotide sequences as shown in SEQ ID NO.22-23; The fifth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.15; the sixth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.18; the seventh nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.21; and the eighth nucleic acid combination further includes a probe with a nucleotide sequence as shown in SEQ ID NO.24.
Citation Information
Patent Citations
Esophageal-cancer-related methylated biomarker and application thereof
CN104745700A
Application of reagent for detecting methylation level in preparation of bladder cancer diagnostic product and bladder cancer diagnostic kit
CN115094139A