Potato StTuA and StTuB genes and their applications

By cloning and overexpressing the potato StTuA and StTuB genes, photosynthesis and nuclear signaling were promoted, solving the antagonistic problem between yield and resistance in breeding and achieving the breeding goal of high yield, disease resistance and stress resistance in potatoes.

CN116445495BActive Publication Date: 2026-05-26HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-11
Publication Date
2026-05-26

Smart Images

  • Figure CN116445495B_ABST
    Figure CN116445495B_ABST
Patent Text Reader

Abstract

This invention provides information on the potato StTuA and StTuB genes and their applications in improving late blight resistance, abiotic stress resistance, and yield. This invention discovers and confirms that two chloroplast elongation factors, StTuA and StTuB, encoded by potato nuclear genes and synthesized in the cytoplasm, can promote leaf photosynthesis, significantly increase potato tuber yield, and significantly enhance resistance to late blight and abiotic stress. Therefore, this study provides two key target genes for improving potato yield and resistance; increasing the expression levels of StTuA and StTuB genes can significantly improve potato yield and late blight resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of potato late blight resistance gene mining, specifically involving the potato StTuA and StTuB genes and their application in improving late blight and stress resistance and increasing yield. Background Technology

[0002] Potatoes are the world's fourth largest food crop after rice, wheat, and corn. In my country, they are also an extremely important dual-purpose crop, used for both food and vegetables. my country ranks first in the world in both potato planting area and yield, accounting for about a quarter of the global total. Potatoes play a vital role in ensuring global and Chinese food security. However, my country's potato yield is only close to the world average (approximately 1.3 tons per mu), far behind the high-yield levels of developed countries (approximately 4-5 tons per mu). Currently, China faces a shortage of land resources, and increasing crop yield is the main way to efficiently utilize limited land. During potato growth, various diseases such as late blight and adverse environmental stresses such as high temperatures severely affect potato growth, leading to reduced yields. Therefore, developing new disease-resistant, stress-resistant, and high-yielding potato varieties has always been a goal for breeders both domestically and internationally.

[0003] Potato late blight resistance consists of vertical resistance controlled by major R genes and horizontal resistance controlled by minor polygenes. When infected by pathogens, the plant's innate immune system is activated, coordinating plant cells to form a unified disease defense line (Jonatha et al., 2006). Simultaneously, various organelles participate in the immune response, such as the sensing of pathogen-associated molecular patterns (PAMPs) by receptor kinases on the cell membrane, signal transduction in the cytoplasm, and the activation of resistance-related genes in the cell nucleus (Yang et al., 2022; Zhou et al., 2020; Li et al., 2015). As a site of production for some defense signaling molecules, chloroplasts play a crucial role in plant immunity. When infected by pathogens, chloroplasts produce large amounts of ROS, SA, and NO for self-protection. At the same time, they transmit immune signals to organelles such as the cell nucleus through retrograde signaling regulation, further enhancing the plant's immune response (Kretschmer et al., 2019; Serrano et al., 2016; Caplan et al., 2015).

[0004] Chloroplasts, as the primary site of photosynthesis and energy factories, play a crucial role in plant growth and development. The generally accepted theory is that enhancing light energy utilization efficiency is a key factor in increasing crop yield, as seen in rice and wheat (Long et al., 2015; Dahal et al., 2014; Parry et al., 2011). Potato leaves synthesize glucose through photosynthesis and sucrose in the cytoplasm; sucrose is then transported to underground stolons and converted into starch, thereby promoting potato tuber development and growth (Dahal et al., 2019). Existing research reports that potatoes have high light energy conversion efficiency, and improving photosynthetic efficiency has great potential to increase potato tuber yield (Dahal et al., 2019).

[0005] Chloroplast-derived proteins and cytoplasm-synthesized chloroplast localization proteins work together to construct chloroplasts, regulate chloroplast development, and thus influence plant yield and resistance. Chloroplast protein translation requires three processes: initiation, elongation, and termination. The elongation factor EF-Tu plays a crucial role in the peptide chain elongation stage. EF-Tu belongs to the GTP-binding protein family. GTP-bound EF-Tu forms a ternary complex with aminoacyl-tRNA, promoting the entry of aminoacyl-tRNA into the A site of the 70S ribosome. After codon recognition, GTPase is activated and hydrolyzes EF-Tu-GTP to form EF-Tu-GDP, which is then released from the ribosome for the next cycle (Warias, et al., 2020). The loss of chloroplast EF-Tu leads to leaf whitening in Arabidopsis thaliana, reduced heat tolerance in both tomato and Arabidopsis, and impaired chloroplast development in rice under low-temperature conditions, indicating that chloroplast EF-Tu plays an important role in plant stress response. However, the role of chloroplast EF-Tu in plant immunity has not been reported (Cai et al., 2021; Liu et al., 2019; Li et al., 2018). Furthermore, no studies have been reported on using chloroplast EF-Tu expression regulation to improve plant yield.

[0006] In breeding practice, breeders hope to obtain varieties that are disease-resistant, stress-resistant, and high-yielding. However, there is often an antagonistic relationship between plant resistance and yield. In production practice, high-yielding varieties often have poor disease and stress resistance, while highly resistant varieties often have lower yields. Obtaining disease-resistant, stress-resistant, and high-yielding varieties in conventional breeding processes is very difficult because it requires the aggregation of disease-resistant genes, stress-resistant genes, and many yield-related genes. Therefore, discovering and cloning pleiotropic genes that can simultaneously regulate yield and stress resistance, and rapidly introducing them into crops using biotechnology to improve disease resistance, stress resistance, and yield, is a long-cherished dream of researchers. Currently, many single genes that regulate yield or resistance have been applied in crop breeding, such as improving plant biomass and yield by regulating photosynthesis-related genes (CO2 assimilation, photorespiration, etc.) and nutrient-efficient utilization genes. However, pleiotropic genes that simultaneously regulate yield and resistance are rarely reported in potatoes and other crops.

[0007] Existing technology has limitations: Currently, no genes in potatoes that simultaneously promote yield and resistance have been identified. Chloroplasts, as the primary site of photosynthesis and plant immunity, may contain genes that simultaneously control yield and resistance, but this has not yet been reported. This study discovered and confirmed that two chloroplast elongation factors, StTuA and StTuB, encoded by potato nuclear genes and synthesized in the cytoplasm, can promote leaf photosynthesis, significantly increase potato tuber yield, and significantly enhance resistance to late blight and abiotic stress. Therefore, this study provides two key target genes for improving potato yield and resistance; increasing the expression levels of StTuA and StTuB genes can significantly improve potato yield and late blight resistance. Summary of the Invention

[0008] The key technical problem this invention aims to solve lies in revealing, through systematic research, the functions of two late blight pathogen virulence effector targets, chloroplast elongation factors StTuA and StTuB, in increasing potato yield and enhancing potato resistance to late blight and abiotic stress by promoting photosynthesis and synergistic signaling between chloroplasts and the cell nucleus. This provides key genes for high-yield, disease-resistant, and stress-resistant potato breeding. To solve the above technical problem, this invention adopts the following technical solution:

[0009] 1. Potato StTuA and StTuB genes, wherein the CDS region sequence of the StTuA gene is shown in SEQ ID No. 1 of the sequence listing; and the CDS region sequence of the StTuB gene is shown in SEQ ID No. 2 of the sequence listing; the StTuA and StTuB genes are derived from the diploid potato variety “DM1-3 516R44”.

[0010] 2. Potato StTuA and StTuB genes, wherein the CDS region sequence of the StTuA gene is shown in SEQ ID No. 3 of the sequence listing; and the CDS region sequence of the StTuB gene is shown in SEQ ID No. 4 of the sequence listing; the StTuA and StTuB genes are derived from the potato cultivar “E Potato No. 3”.

[0011] 3. Methods for cloning potato StTuA and StTuB genes and verifying interacting proteins, including: (1) cloning of StTuA and StTuB genes; (2) construction of yeast vectors; (3) screening of yeast libraries and point-to-point verification of interactions.

[0012] 4. Methods for verifying the function of potato StTuA and StTuB genes, including: (1) construction of plant overexpression vectors for StTuA and StTuB; (2) construction of plant interference expression vectors for StTuA and StTuB; (3) potato genetic transformation; (4) detection of transgenic positive lines; (5) detection of gene protein expression levels in transgenic lines.

[0013] 5. A vector comprising any one of the sequences listed in SEQ ID No. 1-4.

[0014] 6. Application of potato StTuA and StTuB to promote plant growth, wherein the CDS region of StTuA is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of StTuB is shown in SEQ ID No. 4 of the sequence listing.

[0015] 7. Application of potato StTuA and StTuB to significantly improve plant photosynthetic capacity, wherein the CDS region of StTuA is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of StTuB is shown in SEQ ID No. 4 of the sequence listing.

[0016] 8. Application of StTuA and StTuB in enhancing resistance to late blight in potatoes, wherein the CDS region of StTuA is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of StTuB is shown in SEQ ID No. 4 of the sequence listing.

[0017] 9. Application of the heat stress resistance of potato StTuA and StTuB, wherein the CDS region of StTuA is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of StTuB is shown in SEQ ID No. 4 of the sequence listing.

[0018] 10. Application of StTuA and StTuB in increasing potato tuber yield, wherein the CDS region of StTuA is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of StTuB is shown in SEQ ID No. 4 of the sequence listing.

[0019] Beneficial effects: This invention reports for the first time that overexpression of chloroplast elongation factor genes StTuA and StTuB in potatoes can increase photosynthesis, significantly increase potato tuber yield, and improve potato resistance to late blight and heat stress. Interference with StTuA and StTuB significantly reduces yield and decreases potato resistance to late blight. Attached Figure Description

[0020] Figure 1 This study aimed to verify the interaction between the yeast late blight effector Pi22926 and StTuA and StTuB in a point-to-point manner. The figure shows that StTuA and StTuB can interact with the late blight effector Pi22926, but not with another late blight effector, PiAVR2; Control represents the overall response, ++ represents a strong positive interaction, + represents a weak positive interaction, and - represents a negative control with no interaction.

[0021] Figure 2 This diagram illustrates the sequence alignment of StTuA / B and the construction of the interference vector. Figure A shows the comparison of the StTuA and StTuB gene sequences; Figure B shows the construction of the pHellsgate8 interference vector.

[0022] Figure 3 This is a positive detection result for transgenic lines. Figure A shows a schematic diagram of fluorescence detection in leaves of excessive transgenic lines fused with GFP tags (StTuA and StTuB), bar = 5 μm; Figure B shows a positive identification of the StTuA / B-RNAi interference line, with a positive band size of approximately 340 bp.

[0023] Figure 4 This section describes the detection of expression levels in transgenic potato plants. Figure A shows the expression of StTuA-GFP and StTuB-GFP proteins in the StTuA and StTuB overload transgenic lines fused with the GFP tag, detected using anti-GFP antibody. WT represents the transgenic control line, and the total protein loading in leaves was detected using Ponceau S (PS) staining. Figure B shows the expression levels in the StTuA / B-RNAi interference transgenic lines, where StTuA and StTuB specific primers were used to detect their respective expression levels.

[0024] Figure 5StTuA and StTuB promote potato growth and improve photosynthesis. Figure A shows a comparison of plant height between the StTuA / B-RNAi interference transgenic representative lines, the StTuA and StTuB over-transgenic representative lines, and the WT control material; Figure B shows the net photosynthetic rate of the StTuA / B-RNAi double interference transgenic lines, and the StTuA and StTuB over-transgenic lines.

[0025] Figure 6 To identify late blight resistance in overexpressed and interferent transgenic potatoes. A. Measurement and statistical analysis of lesion size after inoculation of StTuA / B-RNAi interferent transgenic lines; B. Statistical analysis of spore number after inoculation of StTuA / B-RNAi interferent transgenic lines; C. Schematic diagram of leaf lesion size after inoculation of StTuA / B-RNAi interferent transgenic lines; D. Measurement and statistical analysis of lesion size after inoculation of StTuA overexpressed transgenic lines; E. Statistical analysis of spore number after inoculation of StTuA overexpressed transgenic lines; F. Schematic diagram of leaf lesion size after inoculation of StTuA overexpressed transgenic lines; G. Measurement and statistical analysis of lesion size after inoculation of StTuB overexpressed transgenic lines; H. Statistical analysis of spore number after inoculation of StTuB overexpressed transgenic lines; I. Schematic diagram of leaf lesion size after inoculation of StTuB overexpressed transgenic lines.

[0026] Figure 7 The results show the performance of transgenic and control potato plants under heat stress. A. Growth status of transgenic and control plants after 90 days of growth, WT is the transgenic control plant, and OE-StTuA and OE-StTuB are overexpressing transgenic lines; B. Growth status of upper leaves of control and overexpressing transgenic plants.

[0027] Figure 8 StTuA and StTuB affect potato yield. A. Schematic diagram of yield per plant in StTuA-excess transgenic lines and yield per plant in WT control plants; B. Schematic diagram of yield per plant in StTuB-excess transgenic lines and yield per plant in WT control plants; C. Statistical analysis of average yield per plant in StTuA-excess transgenic lines and average yield per plant in WT control plants; D. Statistical analysis of average yield per plant in StTuB-excess transgenic lines and average yield per plant in WT control plants; E. Schematic diagram of yield per plant in StTuA / B-RNAi interference transgenic lines and yield per plant in WT control plants; F. Statistical analysis of average yield per plant in StTuA / B-RNAi interference transgenic lines and average yield per plant in WT control plants.

[0028] Figure 9 This is a diagram showing the gene sequences and encoded amino acids of StTuA and StTuB.

[0029] Figure 10This is a sequence comparison diagram of the StTuA gene of “DM1-3 516 R44” and “Emalushu No. 3”.

[0030] Figure 11 This is a sequence alignment diagram of the StTuB gene between “DM1-3 516 R44” and “Emalushu No. 3”. Specific implementation methods

[0031] Unless otherwise specified, the methods and apparatus used in the following embodiments of this invention are conventional methods and apparatus; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific implementation methods of this invention are described in detail below with reference to specific embodiments. Examples of these preferred embodiments are illustrated in the specific embodiments. It should also be noted that, in order to avoid obscuring the technical solution of this invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solution according to this invention are shown in the embodiments, while other details that are not closely related are omitted.

[0032] Example 1

[0033] This embodiment provides the potato StTuA and StTuB genes. The StTuA gene is indexed in GenBank as XM_006344416.2 (protein sequence number XP_006344478.1, potato genome sequencing material 'DM1-3 516R44'), and its transcript sequence is shown in SEQ ID No. 1. The StTuB gene is indexed in GenBank as XM_006347362.2 (protein sequence number XP_006347424.1, potato genome sequencing material 'DM1-3 516R44'), and its transcript sequence is shown in SEQ ID No. 2.

[0034] This embodiment also provides the StTuA and StTuB genes of the potato cultivar “E3” (abbreviated as E3). The CDS region sequence of the StTuA gene is shown in SEQ ID No. 3 of the sequence listing; the CDS region sequence of the StTuB gene is shown in SEQ ID No. 4 of the sequence listing.

[0035] Example 2

[0036] This embodiment provides a method for cloning potato StTuA and StTuB genes and verifying interacting proteins, including: screening a potato cDNA yeast library (Invitrogen) using the late blight pathogen effector PITG_22926 (Pi22926) (GenBank ID, XP_002901758.1). The yeast screening vector PITG_22926 was constructed according to the applicant's published literature (Renet al., 2019). Two interacting nuclear-encoded chloroplast elongation factors, StTuA (corresponding protein GenBank ID, XP_006344478.1) and StTuB (corresponding protein GenBank ID, XP_006347424.1), were identified. Subsequent yeast point-to-point experiments were used to verify the interaction between Pi22926 and StTuA and StTuB.

[0037] 1. Cloning of the StTuA and StTuB genes:

[0038] Amplification primers were designed based on the coding region sequences of StTuA (1434 bp) and StTuB (1434 bp):

[0039] attB1-StTuA-F:AAAAAGCAGGCTTCATGGCTTCAATTTCAGCAGC;

[0040] attB2-StTuA-R:AGAAAGCTGGGTCTCACTCAAGAATTTTCTGAATGACAC;

[0041] attB1-StTuB-F:AAAAAGCAGGCTTCATGGCTTCAATTTCAGCAGC;

[0042] attB2-StTuB-R:AGAAAGCTGGGTCTCATTCT AAGATTTTCTGAATAACACCA.

[0043] RNA extracted from in vitro seedlings of potato variety 'E3' (abbreviated as E3) was reverse transcribed into cDNA, which was then used as a template to amplify the full-length coding sequence (CDS) of the gene. The PCR reaction system consisted of: 2 μl (100 ng) template cDNA, 1 μl each of forward and reverse primers (10 μM), 1 μl (10 mM) dNTP Mix, 1 μl Phanta Max Super-Fidelity DNA Polymerase, 25 μl 2×Phanta Max Buffer, and sterile distilled water to a final volume of 50 μl. The reaction program was: 95℃ for 3 min; 95℃ for 20 s, 58℃ for 20 s, 72℃ for 90 s, 35 cycles; 72℃ for 10 min.

[0044] The obtained product was then used as a template and amplified with primers attB1-F: GGGGACAAGTTTGTACAAAAAAGCAGGCT; attB2-R: GGGGACCACTTTGTACAAGAAAGCTGGGT. The resulting PCR fragment was recovered using the Magen HiPure GelPure DNA Mini Kit.

[0045] 2. Yeast vector construction: Gene fragments were recovered and used with BP recombinase (GateGay BP Clonase™ II EnGymemix). Insert the entry vector pDOR221 to construct intermediate entry vectors pDOR221-StTuA and pDOR221-StTuB; then perform an LR recombination reaction (GateGay LRClonase II EnGyme mix, The inserted target gene was confirmed by sequencing. The sequences of the two genes and their encoded amino acid information are attached. Figure 9 .like Figure 10 and Figure 11 As shown, the StTuA sequence cloned by the applicant from 'Emashan 3' differs from the sequence with GenBank accession number XM_006344416.2 by 21 bases. The StTuB sequence differs from the sequence with GenBank accession number XM_006347362.2 by 12 bases.

[0046] 3. Interaction between yeast library screening and peer-to-peer validation:

[0047] Library screening and point-to-point validation were performed based on the applicant's published literature, Ren et al., 2019. Yeast transformed with pDEST32-Pi22926 and pDEST22-StTuA, and pDEST32-Pi22926 and pDEST22-StTuB plasmids grew on both SD-Leu-Trp and SD-Leu-Trp-His media, showing a blue color on β-Gal, similar to the positive control yeast. The negative control yeast (co-transformed with pDEST32-Pi22926+pDEST22-EV and pDEST32-PiAVR2+pDEST22-StTuA, pDEST32-PiAVR2+pDEST22-StTuB) grew on SD-Leu-Trp-His media but not on SD-Leu-Trp-His media, and did not show a blue color on β-Gal. Figure 1 ). Demonstrate the interaction between Pi22926 and StTuA and StTuB in yeast ( ). Figure 1 ).

[0048] Example 3

[0049] This embodiment provides a method for validating the function of potato StTuA and StTuB genes, including:

[0050] 1. Construction of StTuA and StTuB plant overexpression vectors

[0051] The primers for overexpression vector amplification are designed as follows:

[0052] lic-StTuA-F:5'-TGAGCCACCATGGCTGGATCCATGGCTTCAATTTCAGCAGC;

[0053] lic-StTuA-R:5'-CTTGCTCACCATCCGCTCGAGCTCAAGAATTTTCTGAATGACACC;

[0054] lic-StTuB-F:5'-TGAGCCACCATGGCTGGATCCATGGCTTCAAT TTCAGCAGC;

[0055] lic-StTuB-R:5'-CTTGCTCACCATCCGCTCGAGTTCTAAGATTTTCTGAATA ACACCAGC.

[0056] Yeast plasmids pDEST22-StTuA and pDEST22-StTuB were used as templates for amplification. Gene fragments were recovered using homologous recombinase (ClonExpress II One Step Cloning Kit). The target gene was successfully constructed by inserting it into the Agrobacterium plant expression vector pH7lic-C-GFP. The insertion was confirmed by DH5α transformation of *E. coli*, PCR detection, and sequencing. The target gene was then fused with green fluorescent protein (GFP) into the plasmids pH7lic-StTuA-GFP and pH7lic-StTuB-GFP (hereinafter referred to as StTuA-GFP and StTuB-GFP) via electroporation into *Agrobacterium* GV3101 for later use. After adding 15% glycerol, the plasmids were stored at -70℃ for use.

[0057] 2. Construction of plant interference expression vectors for StTuA and StTuB: Clustax software was used to compare and analyze the gene sequences of StTuA and StTuB, revealing high homology between them. Figure 2 A). Using the NCBI website, a specific 255bp fragment suitable for constructing the StTuA and StTuB dual interference vector was found in the StTuB gene sequence, named StTuA / B-RNAi, and two sets of primers were designed:

[0058] RNAi-XhoI-F:5'-TTTGGAGAGGACACGCTCGAGGAGCTGCGCGTGGTAAATTC;

[0059] RNAi-XhoI-R:5'-TGGGGTACCGAATTCCTCGAGGACCAGGGCAATCCACATGA.

[0060] RNAi-XbaI-F:5'-GATAAGCTTGGATCCTCTAGAGACCAGGGCAATCCACATGA;

[0061] RNAi-XbaI-R:5'-TCATTAAAGCAGGACTCTAGAGAGCTGCGTGTGGTAAATTC.

[0062] PCR amplification was performed using the StTuB-GFP plasmid as a template. After obtaining the target fragment, the fragment was constructed into the Agrobacterium tumefaciens interference vector pHellsgate8 using two homologous recombination methods, resulting in the interference vector pHellsgate8-StTuA / B-RNAi. Figure 2B). The interference vector was transferred into Agrobacterium GV3101 via electroporation. After adding 15% glycerol, it was stored at -70°C until use.

[0063] 3. Genetic transformation of potatoes

[0064] Leaves from test-tube seedlings of the potato variety 'Dèsirèe' were used as explants. The transformation method was Agrobacterium-mediated transformation. Leaves were cultured in the dark in Agrobacterium solution for 2 days; after the bacterial solution was blotted dry with filter paper, they were cultured on callus induction medium P1 (back side up) for 1 week; resistant shoots were cultured on selection medium P2. When the resistant shoots on the selection medium (containing kanamycin, kan) grew to a length greater than 0.5 cm, they were cut and transferred to rooting medium P3 containing the selection antibiotic (kan) + cephalosporin (Cef) + termethim (Tim) for rooting culture, ultimately obtaining complete plants. The potato transgenic culture media are shown in Table 1.

[0065] Table 1. Potato transgenic culture medium

[0066]

[0067] 4. Detection of transgenic positive strains:

[0068] (1) Transgenic materials overexpressing StTuA-GFP and StTuB-GFP were labeled with GFP fluorescence. The positivity was first detected using a fluorescence microscope. Representative images are shown below. Figure 3 As shown in Figure A, GFP is the tag carried by the vector, which can indicate the localization of StTuA and StTuB; Chlorophyll is the autofluorescence of chloroplasts. Merge indicates that GFP and chloroplast autofluorescence have common localization, proving that both StTuA-GFP and StTuB-GFP proteins are normally expressed in chloroplasts.

[0069] (2) The positive rate of the StTuA / B-RNAi interference lines was detected by DNA extraction using the CTAB method. One to two leaflets from the seedlings to be tested were cut into 2ml centrifuge tubes containing steel balls for DNA extraction in a clean bench. After DNA extraction, the extracted DNA was used as a template for PCR detection of transgenic lines. The vector primer 35S-F: 5'-GACGCACAATCCCACTATCC-3' was used, and the reverse primer was the gene-specific primer: StTuA / B-RNAi-R: 5'-GACCAGGGCAATCCACATGA-3'. PCR amplification was performed, and electrophoresis revealed five transgenic plants (lines 1, 2, 7, 23, and 45). Line 27 did not contain the inserted gene fragment, and no related fragment was detected in the negative control WT, confirming the reliability of the results. Figure 3 B).

[0070] 5. Detection of gene protein expression levels in transgenic lines:

[0071] Expression level detection was conducted one month after the test-tube seedlings were transplanted into the greenhouse.

[0072] (1) Detection of protein expression in overexpression transgenic lines

[0073] Two small discs were obtained from the plants to be tested using a 1 cm diameter punch and placed in 2 ml centrifuge tubes containing steel balls for protein extraction. Three samples were taken from each material. Western blot was used to detect the expression levels of the overexpressing transgenic lines. Since the GFP gene was fused after the target gene, an anti-GFP antibody was used for hybridization. Obvious protein bands were detected in lines 7, 8, 10, and 2 of OE-StTuA, and lines 8, 12, 18, and 13 of OE-StTuB, demonstrating that the exogenously introduced StTuA-GFP and StTuB-GFP proteins were normally expressed in potatoes. Figure 4 A).

[0074] (2) Detection of gene interference efficiency in transgenic lines

[0075] Two small discs were obtained from the plants to be tested using a 1cm diameter punch and placed in 2ml centrifuge tubes containing steel balls for RNA extraction. Three samples were taken from each material. The expression levels of StTuA and StTuB dual-interference transgenic lines were detected using qPCR. Total RNA was extracted from transgenic and control plants using a plant RNA rapid extraction kit (Zhuangmeng). Then, cDNA was generated by reverse transcription using RT MasterMix Gith AccuRT (abm). Quantitative PCR was performed using BlasTaq™ 2X qPCR MasterMix (abm) reagent, with StEf1α as the internal reference gene (Ef1α-F 5'-ATTGGAAACGGATATGCTCCA-3', Ef1α-R: 5'-TCCTTACCTGAACGCCTGTCA-3'). Real-time PCR was performed using StTuA-specific primers (qRT-StTuA-F: 5'-AGAACCGACACTATGCCCAC-3', qRT-StTuA-R: 5'-CCACCATGTTAGGGACACCC-3') and StTuB-specific primers (qRT-StTuB-F: 5'-CCAATGCCGCAGACTAAGGA-3', qRT-StTuB-R: 5'-AAGGGCAGACCCACAATGAA-3'). -△△Ct Data analysis was performed. Results showed that the expression levels of StTuA and StTuB were significantly decreased in the five interfering transgenic plants. Figure 4B).

[0076] Example 4

[0077] This embodiment provides the application of StTuA and StTuB in promoting plant growth in potatoes, including:

[0078] Transgenic potatoes from the above-described embodiments, along with transgenic and wild-type control potatoes of the same size and with good germination, were planted in pots filled with nutrient soil inside a plastic greenhouse. After germination, the seedlings were thinned, retaining two main branches. Plant growth was observed under the same water, fertilizer, and light management conditions. One month after planting, significant differences in plant growth were observed. Measurements of the above-ground plant height revealed that the transgenic materials overexpressing StTuA and StTuB were significantly taller than the control, while the StTuA / B-RNAi interference line was significantly shorter. Figure 5 A). This indicates that StTuA and StTuB promoted potato plant height growth.

[0079] Example 5

[0080] This embodiment provides the application of StTuA and StTuB in potatoes to significantly improve the photosynthetic capacity of the plants, including:

[0081] The photosynthetic rate of the transgenic potato plants described in the above examples was measured. On sunny mornings from 8:00 to 10:00, a portable photosynthesis meter (LI-6400XT, LI-COR, USA) was used to measure the photosynthetic rate of the third fully expanded compound leaf from the top of the plant. Seven to nine leaves were measured for each line for statistical analysis. The results showed that the photosynthetic rate of the StTuA and StTuB transgenic lines was significantly higher than that of the control material, while the photosynthetic rate of the StTuA / B-RNAi interference line was lower than that of the control. Figure 5 B). This indicates that overexpression of StTuA and StTuB significantly increases photosynthesis in potato leaves.

[0082] Example 6

[0083] This embodiment provides the application of StTuA and StTuB in potatoes to improve resistance to late blight, including:

[0084] Fully expanded upper leaves from healthy 6-7 week old transgenic potato plants described in the above examples were used for late blight resistance identification. The late blight strain was 88069. The plants were first cultured in the dark at 20°C for 2 weeks on oat medium. Before inoculation, the sporangia on the medium were washed off with sterile water, and the sporangia concentration was adjusted to 70-80 sporangia / μl. The plants were then placed at 4°C for 2 hours to release zoospores. At least 10 leaves were used per line each time (three replicates). The leaves were laid flat in an inoculation box with the underside facing up, in a container lined with absorbent paper (pre-moistened with a spray bottle to maintain a humidity of 70%-80%). 10 μl of bacterial suspension was then pipetted onto the underside of the leaves. After inoculation, the leaf surface was gently sprayed with water, and the box was sealed to maintain humidity. On the first day after inoculation, the plants were kept in the dark at 20°C under a light / dark cycle of 16h / 8h. The diameter of the lesions was measured and photographed on days 5-6. Spores were washed off the leaves with 3 ml of ddH2O, and the spore count was determined using a hemocytometer. Statistical data was analyzed and plotted using GraphPad software. The results are as follows: Figure 6 As shown, the lesion area and spore number of the two StTuA / B-RNAi interference transgenic lines were significantly larger than those of the control. Figure 6 (A, B, C), while the lesion area and spore number of the StTuA and StTuB over-transgenic lines were significantly smaller than those of the control (A, B, C). Figure 6 (DI) demonstrates that StTuA and StTuB regulate potato late blight resistance, and overexpression can significantly improve potato late blight resistance.

[0085] Example 7

[0086] This embodiment provides applications of the heat stress resistance of potato StTuA and StTuB, including:

[0087] Transgenic potato tubers from the above-described examples and control potatoes were planted in pots filled with nutrient soil in a plastic greenhouse in late February. Initially, the temperature was suitable for potato growth. From late May to early June, the daytime temperature inside the greenhouse consistently reached 30℃-40℃, placing the potatoes under significant heat stress. The plants grew for approximately 90 days. With sufficient water, both transgenic and control potato plants exhibited varying degrees of leaf senescence and yellowing due to the high-temperature stress during the later stages of growth. Observations revealed that the transgenic lines overexpressing StTuA and StTuB maintained strong vitality during the high-temperature and physiological senescence period, with some leaves remaining bright green and the plants growing normally. In contrast, the control materials showed extensive yellowing of leaves, indicating severe senescence. Figure 7 This indicates that overexpression of StTuA and StTuB enhances the potato's resistance to heat stress, consistent with the findings reported in Arabidopsis thaliana regarding the involvement of AtEF-Tu in heat stress.

[0088] Example 8

[0089] This embodiment provides applications of StTuA and StTuB in increasing potato tuber yield, including:

[0090] In the above embodiment, after the transgenic potato plants have grown for approximately 100 days, watering is stopped, and the potato tubers are harvested after the soil has dried. At harvest, each transgenic line has 5-6 pots. The tubers harvested from each pot are individually bagged and placed in a cool, well-ventilated place to dry. After removing surface soil and debris from the tubers, the weight of each tuber is measured using an electronic scale (accuracy 0.01g), and the data for each line is statistically analyzed using GraphPad software.

[0091] Statistical results showed that under greenhouse pot cultivation conditions, the average tuber weight per plant in the control group was approximately 516 grams, while the average tuber weight per plant in StTuA transgenic lines 7, 8, and 10 was approximately 555 grams, 697 grams, and 822 grams, respectively. The average tuber weight per plant in the StTuA-8 and StTuA-10 over-yield transgenic lines was significantly higher than the control, with the StTuA-10 line showing a yield increase of approximately 59% compared to the control. The average tuber weight per plant in the StTuB transgenic lines 8, 12, and 18 was approximately 607 grams, 780 grams, and 834 grams, respectively. The average tuber weight per plant in the StTuB-12 and StTuB-18 over-yield transgenic lines was significantly higher than the control, with the StTuB-18 over-yield transgenic line showing a yield increase of 62% compared to the control. However, the average tuber weight per plant in the StTuA / B-RNAi interference transgenic lines was significantly lower than the control, only 20-40% of the control's. Figure 8 The above results indicate that overexpression of StTuA and StTuB significantly increases potato tuber yield.

[0092] The above description is only a specific embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this application, and these improvements and modifications should also be considered within the scope of protection of this application.

[0093] References:

[0094] I.Serrano,C.Audran,S.Rivas,Chloroplasts at Gork during plant innateimmunity,J Exp Bot 67(2016)3845-3854.

[0095] JDJones,JLDangl,The plant immune system,Nature 444(2006)323-329.

[0096] J.L.Caplan,A.S.Kumar,E.Park,M.S.Padmanabhan,K.Hoban,S.Modla,K.CGymmek,S.P.Dinesh-Kumar,Chloroplast Stromules Function during InnateImmunity,Dev Cell 34(2015)45-57.

[0097] J.M.Zhou,Y.Zhang,Plant Immunity:Danger Perception and Signaling,Cell181(2020)978-989.

[0098] K.Dahal,S.M.WeraduGage,K.Kane,S.A.Rauf,E.D.Leonardos,W.Gadapati,L.Savitch,J.Singh,E.-F.Marillia,D.C.Taylor,M.C.Micallef,V.KnoGles,W.Plaxton,J.Barron,F.Sarhan,N.Hüner,B.GrodGinski,B.J.Micallef,Enhancing biomassproduction and yield by maintaining enhanced capacity for CO2 uptake inresponse to elevated CO2,Canadian Journal of Plant Science 94(2014)1075-1083.

[0099] K.Dahal,X.Q.Li,H.Tai,A.Creelman,B.BiGimungu,Improving Potato StressTolerance and Tuber Yield Under a Climate Change Scenario-A Current OvervieG,Front Plant Sci 10(2019)563.

[0100] L.Cai,Z.Liu,L.Cai,X.Yan,Y.Hu,B.Hao,Z.Xu,Y.Tian,X.Liu,L.Liu,L.Jiang,S.Zhou,J.Wan,Nuclear encoded elongation factor EF-Tu is required forchloroplast development in rice groGn under loG-temperature conditions,JGenet Genomics(2021).

[0101] M.Kretschmer,D.Damoo,A.Djamei,J.Kronstad,Chloroplasts and PlantImmunity:Where Are the Fungal Effectors?Pathogens 9(2019).

[0102] M.Warias,H.Grubmüller,L.V.Bock,tRNA Dissociation from EF-Tu after GTPHydrolysis:Primary Steps and Antibiotic Inhibition,Biophysical Journal 118(2020)151-161.

[0103] M.A.Parry,M.Reynolds,M.E.Salvucci,C.Raines,P.J.Andralojc,X.G.Zhu,G.D.Price,A.G.Condon,R.T.Furbank,Raising yield potential ofGheat.II.Increasing photosynthetic capacity and efficiency,J Exp Bot 62(2011)453-467.

[0104] S.Liu,L.Zheng,J.Jia,J.Guo,M.Zheng,J.Zhao,J.Shao,X.Liu,L.An,F.Yu,Y.Qi,Chloroplast Translation Elongation Factor EF-Tu / SVR11 Is Involved in var2-Mediated Leaf Variegation and Leaf Development in Arabidopsis,Front Plant Sci10(2019)295.

[0105] S.P.Long,A.Marshall-Colon,X.G.Zhu,Meeting the global food demand ofthe future by engineering crop photosynthesis and yield potential,Cell 161(2015)56-66.

[0106] X.Li,C.Cai,Z.Wang,B.Fan,C.Zhu,Z.Chen,Plastid Translation ElongationFactor Tu Is Prone to Heat-Induced Aggregation Despite Its Critical Role inPlant Heat Tolerance,Plant Physiol 176(2018)3027-3045.

[0107] X.Li,P.Kapos,Y.Zhang,NLRs in plants,Curr Opin Immunol 32(2015)114-121.

[0108] Y.Yang,Y.Zhao,Y.Zhang,L.Niu,W.Li,W.Lu,J.Li,P.Schafer,Y.Meng,W.Shan,Amitochondrial RNA processing protein mediates plant immunity to a broadspectrum of pathogens by modulating the mitochondrial oxidative burst,PlantCell 34(2022)2343-2363.

[0109] Y.Ren,M.Armstrong,Y.Qi,H.McLellan,C.Zhong,B.Du,P.R.J.Birch,Z.Tian,Phytophthora infestans RXLR Effectors Target Parallel Steps in an ImmuneSignal Transduction PathGay,Plant Physiol 180(2019)2227-2239。

Claims

1. Application of potato StTuA and StTuB genes to enhance potato resistance to late blight and heat stress, wherein the CDS region of the StTuA gene is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of the StTuB gene is shown in SEQ ID No. 4 of the sequence listing.

2. Application of the potato StTuA and StTuB genes to improve potato tuber yield, wherein the CDS region of the StTuA gene is shown in SEQ ID No. 3 of the sequence listing; and the CDS region of the StTuB gene is shown in SEQ ID No. 4 of the sequence listing.

Citation Information

Patent Citations

  • Plants having increased yield and method for making the same

    CN101128589A

  • Sweet potato gene copy number detection method and application thereof

    CN119530442A