Method for efficiently synthesizing β-nicotinamide mononucleotide using nicotinamide ribokinase mutant and recombinant bacteria thereof

Abstract

The present invention relates to the field of bio-enzyme engineering technology, and in particular to a method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof, comprising the following steps: step 1: selecting a nucleotide sequence of any one of SEQ ID NO.1-6 to construct and clone a vector; step 2: verification; step 3: enzyme expression and extraction; step 4: purification; step 5: reaction; the present invention has the following beneficial effects: high production efficiency, low raw material cost and easy availability, which is conducive to industrial production; high yield and high product purity; compliance with food safety standards and high safety; and both cost and quality are independently controllable.

Description

Technical Field

[0001] The present invention relates to the technical field of bioenzyme engineering, and in particular to a method for efficiently synthesizing beta-nicotinamide mononucleotide by using a nicotinamide ribokinase mutant and a recombinant bacterium thereof. Background Art

[0002] NMN (full name β-nicotinamide mononucleotide) - "C11H15N2O8P", is a molecule that exists naturally in all forms of life. At the molecular level, it is ribonucleic acid, the basic structural unit of nucleic acid RNA. Structurally, the molecule is composed of nicotinamide, ribose and phosphate groups. NMN is a direct precursor of the essential molecule nicotinamide adenine dinucleotide (NAD+) and is considered a key component to increase NAD+ levels in cells.

[0003] First of all, NMN is a substance inherent in the human body and is also rich in some fruits and vegetables. NMN exists in every cell and participates in thousands of reactions. Since nicotinamide belongs to vitamin B3, NMN belongs to the category of vitamin B derivatives. It is widely involved in many biochemical reactions in the human body and is closely related to immunity and metabolism.

[0004] Secondly, in recent years, the NMN ingredient has undergone sufficient biological experiments and extensive academic demonstrations. It is currently the most effective anti-aging oral ingredient in the world, and positive articles have been published in world-renowned journals such as Science, Cell, and Nature.

[0005] The chemical method for synthesizing NMN is to use nicotinamide, tribenzoyl-β-D-ribose, tetraacetyl ribose, etc. as raw materials, and synthesize through key steps such as glycosylation, phosphorylation, and aminolysis. Depending on the starting materials and protecting groups, there are many main synthetic routes. Such as patents CN202210955224.2, CN202011625878.6, CN202110200759.4, etc. However, the chemical method has some difficulties such as expensive and difficult to obtain raw materials, long distances and difficult separation, high costs, difficult separation of isomers, and high environmental protection costs. Since a variety of organic solvents are required as media, the use of chemical synthesis processes to obtain purer compounds to apply for new food raw materials in China is generally not approved in principle. Based on the above chemical synthesis routes of NMN, biosynthesis is the best choice.

[0006] The biological method of synthesizing NMN mainly includes fermentation and enzyme methods. The fermentation method is to produce NMN with the help of microorganisms in a manner similar to brewing. Such as CN201610268173.0, but this method also has many limitations such as low production efficiency and high raw material costs, which is not conducive to industrial production. The biological enzyme catalysis method is currently a more popular production method, and there are mainly two technical routes: one is to use D-ribose and nicotinamide as starting materials, and obtain NMN through three-step catalytic reactions under the action of ribokinase, phosphoribosyl pyrophosphate synthetase and nicotinamide phosphoribosyl transferase, such as patent CN202211330622.1, but the substrate conversion rate of this route is not high (calculated in terms of nicotinamide, the maximum does not exceed 50%), and there are many intermediates, and subsequent separation and purification are more difficult, so the overall yield is low, resulting in high production costs. The second route is to use nicotinamide riboside (NR) as the starting material, and to obtain NMN in a one-step reaction under the action of nicotinamide ribokinase (NR kinase, NrK) and ATP, with high yield and high product purity, which will become the mainstream production method of NMN in the future. However, the enzyme activity of nicotinamide ribokinase is generally not high, and the threshold for enzymatic synthesis of β-nicotinamide mononucleotide is high. Several key catalytic enzymes are expensive, accounting for about half of the cost of the entire production process, but it is also a safer and more efficient production method. After screening out suitable enzymes, we perform combined random and site-directed saturation mutations on them to make them more reactive, and the cost and quality are independently controllable. When using the bio-enzyme catalysis method to produce NMN, the use of food-grade raw materials is an important link to ensure product safety. These processed raw materials used to produce NMN should all come from the raw materials listed in the relevant regulations such as the "Chinese Pharmacopoeia" to ensure that there are standards to follow. Summary of the invention

[0007] The purpose of the present invention is to provide a method for efficiently synthesizing β-nicotinamide mononucleotide (NMN) using a nicotinamide ribokinase mutant and a recombinant bacterium thereof, wherein a relatively pure β-nicotinamide mononucleotide compound is obtained by bioprocess synthesis, so that it can be approved in China for application of new food raw materials; β-nicotinamide mononucleotide is synthesized under the action of nicotinamide ribokinase using nicotinamide as a substrate; after screening out a suitable enzyme, a combined random and site-directed saturation mutation is performed on it to make it have higher reaction activity, and the cost and quality are independently controllable; when adopting the bioenzyme catalysis method to produce NMN, the use of food-grade raw materials is an important link to ensure product safety; these processed raw materials used to produce NMN should all come from the raw materials listed in the relevant regulations such as the "Chinese Pharmacopoeia" to ensure that there are standards to follow.

[0008] The present invention designs a reasonable enzyme catalytic reaction synthesis route for industrial production of β-nicotinamide mononucleotide, the target product β-mononucleotide (NMN), the structural formula of which is as follows:

[0009]

[0010] In order to achieve the purpose of the invention, the technical solution adopted by the present invention is:

[0011]

[0012] The substrate nicotinamide generates β-mononucleotide (NMN) under the action of nicotinamide ribokinase (NR Kinase). An ATP recycling regeneration system is introduced into the process, and the commercial ATP regeneration kinase PPK2 from NEB is purchased.

[0013] The experimental materials used in the present invention are as follows:

[0014] In the above reaction, nicotinamide ribokinase (NR kinase) includes NrK01, NrK02, NrK03, NrK04, Q165K, and S97A. Among them, the nucleotide sequences of NrK01, NrK02, NrK03, and NrK04 are artificially synthesized, and Q165K and S97A are derived from random and site-directed saturation mutations of NrK02, specifically, the Q at position 165 is mutated to K, and the S at position 97 is mutated to A.

[0015] In the reaction process of the present invention, ATP can be recycled in the presence of PPK2, thereby greatly reducing its usage.

[0016] Preferably, the magnesium ions of the coenzyme factor can be provided by one or more of magnesium chloride, magnesium sulfate, magnesium sulfite and magnesium nitrate.

[0017] The buffer used in this reaction is 50 mM PBS, with a pH of 6.0-7.5.

[0018]

[0019]

[0020] A method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof of the present invention comprises the following steps:

[0021] Step 1: Select a nucleotide sequence of one of nicotinamide ribokinase SEQ ID NO. 1-6 to construct and clone a vector;

[0022] Step 2: Verification;

[0023] Step 3: Enzyme expression and extraction;

[0024] Step 4: purification;

[0025] Step 5: Reaction.

[0026] Preferably, the step 1 is specifically as follows:

[0027] The nucleotide sequence of one of the selected nicotinamide ribokinase SEQ ID NO.1-6 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.X-pET28a. The following operation was performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, a heat shock at 42°C for 60 seconds, and an ice bath for 5 minutes. 300 μl of 37°C antibiotic-free LB culture medium was added to the tube, and the tube was repaired on a shaking table at 37°C and 200r for 1 hour. Then, the tube was spread on a kanamycin-resistant solid LB plate and cultured at 37°C. After the colony grew, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation, and corresponding marks were made on the corresponding bacteria and the lined area on the plate.

[0028] Preferably, the step 2 is specifically as follows:

[0029] Place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: nicotinamide ribokinase SEQ ID NO.1-Escherichia coli.

[0030] Preferably, the step 3 is specifically as follows:

[0031] The Escherichia coli containing the target enzyme sequence was picked up into the LB medium containing kanamycin resistance, and after culturing at 37°C until the OD reached about 1.0, IPTG with a final concentration of 0.7 mM was added, and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysis solution. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0032] Preferably, the step 4 is specifically as follows:

[0033] The enzyme-containing supernatant was passed through a Ni column and then eluted with imidazole solutions of different gradients. The Ni column eluate with the highest enzyme content was passed through a Q column and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0034] Preferably, an ATP recycling regeneration system is introduced in step 5.

[0035] Preferably, the step 5 is specifically as follows:

[0036] In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g coenzyme factor, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 30℃-40℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and the conversion rate is calculated by high-performance liquid chromatography detection>75%.

[0037] Preferably, the reaction liquid temperature is 37°C.

[0038] Preferably, the coenzyme factor can be provided by one or more of magnesium chloride, magnesium sulfate, magnesium sulfite and magnesium nitrate.

[0039] Preferably, the buffer used in the reaction is 50 mM PBS buffer with a pH of 6.0 to 7.5.

[0040] In summary, the present invention has the following beneficial effects:

[0041] 1. High production efficiency, low raw material cost and easy to obtain, which is conducive to industrial production;

[0042] 2. High yield and high product purity;

[0043] 3. Comply with food safety standards and have high safety;

[0044] 4. Both cost and quality are independently controllable. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 is a high performance liquid chromatogram of the substrate nicotinamide before the reaction in each example;

[0046] Figure 2 It is the HPLC chromatogram of the reference substance β-mononucleotide in each example. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with the accompanying drawings.

[0048] In view of the deficiencies of the prior art, the purpose of the present invention is to provide a one-step reaction enzyme with high activity, high conversion rate and suitable for industrial production for enzymatic production of β-nicotinamide mononucleotide. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method of the present invention has been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and its application herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0049] The synthesis method and the schematic diagram of the reaction principle described in the present invention are intended to clearly describe the core reaction route, and do not limit whether the entire reaction is carried out by a one-step method or a multi-step method.

[0050] The enzymes used in the present invention can be artificially synthesized according to the sequence, or the enzyme expression genes can be carried by plasmid vectors according to the method provided by the present invention and induced to express with the help of host cells.

[0051] Example 1

[0052] S1 vector construction and cloning: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.1 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.1-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, heat shock at 42°C for 60 seconds, and then an ice bath for 5 minutes. 300 μl of 37°C non-antibiotic LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. Then, the tube was spread on a solid LB plate with kanamycin resistance and cultured at 37°C. After the colonies grew out, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation. The corresponding bacteria and the lined area on the plate were marked accordingly;

[0053] S2 verification: Then place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: Nicotinamide ribokinase SEQ ID NO.1-Escherichia coli;

[0054] Expression and extraction of S3 enzyme: The Escherichia coli containing the target enzyme sequence was picked up into LB medium containing kanamycin resistance, cultured at 37°C until the OD reached about 1.0, then IPTG with a final concentration of 0.7 mM was added and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0055] S4 purification: the enzyme-containing supernatant was passed through a Ni column, and then eluted with imidazole solutions of different gradients. Specifically, 5 mM imidazole was used to wash away impurities, and then the target protein was eluted with 300 mM imidazole. The Ni column eluate with the highest enzyme content was passed through a Q column, and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0056] S5 reaction: In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g MgCl2·6H2O, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 37℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and detected by high-performance liquid chromatography to calculate the conversion rate>75%.

[0057] Before the reaction, the HPLC chromatogram of the substrate nicotinamide was measured as follows: Figure 1 As shown, the HPLC chromatogram of the reference substance β-nicotinamide mononucleotide is as follows Figure 2 As shown, it can be seen that the substrate is consumed in the reaction to obtain the product β-nicotinamide mononucleotide.

[0058] After the above reaction is completed, β-nicotinamide mononucleotide is obtained after post-processing and purification such as ion exchange resin separation and freeze-drying, and the purity reaches 99.6%.

[0059] Example 2

[0060] S1 vector construction and cloning: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.2 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.2-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, heat shock at 42°C for 60 seconds, and then an ice bath for 5 minutes. 300 μl of 37°C antibiotic-free LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. Then, the tube was smeared on a solid LB plate with kanamycin resistance and cultured at 37°C. After the colony grew, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation. The corresponding bacteria and the lined area on the plate were marked accordingly;

[0061] S2 verification: Then place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: Nicotinamide ribokinase SEQ ID NO.2-Escherichia coli;

[0062] Expression and extraction of S3 enzyme: The Escherichia coli containing the target enzyme sequence was picked up into LB medium containing kanamycin resistance, cultured at 37°C until the OD reached about 1.0, then IPTG with a final concentration of 0.7 mM was added and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0063] S4 purification: the enzyme-containing supernatant was passed through a Ni column, and then eluted with imidazole solutions of different gradients. Specifically, 5 mM imidazole was used to wash away impurities, and then the target protein was eluted with 300 mM imidazole. The Ni column eluate with the highest enzyme content was passed through a Q column, and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0064] S5 reaction: In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g MgCl2·6H2O, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 37℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and detected by high-performance liquid chromatography to calculate the conversion rate>89%.

[0065] Before the reaction, the HPLC chromatogram of the substrate nicotinamide was measured as follows: Figure 1 As shown, the HPLC chromatogram of the reference substance β-nicotinamide mononucleotide is as follows Figure 2 As shown, it can be seen that the substrate is consumed in the reaction to obtain the product β-nicotinamide mononucleotide.

[0066] After the above reaction is completed, β-nicotinamide mononucleotide is obtained after post-processing and purification such as ion exchange resin separation and freeze-drying, and the purity reaches 99.7%.

[0067] Example 3

[0068] S1 vector construction and cloning: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.3 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.3-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, heat shock at 42°C for 60 seconds, and then an ice bath for 5 minutes. 300 μl of 37°C non-antibiotic LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. Then, the tube was smeared on a solid LB plate with kanamycin resistance and cultured at 37°C. After the colony grew, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation. The corresponding bacteria and the lined area on the plate were marked accordingly;

[0069] S2 verification: Then place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: Nicotinamide ribokinase SEQ ID NO.3-Escherichia coli;

[0070] Expression and extraction of S3 enzyme: The Escherichia coli containing the target enzyme sequence was picked up into LB medium containing kanamycin resistance, cultured at 37°C until the OD reached about 1.0, then IPTG with a final concentration of 0.7 mM was added and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0071] S4 purification: the enzyme-containing supernatant was passed through a Ni column, and then eluted with imidazole solutions of different gradients. Specifically, 5 mM imidazole was used to wash away impurities, and then the target protein was eluted with 300 mM imidazole. The Ni column eluate with the highest enzyme content was passed through a Q column, and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0072] S5 reaction: In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g MgCl2·6H2O, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 37℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and detected by high performance liquid chromatography to calculate the conversion rate>88%.

[0073] Before the reaction, the HPLC chromatogram of the substrate nicotinamide was measured as follows: Figure 1 As shown, the HPLC chromatogram of the reference substance β-nicotinamide mononucleotide is as follows Figure 2 As shown, it can be seen that the substrate is consumed in the reaction to obtain the product β-nicotinamide mononucleotide.

[0074] After the above reaction is completed, β-nicotinamide mononucleotide is obtained after post-treatment and purification such as ion exchange resin separation and freeze-drying, and the purity reaches 99.0%.

[0075] Example 4

[0076] S1 vector construction and cloning: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.4 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.4-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, heat shock at 42°C for 60 seconds, and then an ice bath for 5 minutes. 300 μl of 37°C antibiotic-free LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. Then, the tube was spread on a solid LB plate with kanamycin resistance and cultured at 37°C. After the colonies grew out, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation. The corresponding bacteria and the lined area on the plate were marked accordingly;

[0077] S2 verification: Then place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: Nicotinamide ribokinase SEQ ID NO.4-Escherichia coli;

[0078] Expression and extraction of S3 enzyme: The Escherichia coli containing the target enzyme sequence was picked up into LB medium containing kanamycin resistance, cultured at 37°C until the OD reached about 1.0, then IPTG with a final concentration of 0.7 mM was added and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0079] S4 purification: the enzyme-containing supernatant was passed through a Ni column, and then eluted with imidazole solutions of different gradients. Specifically, 5 mM imidazole was used to wash away impurities, and then the target protein was eluted with 300 mM imidazole. The Ni column eluate with the highest enzyme content was passed through a Q column, and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0080] S5 reaction: In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g MgCl2·6H2O, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 37℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and detected by high-performance liquid chromatography to calculate the conversion rate>82%.

[0081] Before the reaction, the HPLC chromatogram of the substrate nicotinamide was measured as follows: Figure 1 As shown, the HPLC chromatogram of the reference substance β-nicotinamide mononucleotide is as follows Figure 2 As shown, it can be seen that the substrate is consumed in the reaction to obtain the product β-nicotinamide mononucleotide.

[0082] After the above reaction is completed, β-nicotinamide mononucleotide is obtained after post-processing and purification such as ion exchange resin separation and freeze-drying, and the purity reaches 99.5%.

[0083] Example 5

[0084] S1 vector construction and cloning: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.5 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.5-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, heat shock at 42°C for 60 seconds, and then an ice bath for 5 minutes. 300 μl of 37°C non-antibiotic LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. Then, the tube was spread on a solid LB plate with kanamycin resistance and cultured at 37°C. After the colonies grew out, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation. The corresponding bacteria and the lined area on the plate were marked accordingly;

[0085] S2 verification: Then place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: Nicotinamide ribokinase SEQ ID NO.5-Escherichia coli;

[0086] Expression and extraction of S3 enzyme: The Escherichia coli containing the target enzyme sequence was picked up into LB medium containing kanamycin resistance, cultured at 37°C until the OD reached about 1.0, then IPTG with a final concentration of 0.7 mM was added and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0087] S4 purification: the enzyme-containing supernatant was passed through a Ni column, and then eluted with imidazole solutions of different gradients. Specifically, 5 mM imidazole was used to wash away impurities, and then the target protein was eluted with 300 mM imidazole. The Ni column eluate with the highest enzyme content was passed through a Q column, and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0088] S5 reaction: In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g MgCl2·6H2O, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 37℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and detected by high-performance liquid chromatography to calculate its conversion rate>98%.

[0089] Before the reaction, the HPLC chromatogram of the substrate nicotinamide was measured as follows: Figure 1 As shown, the HPLC chromatogram of the reference substance β-nicotinamide mononucleotide is as follows Figure 2 As shown, it can be seen that the substrate is consumed in the reaction to obtain the product β-nicotinamide mononucleotide.

[0090] After the above reaction is completed, β-nicotinamide mononucleotide is obtained after post-processing and purification such as ion exchange resin separation and freeze-drying, and the purity reaches 99.8%.

[0091] Example 6

[0092] S1 vector construction and cloning: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.6 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.6-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, heat shock at 42°C for 60 seconds, and then an ice bath for 5 minutes. 300 μl of 37°C non-antibiotic LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. Then, the tube was spread on a solid LB plate with kanamycin resistance and cultured at 37°C. After the colonies grew out, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the LB plate containing kanamycin resistance for seed preservation. The corresponding bacteria and the lined area on the plate were marked accordingly;

[0093] S2 verification: Then place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15min, 94℃ denaturation 15s, 55℃ annealing 15s, 72℃ extension 1min, 30 cycles, and finally 72℃, incubation for 5min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: Nicotinamide ribokinase SEQ ID NO.6-Escherichia coli;

[0094] Expression and extraction of S3 enzyme: The Escherichia coli containing the target enzyme sequence was picked up into LB medium containing kanamycin resistance, cultured at 37°C until the OD reached about 1.0, then IPTG with a final concentration of 0.7 mM was added and the culture was induced at 28°C for 16 hours. The bacterial liquid was then centrifuged at 7000 g / min for 6 minutes to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell crusher to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 minutes, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

[0095] S4 purification: the enzyme-containing supernatant was passed through a Ni column, and then eluted with imidazole solutions of different gradients. Specifically, 5 mM imidazole was used to wash away impurities, and then the target protein was eluted with 300 mM imidazole. The Ni column eluate with the highest enzyme content was passed through a Q column, and then eluted with salt solutions (mainly KCL) of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

[0096] S5 reaction: In a 50mL glass reaction bottle, add 3g substrate nicotinamide, 0.16g MgCl2·6H2O, 3g ATP, 0.15g sodium hexametaphosphate. 1ml nicotinamide ribokinase solution (20mg / ml), 1ml ATP regeneration enzyme ppk2 solution (20mg / ml), and then add 3ml 100mM PBS buffer to the reaction bottle to start the reaction; the reaction liquid temperature is 37℃, and the pH of the reaction liquid is controlled between 6.8-7.2 with NaOH. Stir evenly and react for 6h. After passing through a 0.22μm filter membrane, 10μl of the solution can be taken and detected by high-performance liquid chromatography to calculate its conversion rate>95%.

[0097] Before the reaction, the HPLC chromatogram of the substrate nicotinamide was measured as follows: Figure 1 As shown, the HPLC chromatogram of the reference substance β-nicotinamide mononucleotide is as follows Figure 2 As shown, it can be seen that the substrate is consumed in the reaction to obtain the product β-nicotinamide mononucleotide.

[0098] After the above reaction is completed, β-nicotinamide mononucleotide is obtained after post-processing and purification such as ion exchange resin separation and freeze-drying, and the purity reaches 99.8%.

[0099] The conversion rate, product and purity during the reaction of Examples 1-6 are shown in the following table:

[0100]

[0101] As shown in the table above, SEQ ID NO.5 and SEQ ID NO.6 obtained by combined random and site-directed saturation mutagenesis techniques have higher reactivity, can be efficiently synthesized by enzymatic method with higher purity β-nicotinamide mononucleotide, and are more suitable for industrial production.

[0102] According to the reaction route of the process of the present invention, the amount of each reaction substance can be adjusted according to the actual situation. In order to maximize the efficiency, the present invention provides the following concentrations and amounts of each reaction substance:

[0103] The substrate concentration of niacinamide is 20mM, the substrate concentration of ATP is 2mM, the substrate concentration of sodium hexametaphosphate PolyP6 is 15mM, the concentration of Mg2+ is 15mM, and the buffer solution is 50mM PBS pH6.0.

[0104] The pH of the reaction solution was maintained at 6.0 during the reaction, and the reaction temperature was preferably 37°C.

[0105] The relevant information of the enzymes used in the specific embodiments of the present invention is shown in Table 1 and Table 2:

[0106] Table 1

[0107]

[0108]

[0109] The corresponding nucleotide sequences of nicotinamide riboside kinase in the above table are shown as SEQ ID NO.1 to SEQ ID NO.4 in the sequence listing.

[0110] SEQ ID NO.1

[0111] atgcatcatcatcatcaccatagcagcggtgccgataaaaaagcactgattgttgccctgagcggctgtagtagcagcggtaaaaccaccctggcccgtctgctgcgtgatatttttccgagtacctttattctgcatgaagatgatttttaccgtccggaaaccgaactgccgaaaaaagatgatctgctggattgggattgtgccgaaagtattgatattccggcaatggctgaaagcctgagctatattcgtcagcatgccgcctttccgccgaccctggatagttatcaggataaaaatagcgttggcgaatgcccggtgccgccgagtaccattagtgcactgaaaagtaaagttagcagcctgctgccgagtacccatccgctggcaaccagtgccctgcatctgtgtattctggatggttttctgctgtatccgccgagcatgagtgccattcagccgcatctggatattaagatttttctgcgtgcaagctatgcccaggccaaagcccgtcgtgaagcacgtgatggttatgtgaccctggaaggtttttgggcagatccgccgggctatgtggataaaattgtgtggccgaattatgttgccgaacatagttggatgtttcaggatggtgacgttgaaggtgaatataaagccgatgttctggaacaggaagccattcgtgttccgagcggtagcggcgtggatggtgaaatggataaaattctggaatggatggtggatctgattctggaagaaatgaaaaaatacgcataa

[0112] SEQ ID NO.2

[0113] atgcatcatcatcatcaccatagcagcggtaaaacctttattatggtattagcggtgttaccaatagcggcaaaaccaccctggcaaaaaatctgcagaaacatctgccgaattgtagtgtgattagtcaggatgat ttctttaaaccggaaagtgaaattgaaaccgataaaaatggtttcctgcagtatgatgttctggaagcactgaatatggaaaaaatgatgagtgccattagttgctggatggaaagtgcccgccatagcgtggtgagta ccgatcaggaaagtgcagaagaaattccgattctgattattgaaggctttctgctgtttaattacaatacccgtgtgtatcagccgccggatagtccgggttattttgatggtcatgtttggccgatgtatctgaaata tcgtcaggaaatgcaggatattacctgggaagtggtgtatctggatggcaccaaaagtgaagaagatctgtttctgcaggtttatgaagatctgattcaggaactggccaaacagaaatgcctgcaggttaccgcataa

[0114] SEQ ID NO.3

[0115] atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccatatgaccaccaccaaagtgaaactgattgcaattagcggttgtagtagcagcggtaaaaccaccctggcaaaatttctggcaaatgccattccgggttgcattctgattcatgaagatgatttttacaagccggatagtgaaattccgattaatgaaaaatacggcgtggccgattgggattgcccggaagccctggatctggatgcattcaaacgcgaactggatctgattaagaccaccggcagcattaagaccaaactgattcataatgaaaacgttgatgacattggtaaattcaatatcaagcaggaagattgggatgcactgcgcgcaaaactgagtagcgttattgaaagtgatctgaaagttgtgctggtggatggctttatgatttttaatgatgaagagctgatgaagaagtttgatattcgtattttcgtgcgtgccccgtatgaagttctgagccgccgtcgccatgcacgtgcaggttataaaaccctggaaagtttttgggtggaccctccgtattattttgatgaatttgtttaccgcgcctatcgcgaagaacataaacatctgtttgttaatgaggatgtggaaggtagtctgcgcagcgatgccggcctgtttgaactgattaatgatgatgaaaccgaaattaccaaggcactgaataccattgccgattatattgttagtcatctggatgccaattaa

[0116] SEQ ID NO.4

[0117] atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccatatgaccagtaaaaaggttatcctggttgcactgagtggctgtagtagcagtggtaaaaccaccattgccaaactgaccgcaagtctgtttaccaaagccaccctgattcatgaagatgatttttataagcacgacaatgaagtgccggtggatgcaaaatataatattcagaattgggacagtccggaagcactggattttaaactgtttggcaaagaactggatgttattaagcagaccggtaaaattgccaccaaactgattcataataacaatgtggatgacccgtttaccaaatttcatattgatcgtcaggtttgggatgaactgaaagccaaatatgatagcattaatgatgacaaatacgaggttgttatcgttgatggttttatgattttcaacaacaccggtattagtaaaaagtttgatctgaaaatcctggttcgcgccccgtatgaagtgctgaaaaaacgccgcgccagtcgtaaaggctatcagaccctggatagcttttgggttgatccgccgtattattttgatgaatttgtgtatgagagctaccgcgcaaatcatgcacagctgtttgttaatggtgacgtggaaggcctgctggaccctcgtaaaagtaaaaatattaaggagtttattaacgacgacgataccccgattgcaaaaccgctgagctgggtttgtcaggaaattctgaaactgtgtaaagattaa

[0118] Table 2

[0119]

[0120] The corresponding nucleotide sequences of nicotinamide riboside kinase in the above table are shown as SEQ ID NO.5 - SEQ ID NO.6 in the sequence listing.

[0121] SEQ ID NO.5

[0122] atgcatcatcatcatcatcatagcagcggcaaaacctttattattggcattagcggcgtgaccaacagcggcaaaaccaccctggcgaaaaacctgcagaaacatctgccgaactgcagcgtgattagccaggatgatttttttaaaccggaaagcgaaattgaaaccgataaaaacggctttctgcagtatgatgtgctggaagcgctgaacatggaaaaaatgatgagcgcgattagctgctggatggaaagcgcgcgccatagcgtggtgagcaccgatcaggaaagcgcggaagaaattccgattctgattattgaaggctttctgctgtttaactataacacccgcgtgtatcagccgccggatagcccgggctattttgatggccatgtgtggccgatgtatctgaaatatcgccaggaaatgcaggatattacctgggaagtggtgtatctggatggcaccaaaagcgaagaagatctgtttctgaaagtgtatgaagatctgattcaggaactggcgaaacagaaatgcctgcaggtgaccgcg

[0123] SEQ ID NO.6

[0124] atgcatcatcatcatcatcatagcagcggcaaaacctttattattggcattagcggcgtgaccaacagcggcaaaaccaccctggcgaaaaacctgcagaaacatctgccgaactgcagcgtgattagccaggatgatttttttaaaccggaaagcgaaattgaaaccgataaaaacggctttctgcagtatgatgtgctggaagcgctgaacatggaaaaaatgatgagcgcgattagctgctggatggaaagcgcgcgccatagcgtggtgagcaccgatcaggaagcggcggaagaaattccgattctgattattgaaggctttctgctgtttaactataacacccgcgtgtatcagccgccggatagcccgggctattttgatggccatgtgtggccgatgtatctgaaatatcgccaggaaatgcaggatattacctgggaagtggtgtatctggatggcaccaaaagcgaagaagatctgtttctgcaggtgtatgaagatctgattcaggaactggcgaaacagaaatgcctgcaggtgaccgcg

Claims

1. A method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof, characterized in that: The following steps are involved: Step 1: Select the nucleotide sequence of nicotinamide ribokinase SEQ ID NO.5 to construct and clone a vector; Step 2: Verification; Step 3: Enzyme expression and extraction; Step 4: purification; Step 5: Reaction.

2. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 1, characterized in that: The step 1 is specifically as follows: The nucleotide sequence of the selected nicotinamide ribokinase SEQ ID NO.5 was connected to the vector pET28a by seamless cloning to obtain nicotinamide ribokinase SEQ ID NO.5-pET28a. The following operations were performed on the aforementioned connection vector: 10 μl of the connection product was added to 100 μl of Escherichia coli BL21 (DE3) competent cells in an ice bath, followed by an ice bath for 30 minutes, a heat shock at 42°C for 60 seconds, and an ice bath for 5 minutes. 300 μl of 37°C antibiotic-free LB culture medium was added to the tube, and the tube was repaired at 37°C and 200r on a shaking table for 1 hour. The tube was then spread on a kanamycin-resistant solid LB plate and cultured at 37°C. After the colonies grew, a single colony was picked up with an autoclaved toothpick, and a line was drawn on the kanamycin-resistant LB plate for seed preservation, and corresponding marks were made on the corresponding bacteria and the lined area on the plate.

3. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 1, characterized in that: The step 2 is specifically as follows: Place the toothpick in 20μl PCR Mix system with T7 universal primer and stir it for PCR amplification. The PCR reaction conditions are: 95℃, 15 min, 94℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 30 cycles, and finally 72℃, insulation for 5 min. After PCR amplification, electrophoresis is performed to observe the results to obtain positive clones and obtain Escherichia coli strains containing the target enzyme sequence: nicotinamide ribokinase SEQ ID NO.5-Escherichia coli.

4. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 1, characterized in that: The step 3 is specifically as follows: The Escherichia coli containing the target enzyme sequence was picked up into the LB medium containing kanamycin resistance, and after culturing at 37°C until the OD reached 1.0, IPTG with a final concentration of 0.7 mM was added, and the culture was induced at 28°C for 16 h. The bacterial liquid was then centrifuged at 7000 g / min for 6 min to collect the bacteria. After the supernatant culture medium was discarded, the bacteria were resuspended in 100 mM PBS solution at a ratio of bacterial weight: PBS solution = 1 g: 5 ml. The resuspended bacteria were crushed by a high-pressure cell disruptor to obtain an enzyme-containing lysate. After centrifugation at 35000 g / min for 30 min, the supernatant was extracted to obtain a crude enzyme solution of the target enzyme.

5. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 1, characterized in that: The step 4 is specifically as follows: The enzyme-containing supernatant was passed through a Ni column and then eluted with imidazole solutions of different gradients. The Ni column eluate with the highest enzyme content was passed through a Q column and then eluted with salt solutions of different gradients to obtain a preliminarily purified enzyme-containing solution. The preliminarily purified enzyme-containing solution was dialyzed for 12 hours to finally obtain an enzyme solution after the target enzyme was purified.

6. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 1, characterized in that: In step 5, an ATP cycle regeneration system is introduced.

7. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 6, characterized in that: The step 5 is specifically as follows: In a 50 mL glass reaction bottle, add 3 g substrate niacinamide, 0.16 g coenzyme factor, 3 g ATP, 0.15 g sodium hexametaphosphate, 1 ml 20 mg / ml nicotinamide ribokinase solution, 1 ml 20 mg / ml ATP regeneration enzyme ppk2 solution, and then add 3 ml 100 mM PBS buffer to the reaction bottle to start the reaction; the reaction solution temperature is 30°C-40°C, and the pH of the reaction solution is controlled between 6.8 and 7.2 with NaOH. After stirring evenly, react for 6 hours. After passing through a 0.22 μm filter membrane, take 10 μl of the solution and use high performance liquid chromatography to calculate its conversion rate>75%.

8. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 7, characterized in that: The reaction liquid temperature was 37°C.

9. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 7, characterized in that: The coenzyme factor is provided by one or more of magnesium chloride, magnesium sulfate, magnesium sulfite, and magnesium nitrate.

10. The method for efficiently synthesizing β-nicotinamide mononucleotide using a nicotinamide ribokinase mutant and a recombinant bacterium thereof according to claim 7, characterized in that: The buffer used in this reaction is 50 mM PBS buffer with a pH of 6.0~7.5.

Images