Lipid compounds and lipid nanoparticle compositions

Abstract

Provided herein are lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-bound lipids, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules) for therapeutic or preventive purposes, including vaccination. Also provided herein are lipid nanoparticle compositions comprising the lipid compounds.

Description

[0001] 1. Cross-reference to related applications

[0002] This application claims priority to International Patent Application No. PCT / CN2021 / 095520 filed on May 24, 2021, International Patent Application No. PCT / CN2021 / 122704 filed on October 8, 2021, Chinese Patent Application No. CN202210010389.2 filed on January 6, 2022, and International Patent Application No. PCT / CN2022 / 071251 filed on January 11, 2022, and the entire contents of each case are incorporated herein by reference.

[0003] 2. Sequence Listing

[0004] This specification is filed with a copy of the computer readable form (CRF) of the sequence listing. The CRF, named 14639-007-228_SeqListing_ST25.txt, created on May 18, 2021 and 627 bytes in size, is incorporated herein by reference in its entirety. 3. Technical Field

[0006] The present disclosure generally relates to lipid compounds that can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-bound lipids, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholinos) in vitro and in vivo for therapeutic or preventive purposes, including vaccination. Lipid compounds can be used in combination with other lipid components, such as neutral lipids, cholesterol, and polymer-bound lipids, to form lipid nanoparticles for delivering therapeutic agents. There is a need to develop new lipid compounds (e.g., cationic lipid compounds) that provide effective delivery of therapeutic agents, sufficient activity of the therapeutic agent (e.g., expression of mRNA after delivery), optimal pharmacokinetics, and / or other suitable physiological, biological, and / or therapeutic properties. 4. Background of the Invention

[0008] Therapeutic nucleic acids have the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other treatments for genetic diseases. Since the first clinical studies of therapeutic nucleic acids began in the 2000s, significant progress has been made in the design of nucleic acid molecules and their delivery methods. However, nucleic acid therapeutics still face several challenges, including low cellular permeability and high sensitivity to degradation by certain nucleic acid molecules, including RNA. Therefore, there remains a need to develop new nucleic acid molecules, as well as related methods and compositions that facilitate the in vitro or in vivo delivery of nucleic acid molecules for therapeutic and / or preventive purposes. 5. Summary of the Invention

[0010] In one embodiment, provided herein are lipid compounds, including pharmaceutically acceptable salts, prodrugs or stereoisomers thereof, which can be used alone or in combination with other lipid components, such as neutral lipids, charged lipids, steroids (including, for example, all sterols) and / or their analogs and / or polymer-bound lipids and / or polymer combinations, to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino nucleic acids). In some cases, the lipid nanoparticles are used to deliver nucleic acids, such as antisense and / or messenger RNA. Also provided are methods for treating various diseases or illnesses using such lipid nanoparticles, such as diseases or illnesses caused by infectious agents and / or protein deficiencies.

[0011] In one embodiment, the lipid compounds provided herein are substituted glycerolamine (3-aminopropane-1,2-diol) based lipid compounds.

[0012] In one embodiment, provided herein is a compound of formula (I):

[0013]

[0014] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 1 , G 2 , G 3 、L 1 、L 2 、R 0 、R 4 、R 5 and s are as defined herein or elsewhere.

[0015] In one embodiment, provided herein is a compound of formula (II):

[0016]

[0017] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 1 , G 2 , G 3 、L 1 、L 2 , Y and R 3 As defined herein or elsewhere.

[0018] In one embodiment, provided herein is a compound of formula (III):

[0019]

[0020] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 3 , G 4 、R 0 、R 1 、R 2 and R 3 As defined herein or elsewhere.

[0021] In one embodiment, provided herein is a nanoparticle composition comprising a compound provided herein and a therapeutic or prophylactic agent. In one embodiment, the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.

[0022] Additional features of the present disclosure will become apparent to those skilled in the art after considering the following detailed description of specific embodiments. 6. Specific Implementation Methods

[0024] 6.1 General Technology

[0025] The techniques and procedures described or referenced herein include those generally well understood and / or commonly employed by those skilled in the art using routine methods, such as the widely used methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molecular Biology (Ausubel et al., eds., 2003).

[0026] 6.2 Terminology

[0027] Unless otherwise described, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. For the purpose of interpreting this specification, the following terminology will be applied, and where appropriate, terms used in the singular will also include the plural form, and vice versa. All patents, applications, published applications and other publications are incorporated by reference in their entirety. If any description of a term set forth conflicts with any document incorporated herein by reference, the term description set forth below shall prevail.

[0028] As used herein and unless otherwise indicated, the term "lipid" refers to a group of organic compounds that include, but are not limited to, fatty acid esters and are generally characterized by being poorly soluble in water but soluble in many non-polar organic solvents. Although lipids generally have poor water solubility, certain classes of lipids (e.g., lipids modified with polar groups, such as DMG-PEG2000) have limited water solubility and are soluble in water under certain conditions. Known lipid types include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three categories: (1) "simple lipids," which include fats and oils, as well as waxes; (2) "complex lipids," which include phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derivatized lipids," such as steroids. In addition, as used herein, lipids also include lipid-like compounds. The term "lipid-like compound," also referred to as "lipidoid," refers to lipid-like compounds (e.g., amphiphilic compounds with lipid-like physical properties).

[0029] The term "lipid nanoparticle" or "LNP" refers to a particle with at least one nanometer (nm) size (e.g., 1 to 1,000 nm) containing one or more types of lipid molecules. The LNP provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule partially or completely encapsulated in a lipid shell. Specifically, in some embodiments, the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is expected that cationic lipids can interact with negatively charged payload molecules and promote the incorporation and / or encapsulation of payload into the LNP during LNP formation. Other lipids that can form a part of an LNP as provided herein include, but are not limited to, neutral lipids and charged lipids, such as steroids, polymer-bound lipids, and various zwitterionic lipids. In certain embodiments, LNP according to the present disclosure comprises a lipid of one or more formulas (I), (II), or (III) (and subformulas thereof) as described herein.

[0030] The term "cationic lipid" refers to a lipid that is positively charged at any pH value or hydrogen ion activity of its environment, or can be positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use). Therefore, the term "cationic lipid" encompasses "permanent cations" and "cationizable". In certain embodiments, the positive charge in the cationic lipid is derived from the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment of its intended use (e.g., at physiological pH). In certain embodiments, the cationic lipid is a lipid of one or more formulas (I), (II) or (III) (and subformulas thereof) as described herein.

[0031] The term "polymer-bound lipid" refers to a molecule comprising both a lipid portion and a polymer portion. An example of a polymer-bound lipid is a pegylated lipid (PEG-lipid), wherein the polymer portion comprises polyethylene glycol.

[0032] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or in a neutral zwitterionic form at a selected pH value or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the environment of the intended lipid use, such as physiological pH. As non-limiting examples, neutral lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylcholines, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC); phosphatidylethanolamines, such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl))dimethylammonio)ethyl hydrogenphosphate (DOCP); sphingomyelin (SM); ceramides; steroids, such as sterols and their derivatives. The neutral lipids provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0033] The term "charged lipid" encompasses any lipid molecule that exists in a positively charged or negatively charged form at a selected pH value or within a selected pH range. In some embodiments, the selected pH value or range corresponds to the pH conditions in the environment of a predetermined lipid use, such as physiological pH. As a non-limiting example, the neutral lipids that can be used in conjunction with the present disclosure include but are not limited to phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (such as DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethanecarbamoylsterol (such as DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-racemic-glycerol) sodium salt (DOPG-Na) and 1,2-dioleoyl-sn-glycero-3-phospho-sodium salt (DOPA-Na). The charged lipids provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0034] As used herein and unless otherwise indicated, the term "alkyl" refers to a saturated straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms. In one embodiment, an alkyl group has, for example, one to twenty-four carbon atoms (C1-C 24 alkyl), four to twenty carbon atoms (C4-C 20 Alkyl), six to sixteen carbon atoms (C6-C 16 alkyl), six to nine carbon atoms (C6-C9 alkyl), one to fifteen carbon atoms (C1-C 15 alkyl), one to twelve carbon atoms (C1-C 12 Alkyl groups are alkyl groups (C1-C8 alkyl), one to eight carbon atoms (C1-C8 alkyl), or one to six carbon atoms (C1-C6 alkyl) and are attached to the rest of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise specified, alkyl groups are optionally substituted.

[0035] As used herein and unless otherwise indicated, the term "alkenyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds. As will be appreciated by those of ordinary skill in the art, the term "alkenyl" also encompasses groups having "cis" and "trans" configurations, or groups having "E" and "Z" configurations. In one embodiment, an alkenyl group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), four to twenty carbon atoms (C4-C 20 alkenyl), six to sixteen carbon atoms (C6-C 16alkenyl), six to nine carbon atoms (C6-C9 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 The term "alkenyl" refers to a group consisting of two to eight carbon atoms (C-C alkenyl), two to eight carbon atoms (C-C alkenyl), or two to six carbon atoms (C-C alkenyl), and is connected to the rest of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, vinyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. Unless otherwise indicated, alkenyl groups are optionally substituted.

[0036] As used herein and unless otherwise indicated, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing one or more carbon-carbon triple bonds. In one embodiment, an alkynyl group has, for example, two to twenty-four carbon atoms (C2-C 24 Alkynyl), four to twenty carbon atoms (C4-C 20 Alkynyl), six to sixteen carbon atoms (C6-C 16 Alkynyl), six to nine carbon atoms (C6-C9 alkynyl), two to fifteen carbon atoms (C2-C 15 Alkynyl), two to twelve carbon atoms (C2-C 12 Alkynyl groups are substituted with two to eight carbon atoms (C2-C8 alkynyl) or two to six carbon atoms (C2-C6 alkynyl) and are attached to the rest of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise specified, alkynyl groups are optionally substituted.

[0037] As used herein and unless otherwise indicated, the term "alkylene" or "alkylene chain" refers to a straight or branched multivalent (e.g., divalent or trivalent) hydrocarbon chain that connects the rest of the molecule to a group (or groups), consisting solely of carbon and hydrogen and being saturated. In one embodiment, an alkylene group has, for example, one to twenty-four carbon atoms (C1-C 24 Alkylene), one to fifteen carbon atoms (C1-C 15 Alkylene), one to twelve carbon atoms (C1-C 12 C1-C8 alkylene), one to eight carbon atoms (C1-C8 alkylene), one to six carbon atoms (C1-C6 alkylene), two to four carbon atoms (C2-C4 alkylene), one to two carbon atoms (C1-C2 alkylene). Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is attached to the rest of the molecule via a single bond and to the radical group via a single bond. The point of attachment of the alkylene chain to the rest of the molecule and to one or more radical groups may be through one carbon or any two (or more) carbons within the chain. Unless otherwise indicated, the alkylene chain is optionally substituted.

[0038] As used herein and unless otherwise indicated, the term "alkenylene" refers to a straight or branched multivalent (e.g., divalent or trivalent) hydrocarbon chain that connects the remainder of the molecule to a group (or groups) consisting solely of carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, an alkenylene group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 Alkenylene is a 1- to 2-carbon group, 1- to 4-carbon group, 1- to 6-carbon group, 1- to 8-carbon group (C-C-alkenylene), 2- to 6-carbon group (C-C-alkenylene), or 2- to 4-carbon group (C-C-alkenylene). Examples of alkenylene groups include, but are not limited to, vinylene, propenylene, n-butenyl, and the like. Alkenylene groups are attached to the rest of the molecule via a single or double bond and to the radical group via a single or double bond. The points of attachment of an alkenylene group to the rest of the molecule and to one or more radical groups may be through one carbon or any two (or more) carbons within the chain. Unless otherwise indicated, an alkenylene group is optionally substituted.

[0039] As used herein and unless otherwise indicated, the term "cycloalkyl" refers to a non-aromatic, saturated monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms. Unless otherwise indicated, a cycloalkyl radical is optionally substituted. A cycloalkyl radical may include fused or bridged ring systems. In one embodiment, a cycloalkyl radical has, for example, 3 to 15 ring carbon atoms (C3-C 15 cycloalkyl), 3 to 10 ring carbon atoms (C3-C 10 The cycloalkyl radical is a cycloalkyl radical having 3 to 8 ring carbon atoms (C3-C8 cycloalkyl). The cycloalkyl radical is connected to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decahydronaphthyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, and the like. Unless otherwise indicated, cycloalkyl radicals are optionally substituted.

[0040] As used herein, and unless otherwise specified, the term "cycloalkylene" is a multivalent (e.g., divalent or trivalent) cycloalkyl group. Unless otherwise specified, a cycloalkylene group is optionally substituted.

[0041] As used herein and unless otherwise indicated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms and including one or more carbon-carbon double bonds. Cycloalkenyl groups may include fused or bridged ring systems. In one embodiment, a cycloalkenyl group has, for example, 3 to 15 ring carbon atoms (C3-C 15 cycloalkenyl), 3 to 10 ring carbon atoms (C3-C 10The cycloalkenyl group is a cycloalkyl group (C-C) or 3 to 8 ring carbon atoms (C-C). The cycloalkenyl group is connected to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise indicated, the cycloalkenyl group is optionally substituted.

[0042] As used herein, and unless otherwise specified, the term "cycloalkenylene" is a multivalent (e.g., divalent or trivalent) cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.

[0043] As used herein and unless otherwise indicated, the term "heterocyclyl" refers to a non-aromatic monocyclic or polycyclic moiety containing one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl group may be attached to the main structure at any heteroatom or carbon atom. The heterocyclyl group may be a monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring system, wherein the polycyclic ring system may be a fused, bridged, or spirocyclic ring system. The heterocyclyl polycyclic ring system may contain one or more heteroatoms in one or more rings. The heterocyclyl group may be saturated or partially unsaturated. Saturated heterocycloalkyl groups may be referred to as "heterocycloalkyl." Partially unsaturated heterocycloalkyl groups may be referred to as "heterocycloalkenyl" when the heterocyclyl group contains at least one double bond, or as "heterocycloalkynyl" when the heterocyclyl group contains at least one triple bond. In one embodiment, the heterocyclyl group has, for example, 3 to 18 ring atoms (3 to 18-membered heterocyclyl), 4 to 18 ring atoms (4 to 18-membered heterocyclyl), 5 to 18 ring atoms (3 to 18-membered heterocyclyl), 4 to 8 ring atoms (4 to 8-membered heterocyclyl), or 5 to 8 ring atoms (5 to 8-membered heterocyclyl). When appearing herein, a numerical range such as "3 to 18" refers to each integer in the given range; for example, "3 to 18 ring atoms" means that the heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc. (up to and including 18 ring atoms). Examples of heterocyclic groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furanyl, tetrahydrofuranyl, thienyl, pyridyl, piperidyl, quinolyl, and isoquinolyl. Unless otherwise indicated, heterocyclic groups are optionally substituted. Unless otherwise indicated, heterocyclic groups are optionally substituted.

[0044] As used herein, and unless otherwise specified, the term "heterocyclylene" is a polyvalent (e.g., divalent or trivalent) heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted.

[0045] As used herein and unless otherwise indicated, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl group has 6 to 18 ring carbon atoms (C6-C 18 aryl), 6 to 14 ring carbon atoms (C6-C 14 aryl) or 6 to 10 ring carbon atoms (C6-C 10 Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthracenyl, phenanthrenyl, pyrenyl, biphenyl, and terphenyl. The term "aryl" also refers to bicyclic, tricyclic, or other polycyclic hydrocarbon rings in which at least one ring is aromatic and the other rings may be saturated, partially unsaturated, or aromatic, such as dihydronaphthyl, indenyl, dihydroindenyl, or tetrahydronaphthyl (tetralinyl). Unless otherwise specified, aryl groups are optionally substituted.

[0046] As used herein, and unless otherwise specified, the term "arylene" is a multivalent (eg, divalent or trivalent) aromatic group. Unless otherwise specified, an arylene group is optionally substituted.

[0047] As used herein and unless otherwise indicated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from O, S, and N. The heteroaryl group can be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, the heteroaryl group has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to a bicyclic, tricyclic, or other polycyclic ring, wherein at least one ring is an aromatic ring, and the other rings can be saturated, partially unsaturated, or aromatic rings, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. The example of monocyclic heteroaryl includes but is not limited to pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl and triazinyl. The example of bicyclic heteroaryl includes but is not limited to indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolyl, tetrahydroisoquinolyl, isoquinolyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromone radical, coumarin base, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl and tetrahydroquinolyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl.Unless otherwise specified, heteroaryl groups are optionally substituted.

[0048] As used herein, and unless otherwise specified, the term "heteroarylene" is a polyvalent (eg, divalent or trivalent) heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.

[0049] When a group described herein is referred to as "substituted," it may be substituted with one or more suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: halogen atoms, such as F, Cl, Br, or I; cyano; oxo (=O); hydroxyl (-OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=O)OR'; -O(C=O)R'; -C(=O)R'; -OR'; -S(O) x R';-S-SR';-C(=O)SR';-SC(=O)R';-NR'R';-NR'C(=O)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) x NR'R';-NR'S(O) x R'; and -S(O) x NR'R', wherein: R' is independently H, C1-C 15 alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments, the substituent is C1-C 12 In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as a fluoro group. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').

[0050] As used herein, and unless otherwise indicated, the term "optionally" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally substituted alkyl" means that the alkyl group may or may not be substituted, and that the description includes both substituted alkyl groups and alkyl groups without substitution.

[0051] As used herein and unless otherwise indicated, the term "prodrug" of a biologically active compound refers to a compound that can be converted into a biologically active compound under physiological conditions or by solvolysis. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. When a prodrug is administered to a subject in need, the prodrug may be inactive, but is converted into a biologically active compound in vivo. Prodrugs typically rapidly transform in vivo to produce the parent biologically active compound, for example, by hydrolysis in the blood. Prodrug compounds generally provide advantages of solubility, tissue compatibility or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, pp. 21-24 (Elsevier, Amsterdam)). A discussion of prodrugs is provided in Higuchi, T. et al., ACS Symposium Series, Vol. 14; and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

[0052] In one embodiment, the term "prodrug" is also intended to include any covalently bonded carriers that release the active compound in vivo when such prodrugs are administered to a mammalian subject. Prodrugs of a compound can be prepared by modifying functional groups present in the compound in such a way that the modifications can be cleaved during routine manipulation or in vivo to yield the parent compound. Prodrugs include compounds in which a hydroxyl, amino, or sulfhydryl group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, cleaves to form a free hydroxyl, free amino, or free sulfhydryl group, respectively.

[0053] Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.

[0054] As used herein, and unless otherwise indicated, the term "pharmaceutically acceptable salt" includes both acid addition salts and base addition salts.

[0055] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, benzo ... acid), dodecyl sulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphate, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, and the like.

[0056] Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by adding an inorganic base or an organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. In one embodiment, the inorganic salt is an ammonium salt, a sodium salt, a potassium salt, a calcium salt, and a magnesium salt. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines; substituted amines, including naturally occurring substituted amines; cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0057] The compounds provided herein may contain one or more asymmetric centers and thus may produce enantiomers, diastereomers, and other stereoisomeric forms, which may be defined as (R)- or (S)- or as (D)- or (L)- for amino acids based on absolute stereochemistry. Unless otherwise indicated, the compounds provided herein are intended to include all such possible isomers, as well as racemic and optically pure forms thereof. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques such as chromatography and fractional crystallization. Conventional techniques for preparing / isolating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other geometric asymmetric centers, unless otherwise indicated, the compounds are intended to include E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.

[0058] As used herein and unless otherwise indicated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the arrangement of their atoms in space. "Atropisomers" are stereoisomers resulting from hindered rotation about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any ratio is referred to as a "racemic" mixture. "Diastereomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0059] "Stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.

[0060] "Tautomers" refers to isomeric forms of a compound that are in equilibrium with each other. The concentrations of the isomeric forms will depend on the environment in which the compound is found, and may vary depending on, for example, whether the compound is a solid or in organic or aqueous solution.

[0061] It should also be noted that the compounds described herein may contain unnatural proportions of atomic isotopes at one or more atoms. For example, the compounds may be radiolabeled with a radioactive isotope, such as tritium ( 3 H), iodine-125 ( 125 I), sulfur-35( 35 S) or carbon-14 ( 14 C), or may be isotopically enriched, such as deuterium ( 2 H), carbon-13 ( 13C) or nitrogen-15( 15 N). As used herein, an "isotopologue" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom whose isotopic composition is different from the natural isotopic composition of the atom. "Isotopically enriched" may also refer to a compound containing at least one atom whose isotopic composition is different from the natural isotopic composition of the atom. The term "isotopic composition" refers to the amount of each isotope present in a given atom. Radiolabeled and isotopically enriched compounds can be used as therapeutic agents, such as cancer therapeutics; research reagents, such as binding assay reagents; and diagnostic agents, such as in vivo imaging agents. All isotopic variants of the compounds described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments, isotopologues of the compounds described herein are provided, for example, isotopologues that are enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" refers to a compound in which at least one hydrogen (H) has been replaced with deuterium (as D or 2 H represents) substitution, that is, the compound is enriched in deuterium at at least one position.

[0062] It should be noted that if there is a discrepancy between a depicted structure and the name of the structure, the depicted structure shall control.

[0063] As used herein and unless otherwise indicated, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier approved by the U.S. Food and Drug Administration as acceptable for use in humans or veterinary animals.

[0064] The term "composition" is intended to encompass a product containing specified ingredients (eg, mRNA molecules provided herein), optionally in specified amounts.

[0065] As used interchangeably herein, the terms "polynucleotide" or "nucleic acid" refer to nucleotide polymers of any length, and include, for example, DNA and RNA. Nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may comprise modified nucleotides, such as methylated nucleotides and their analogs. Nucleic acids may be in single-stranded or double-stranded form. As used herein and unless otherwise indicated, "nucleic acid" also includes nucleic acid mimics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholino nucleic acids. As used herein, "oligonucleotide" refers to a short synthetic polynucleotide, generally but not necessarily less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides. Unless otherwise indicated, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of 5' to 3' addition of the nascent RNA transcript is called the transcription direction; the sequence region on the DNA chain that has the same sequence as the RNA transcript and is located 5' relative to the 5' end of the RNA transcript is called the "upstream sequence"; the sequence region on the DNA chain that has the same sequence as the RNA transcript and is located 3' relative to the 3' end of the RNA transcript is called the "downstream sequence".

[0066] "Isolated nucleic acid" refers to nucleic acids that are substantially separated from other genomic DNA sequences and proteins or complexes (such as ribosomes and polymerases) that naturally accompany native sequences, such as RNA, DNA or mixed nucleic acids. The nucleic acid molecules of "isolation" are nucleic acid molecules that are separated from other nucleic acid molecules that are present in the natural sources of nucleic acid molecules. In addition, when manufactured by recombinant technology, the nucleic acid molecules of "isolation", such as mRNA molecules, can be substantially free of other cell materials or culture medium, or when chemically synthesized, it can be substantially free of chemical precursors or other chemicals. In specific embodiments, one or more nucleic acid molecules of encoding antigens as herein described are separated or purified. The term includes nucleic acid sequences removed from its naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogs or analogs biosynthesized by heterologous systems. Substantially pure molecules can include isolated forms of molecules.

[0067] The term "coding nucleic acid" or its grammatical equivalents when used to refer to a nucleic acid molecule includes: (a) a nucleic acid molecule that can be transcribed to produce mRNA and then translated into peptides and / or polypeptides when in its natural state or manipulated by methods well known to those skilled in the art; and (b) the mRNA molecule itself. The antisense strand is the complementary sequence of such a nucleic acid molecule, and the coding sequence can be inferred therefrom. The term "coding region" refers to the portion of a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of the nucleic acid molecule, the UTR is referred to as a 5'-UTR if it is located at the 5' end of the coding region, and as a 3'-UTR if it is located at the 3' end of the coding region.

[0068] As used herein, the term "mRNA" refers to a messenger RNA molecule comprising one or more open reading frames (ORFs), which can be translated by a cell or organism having the mRNA to produce one or more peptide or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs).

[0069] In certain embodiments, the mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, the mRNA is a polycistronic mRNA comprising two or more ORFs. In certain embodiments, the polycistronic mRNA encodes two or more peptides or proteins that may be identical or different from each other. In certain embodiments, each peptide or protein encoded by the polycistronic mRNA comprises at least one epitope of a selected antigen. In certain embodiments, the different peptides or proteins encoded by the polycistronic mRNA each comprise at least one epitope of a different antigen. In any of the embodiments described herein, the at least one epitope may be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.

[0070] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.

[0071] As used herein, the term "functional nucleotide analogue" refers to a modified version of a classical nucleotide A, G, C, U, or T that (a) retains the base pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification of the corresponding natural nucleotide to (i) a nucleobase, (ii) a sugar group, (iii) a phosphate group, or (iv) any combination of (i) to (iii). As used herein, base pairing encompasses not only the classical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analogue, or between a pair of functional nucleotide analogues, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonds to form between the modified nucleobase and the classical nucleobase, or between two complementary modified nucleobase structures. For example, a functional analogue of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analogue of cytosine. An example of such non-classical base pairing is base pairing between a modified nucleotide inosine and adenine, cytosine, or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Thus, nucleic acid molecules containing functional nucleotide analogs can have at least one modified nucleobase, sugar group, and / or internucleoside linkage. Exemplary chemical modifications to nucleobases, sugar groups, or internucleoside linkages of nucleic acid molecules are provided herein.

[0072] As used herein, the terms "translational enhancer element," "TEE," and "translational enhancer" refer to regions in nucleic acid molecules that promote translation of a coding sequence of a nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation. TEEs are typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhance the translation level of a coding sequence located upstream or downstream. For example, a TEE in the 5'-UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, August 2013; 10(8):747-750; Chappell et al., PNAS, June 29, 2004, 101(26)9590-9594). Some TEEs are known to be conserved across multiple species (Pánek et al., Nucleic Acids Research, Vol. 41, No. 16, Sept. 1, 2013, pp. 7625-7634).

[0073] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions and are therefore capable of base pairing with each other to form at least one double helix and an unpaired loop. The resulting structure is called a stem-loop structure, hairpin, or hairpin loop, and is a secondary structure found in many RNA molecules.

[0074] As used herein, the term "peptide" refers to a polymer containing from two to fifty (2-50) amino acid residues joined via one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).

[0075] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer having more than fifty (50) amino acid residues linked by covalent peptide bonds. That is, a description of a polypeptide equally applies to a description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid (e.g., an amino acid analog). As used herein, the terms encompass amino acid chains of any length, including full-length proteins (e.g., antigens).

[0076] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including the adaptive immune system) and can trigger an immune response (including an antigen-specific immune response) after the subject contacts the antigen. In certain embodiments, the antigen is a protein associated with a diseased cell, such as a cell infected with a pathogen or a neoplastic cell (e.g., a tumor-associated antigen (TAA)).

[0077] In the case of a peptide or polypeptide, as used herein, the term "fragment" refers to a peptide or polypeptide that comprises an amino acid sequence that is less than the full length. Such fragments can, for example, come from truncation of the amino terminus, truncation of the carboxyl terminus, and / or internal deletions of residues in the amino acid sequence. Fragments can, for example, be produced by alternative RNA splicing or by in vivo protease activity. In certain embodiments, a fragment refers to at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, or at least 110 consecutive amino acid residues. In some embodiments, a fragment of a polypeptide comprises an amino acid sequence of at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 consecutive amino acid residues. In certain embodiments, a fragment of a polypeptide retains at least one, at least two, at least three, or more functions of the polypeptide.

[0078] An "epitope" is a site on the surface of an antigen molecule that binds to a single antibody molecule, such as a localized region on an antigen surface that is capable of binding to one or more antigen-binding regions of an antibody and that has antigenic or immunogenic activity in an animal, such as a mammal (e.g., a human), and is capable of eliciting an immune response. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope with antigenic activity is a portion of a polypeptide that is bound by an antibody, as determined by any method known in the art, including, for example, an immunoassay. An antigenic epitope is not necessarily immunogenic. Epitopes are typically composed of chemically active surface groups of a molecule, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics. Antibody epitopes can be linear or conformational. Linear epitopes are formed by contiguous sequences of amino acids in a protein. Conformational epitopes are formed by amino acids that are discontinuous in the protein sequence but bind together when the protein folds into its three-dimensional structure. Inducible epitopes are formed when the three-dimensional structure of a protein assumes an altered conformation, such as after activation or binding by another protein or ligand. In certain embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is a linear feature of a polypeptide. Generally, an antigen has several or many different epitopes and can react with many different antibodies.

[0079] As used herein, the term "genetic vaccine" refers to a therapeutic or preventive composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease). Administering a vaccine to a subject ("vaccination") allows the production of encoded peptides or proteins, thereby causing an immune response to the target disease in the subject. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies to the encoded antigen, and / or the activation and proliferation of immune cells capable of specifically eliminating diseased cells expressing the antigen. In certain embodiments, the immune response further includes an innate immune response. According to the present disclosure, the vaccine can be administered to a subject before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of healthy or asymptomatic subjects makes the vaccinated subject immune or less sensitive to the development of the target disease. In some embodiments, vaccination of subjects showing symptoms of the disease improves the disease condition of the vaccinated subject or treats the disease.

[0080] The terms "innate immune response" and "innate immunity" are recognized in the art and refer to nonspecific defense mechanisms that are initiated by the body's immune system when it recognizes pathogen-associated molecular patterns, which involve different forms of cellular activity, including cytokine production and cell death via various pathways. As used herein, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production); activation of the NFκB pathway; increased proliferation, maturation, differentiation and / or survival of immune cells, and in some cases, induction of apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF)-κB activation.

[0081] The terms "adaptive immune response" and "adaptive immunity" are recognized in the art and refer to antigen-specific defense mechanisms initiated by the body's immune system when it recognizes a specific antigen, including humoral and cell-mediated responses. As used herein, an adaptive immune response includes cellular responses triggered and / or enhanced by a vaccine composition, such as a genetic composition described herein. In some embodiments, the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition, upon administration, allows the production of an antigen in the immunized subject that is a target of an antigen-specific adaptive immune response. Activation of the adaptive immune response can be detected using methods known in the art, such as measuring the level of antigen-specific antibody production or antigen-specific cell-mediated cytotoxicity.

[0082] The term "antibody" is intended to include polypeptide products of B cells within the scope of immunoglobulin polypeptides, which are capable of binding to specific molecular antigens and are composed of two pairs of identical polypeptide chains, wherein each pair has a heavy chain (about 50-70 kDa) and a light chain (about 25 kDa), each amino terminal portion of each chain includes a variable region containing about 100 to about 130 or more amino acids, and each carboxyl terminal portion of each chain includes a constant region. See, for example, Antibody Engineering (Borrebaeck ed., 2nd ed., 1995); and Kuby, Immunology (3rd ed., 1997). In certain embodiments, specific molecular antigens can be bound by the antibodies provided herein, including polypeptides, fragments thereof, or epitopes. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, internal antibodies, anti-idiotypic (anti-Id) antibodies, and functional fragments of any of the above, which refers to a portion of the antibody heavy chain or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment is derived. Non-limiting examples of functional fragments include single-chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies, and minibodies. Specifically, the antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as antigen-binding domains or molecules containing antigen-binding sites (e.g., one or more CDRs of an antibody). Such antibody fragments can be found in, for example, Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995); Huston et al., 1993, Cell Biophysics 22: 189-224; Plückthun and Skerra, 1989, Meth. Enzymol. 178: 497-515; and Day, Advanced Immunochemistry (2nd ed. 1990). The antibodies provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) of immunoglobulin molecules.

[0083] The term "administer" or "administration" refers to the act of injecting or otherwise physically delivering a substance (e.g., a lipid nanoparticle composition described herein) present in vitro into a patient's body, such as by transmucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When treating a disease, condition, illness, or symptom thereof, the administration of the substance is typically performed after the onset of the disease, condition, illness, or symptom thereof. When preventing a disease, condition, illness, or symptom thereof, the administration of the substance is typically performed before the onset of the disease, condition, illness, or symptom thereof.

[0084] "Long-term" administration, as opposed to acute mode, refers to administration of one or more agents in a continuous mode (e.g., over a period of time, such as days, weeks, months, or years) such that the initial therapeutic effect (activity) is maintained over an extended period of time. "Intermittent" administration refers to treatment that is not continuous without interruption, but rather is cyclical in nature.

[0085] As used herein, the term "targeted delivery" or verb form "targeting" refers to the process of promoting the delivery of an agent (such as the therapeutic payload molecule in the lipid nanoparticle composition as described herein) to a specific organ, tissue, cell and / or intracellular compartment (referred to as a target location) as opposed to delivery to any other organ, tissue, cell or intracellular compartment (referred to as a non-target location). Targeted delivery can be detected using methods known in the art, such as by comparing the concentration of the delivered agent in the target cell population with the concentration of the delivered agent at the non-target cell population after systemic administration. In certain embodiments, targeted delivery causes the concentration at the target location to be at least 2 times higher than the concentration at the non-target location.

[0086] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or underlying causes; prevent the occurrence of symptoms and / or their underlying causes; and / or ameliorate or remedy damage caused by or associated with a disease, condition, or disorder, including, for example, infection and neoplasia. In some embodiments, an effective amount is a therapeutically effective amount or a prophylactically effective amount.

[0087] As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or ameliorate the severity and / or duration of a given disease, condition, or disorder, and / or its associated symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer). A "therapeutically effective amount" of a substance / molecule / agent disclosed herein (e.g., a lipid nanoparticle composition described herein) may vary depending on a number of factors, such as the disease state, age, sex, and weight of the individual, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount comprises an amount in which any toxic or deleterious effects of the substance / molecule / agent are outweighed by the therapeutically beneficial effects. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition as described herein, or a therapeutic or prophylactic agent (e.g., a therapeutic mRNA) contained therein, that is effective to "treat" a disease, condition, or disorder in a subject or mammal.

[0088] A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, such as preventing a disease, condition, illness, or related symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer), delaying its onset (or recurrence), or reducing the likelihood of its onset (or recurrence). Typically, but not necessarily, a prophylactic dose is administered to a subject before or at an early stage of a disease, condition, or illness. A complete therapeutic or prophylactic effect may not occur by administering a single dose, but may only occur after a series of doses. Therefore, a therapeutically or prophylactically effective amount may be administered in one or more administrations.

[0089] The terms "prevent," "preventing," and "prevention" refer to reducing the likelihood of onset (or recurrence) of a disease, disorder, condition, or associated symptoms, such as an infectious disease, such as caused by a viral infection, or a neoplastic disease, such as cancer.

[0090] The terms "management" and "managing" refer to the beneficial effects a subject obtains from a therapy (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease. In certain embodiments, one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) are administered to a subject to "manage" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing progression or worsening of the disease.

[0091] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the development, recurrence, onset, or spread of a disease and / or its associated symptoms in a subject.

[0092] The term "therapeutic agent" refers to any agent useful in treating, preventing, or alleviating a disease, condition, or disorder, including any agent useful in treating, preventing, or alleviating one or more symptoms of a disease, condition, or disorder and / or its associated symptoms.

[0093] The term "therapy" refers to any regimen, method, and / or agent that can be used to prevent, manage, treat, and / or improve a disease, condition, or illness. In certain embodiments, the term "therapies" or "therapy" refers to biological therapies, supportive therapies, and / or other therapies known to those skilled in the art, such as medical personnel, that can be used to prevent, manage, treat, and / or improve a disease, condition, or illness.

[0094] As used herein, a "prophylactically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that completely or partially inhibits the development, recurrence, onset, or spread of a disease, disorder, or condition, and / or its associated symptoms in the subject.

[0095] In certain embodiments, a "therapeutically effective serum titer" is a serum titer of antibodies in a subject (eg, a human) that reduces the severity, duration, and / or symptoms associated with a disease, disorder, or condition in the subject.

[0096] The term "serum titer" refers to the average serum titer from multiple samples (e.g., at multiple time points) in one subject or in a population of at least 10, at least 20, at least 40 up to about 100, 1000, or more subjects.

[0097] The term "side effect" encompasses unwanted and / or adverse effects of a therapy (such as a preventive or therapeutic agent). An unwanted effect is not necessarily adverse. The adverse effects of a therapy (such as a preventive or therapeutic agent) may be harmful, uncomfortable, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Other undesirable effects experienced by patients are numerous and known in the art. Many effects are described in Physician's Desk Reference (68th edition, 2014).

[0098] The terms "subject" and "patient" are used interchangeably. As used herein, in certain embodiments, the subject is a mammal, such as a non-primate (e.g., a cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., a monkey and a human). In specific embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or a neoplastic disease.

[0099] The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody, or antibody fragment that provides a detectable signal through activity.

[0100] The term "detectable agent" refers to a substance that can be used to determine the presence of a desired molecule, such as an antigen encoded by an mRNA molecule described herein, in a sample or subject. A detectable agent can be a substance that can be visually detected or can be otherwise determined and / or measured (e.g., by quantitation).

[0101] By "substantially all" is meant at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0102] As used herein and unless otherwise indicated, the term "about" or "approximately" means an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the terms "about" and "approximately" mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05%, or less of a given value or range.

[0103] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0104] All publications, patent applications, accession numbers, and other references cited in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Furthermore, the dates of publication provided may differ from the actual publication dates, which may need to be independently confirmed.

[0105] A number of embodiments of the present invention have been described. However, it will be appreciated that various modifications can be made without departing from the spirit and scope of the present invention. Therefore, the descriptions in the experimental section and examples are intended to illustrate, but not to limit, the scope of the invention described in the claims.

[0106] 6.3 Lipid compounds

[0107] Unless otherwise indicated, the descriptions provided herein apply to all formulae provided herein (eg, Formula (I), Formula (II), and Formula (III), including subformulae thereof), to the extent they are applicable.

[0108] In one embodiment, provided herein is a compound of formula (I):

[0109]

[0110] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0111] G 1 and G 2 Each is independently a bond, C2-C 12 Alkylene or C2-C 12 alkenylene;

[0112] L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR aC(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ;

[0113] L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f )、-(C6-C 10 arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 or R 2 ;

[0114] R1 and R 2 Each independently is C5-C 32 Alkyl or C5-C 32 alkenyl;

[0115] R a 、R b 、R d and R e Each independently represents H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0116] R c and R f Each independently is C1-C 32 Alkyl or C2-C 32 alkenyl;

[0117] R 0 It is C1-C 12 Alkyl, C2-C 12 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 aryl or 4- to 8-membered heterocycloalkyl;

[0118] G 3 It is C2-C 12 Alkylene or C2-C 12 alkenylene;

[0119] R 4 It is C1-C 12 Alkyl, C2-C 12 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 aryl or 4- to 8-membered heterocycloalkyl;

[0120] R 5 It is C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 aryl or 4- to 8-membered heterocycloalkyl;

[0121] x is 0, 1, or 2;

[0122] s is 0 or 1; and

[0123] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, and heteroarylene is independently optionally substituted.

[0124] In one embodiment, the compound is not

[0125] In one embodiment, s is 0. In one embodiment, when s is 0, then R 4 Not C1-C 12 In one embodiment, when s is 0, then R 4 In one embodiment, s is 1.

[0126] In one embodiment, provided herein is a compound of formula (II):

[0127]

[0128] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0129] G 1 and G 2 Each is independently a bond, C2-C 12 Alkylene or C2-C 12 alkenylene;

[0130] L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R1 ;

[0131] L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f )、-(C6-C 10 arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 or R 2 ;

[0132] R 1 and R 2 Each independently is C5-C 32 Alkyl or C5-C 32 alkenyl;

[0133] Y is H, C1-C 14 Alkyl or -C(=O)(C1-C 14 alkyl);

[0134] R a 、R b 、R d and R e Each independently represents H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0135] Rc and R f Each independently is C1-C 32 Alkyl or C2-C 32 alkenyl;

[0136] G 3 It is C2-C 12 Alkylene or C2-C 12 alkenylene;

[0137] R 3 Yes-N(R 4 )R 5 OR 6 ;

[0138] R 4 It is C1-C 12 Alkyl, C2-C 12 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 aryl or 4- to 8-membered heterocycloalkyl;

[0139] R 5 It is C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl; or R 4 、R 5 Together with the nitrogen to which it is attached, it forms a cyclic portion;

[0140] R 6 is hydrogen, C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl or C6-C 10 aryl;

[0141] x is 0, 1, or 2; and

[0142] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.

[0143] In one embodiment, Y is H.

[0144] In one embodiment, Y is C1-C 14 In one embodiment, Y is C4-C 14 In one embodiment, Y is C6-C 12 In one embodiment, Y is n-hexyl. In one embodiment, Y is n-octyl. In one embodiment, Y is n-decyl. In one embodiment, Y is n-dodecyl.

[0145] In one embodiment, Y is -C(=O)(C1-C 14 In one embodiment, Y is -C(=O)(C1-C5 alkyl). In one embodiment, Y is acetyl. In one embodiment, Y is propionyl. In one embodiment, Y is -C(=O)(n-pentyl).

[0146] In one embodiment, provided herein is a compound of formula (III):

[0147]

[0148] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0149] R 1 and R 2 Each independently is C5-C 32 Alkyl or C5-C 32 alkenyl;

[0150] R 0 It is C1-C 12 Alkyl, C2-C 12 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 aryl or 4- to 8-membered heterocycloalkyl;

[0151] G 3 It is C2-C 12 Alkylene or C2-C 12 alkenylene;

[0152] G 4 It is C2-C 12 Alkylene or C2-C 12 alkenylene;

[0153] R 3 Yes-N(R 4 )R 5 OR 6 ;

[0154] R 4 It is C1-C 12 Alkyl, C2-C 12 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 aryl or 4- to 8-membered heterocycloalkyl;

[0155] R 5 It is C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl; or R 4 、R5 Together with the nitrogen to which it is attached, it forms a cyclic moiety;

[0156] R 6 is hydrogen, C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl or C6-C 10 aryl; and

[0157] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene and cyclic moiety is independently optionally substituted.

[0158] In one embodiment, G 4 It is C2-C 12 In one embodiment, G 4 In one embodiment, G 4 In one embodiment, G 4 is C2-C4 alkylene. In one embodiment, G 4 In one embodiment, G 4 It is a C4 alkylene group.

[0159] In one embodiment, G 4 It is C2-C 12 In one embodiment, G 4 In one embodiment, G 4 In one embodiment, G 4 It is a C2-C4 alkenylene group.

[0160] In one embodiment, G 4 In one embodiment, G 4 Replaced.

[0161] In one embodiment, G 3 It is C2-C 12 In one embodiment, G 3 In one embodiment, G 3 is C2-C6 alkylene. In one embodiment, G 3 is C2-C4 alkylene. In one embodiment, G 3 In one embodiment, G 3 It is a C4 alkylene group.

[0162] In one embodiment, G 3 It is C2-C 12 In one embodiment, G3 In one embodiment, G 3 In one embodiment, G 3 It is a C2-C4 alkenylene group.

[0163] In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 In one embodiment, G 3 Yes-(C1-C 11 In one embodiment, G 3 is -(C1-C7 alkylene)-C(=O)-. In one embodiment, G 3 is -(C1-C5 alkylene)-C(=O)-. In one embodiment, G 3 is -(C1-C3 alkylene)-C(=O)-. In one embodiment, G 3 is -CH2-C(=O)-. In one embodiment, G 3 In one embodiment, -C(=O)- is attached to the nitrogen atom and the alkylene group is attached to -N(R 4 )R 5 OR 6 .

[0164] In one embodiment, R 3 Yes-OR 6 .

[0165] In one embodiment, R 6 is hydrogen (ie, R 3 is -OH). In one embodiment, R 6 It is C1-C 12 In one embodiment, R 6 In one embodiment, R 6 In one embodiment, R 6 In one embodiment, R 6 In one embodiment, R 6 In one embodiment, R 6 is a C3-C8 cycloalkyl group. 6 is C3-C8 cycloalkenyl. In one embodiment, R 6 It is C6-C 10In one embodiment, R 6 In one embodiment, R 6 In one embodiment, R 6 Replaced.

[0166] In one embodiment, R 3 Yes-N(R 4 )R 5 . R 4 and R 5 described herein or elsewhere.

[0167] In one embodiment, the compound is of formula (IV):

[0168]

[0169] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0170] In one embodiment, the compound is of formula (V):

[0171]

[0172]

[0173] wherein t is an integer from 2 to 12,

[0174] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0175] In one embodiment, the compound is of formula (VI):

[0176]

[0177] wherein t is an integer from 2 to 12,

[0178] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0179] In one embodiment, the compound is of formula (VII):

[0180]

[0181] wherein t is an integer from 2 to 12, and

[0182] u is an integer from 2 to 12,

[0183] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0184] In one embodiment, t is an integer from 2 to 12. In one embodiment, t is an integer from 1 to 10. In one embodiment, t is an integer from 1 to 8. In one embodiment, t is an integer from 1 to 6. In one embodiment, t is an integer from 1 to 4. In one embodiment, t is an integer from 1 to 3. In one embodiment, t is an integer from 1 to 2. In one embodiment, t is 1. In one embodiment, t is 2. In one embodiment, t is 3. In one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6. In one embodiment, t is 7.

[0185] In one embodiment, u is an integer from 2 to 12. In one embodiment, u is an integer from 1 to 10. In one embodiment, u is an integer from 1 to 8. In one embodiment, u is an integer from 1 to 6. In one embodiment, u is an integer from 1 to 4. In one embodiment, u is an integer from 1 to 3. In one embodiment, u is an integer from 1 to 2. In one embodiment, u is 1. In one embodiment, u is 2. In one embodiment, u is 3. In one embodiment, u is 4. In one embodiment, u is 5. In one embodiment, u is 6. In one embodiment, u is 7.

[0186] In one embodiment, t is 2 and u is 4.

[0187] In one embodiment, R 0 It is C1-C 12 In one embodiment, R 0 It is C1-C 10 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 It's Zheng Renji.

[0188] In one embodiment, R 0 It is C2-C 12 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, the alkenyl group is a straight chain alkenyl group. In one embodiment, the alkenyl group is a branched chain alkenyl group. In one embodiment, R 0 In one embodiment, R 0 It is allyl.

[0189] In one embodiment, R 0 is a C3-C8 cycloalkyl group. 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 It's cyclooctyl.

[0190] In one embodiment, R 0 is C3-C8 cycloalkenyl. In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0 It is a cyclooctenyl group.

[0191] In one embodiment, R 0 It is C6-C 10 In one embodiment, R 0 It is phenyl.

[0192] In one embodiment, R 0 is a 4- to 8-membered heterocyclyl. 0 is a 4- to 8-membered heterocycloalkyl group. 0 In one embodiment, R 0 In one embodiment, R 0 In one embodiment, R 0In one embodiment, R 0 It is N-methylpiperidinyl.

[0193] In one embodiment, R 0 In one embodiment, R 0 Replaced.

[0194] In one embodiment, R 4 It is C1-C 12 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 It's Zheng Renji.

[0195] In one embodiment, R 4 It is C2-C 12 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, the alkenyl group is a straight chain alkenyl group. In one embodiment, the alkenyl group is a branched chain alkenyl group. In one embodiment, R 4 In one embodiment, R 4 It is allyl.

[0196] In one embodiment, R 4 is a C3-C8 cycloalkyl group. 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 It's cyclooctyl.

[0197] In one embodiment, R 4 is C3-C8 cycloalkenyl. In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 It is a cyclooctenyl group.

[0198] In one embodiment, R 4 It is C6-C 10 In one embodiment, R 4 It is phenyl.

[0199] In one embodiment, R 4 is a 4- to 8-membered heterocyclyl. 4 is a 4- to 8-membered heterocycloalkyl group. 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 In one embodiment, R 4 It is N-methylpiperidinyl.

[0200] In one embodiment, R 4 Not replaced.

[0201] In one embodiment, R 4 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(=O)R h 、-C(=O)NR g R h 、-C(=O)R h 、-OC(=O)R h 、-C(=O)OR h AND-OR i -OH, where:

[0202] R g is independently H or C1-C6 alkyl at each occurrence;

[0203] R h is independently at each occurrence C1-C6 alkyl; and

[0204] R i is independently at each occurrence C1-C6 alkylene.

[0205] In one embodiment, R 4 In one embodiment, R 4 Substituted with one hydroxyl group.

[0206] In one embodiment, R 4 In one embodiment, R 4 Substituted with one hydroxyl group and one oxo group.

[0207] In one embodiment, R 5 It is C1-C 12 In one embodiment, R 5 It is C1-C 10 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 is C1-C4 alkyl. In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 It's Zheng Renji.

[0208] In one embodiment, R 5 is a C3-C8 cycloalkyl group. 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 It's cyclooctyl.

[0209] In one embodiment, R 5 is C3-C8 cycloalkenyl. In one embodiment, R 5In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 It is a cyclooctenyl group.

[0210] In one embodiment, R 5 It is C6-C 10 In one embodiment, R 5 It is phenyl.

[0211] In one embodiment, R 5 is a 4- to 8-membered heterocyclyl. 5 is a 4- to 8-membered heterocycloalkyl group. 5 In one embodiment, R 5 In one embodiment, R 5 In one embodiment, R 5 It is tetrahydrothiopyranyl.

[0212] In one embodiment, R 4 、R 5 Together with the nitrogen to which it is attached, it forms a cyclic moiety.

[0213] In one embodiment, the cyclic portion (composed of R 4 and R 5 In one embodiment, the cyclic moiety is a heterocycloalkyl. In one embodiment, the cyclic moiety is a 4- to 8-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 4-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 5-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 6-membered heterocycloalkyl. In one embodiment, the cyclic moiety is a 7-membered heterocycloalkyl. In one embodiment, the cyclic moiety is an 8-membered heterocycloalkyl.

[0214] In one embodiment, the cyclic portion (composed of R 4 and R 5In one embodiment, the cyclic moiety is pyrrolidin-1-yl. In one embodiment, the cyclic moiety is piperidin-1-yl. In one embodiment, the cyclic moiety is azepan-1-yl. In one embodiment, the cyclic moiety is azocyclooctan-1-yl. In one embodiment, the cyclic moiety is morpholinyl. In one embodiment, the cyclic moiety is piperazin-1-yl. The point of attachment in these groups is connected to G. 3 .

[0215] As described herein and unless otherwise indicated, R 5 The substitution pattern also applies to the 4 and R 5 Together with the nitrogen to which it is attached, it forms a cyclic moiety.

[0216] In one embodiment, R 5 Not replaced.

[0217] In one embodiment, R 5 Substituted with one or more substituents selected from the group consisting of: oxo, -OR g 、-NR g C(=O)R h 、-C(=O)NR g R h 、-C(=O)R h 、-OC(=O)R h 、-C(=O)OR h AND-OR i -OH, where:

[0218] R g is independently H or C1-C6 alkyl at each occurrence;

[0219] R h is independently at each occurrence C1-C6 alkyl; and

[0220] R i is independently at each occurrence C1-C6 alkylene.

[0221] In one embodiment, R 5 In one embodiment, R 5 Substituted with one hydroxyl group.

[0222] In one embodiment, R 5 In one embodiment, R 5 is substituted with one hydroxyl group and one oxo group. 5It is -CH2CH2OH.

[0223] In one embodiment, R 5 Yes - (CH2) p Q, -(CH2) p CHQR, -CHQR or -CQ(R)2, wherein Q is C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4 to 8 membered heterocyclyl, C6-C 10 Aryl, 5- to 10-membered heteroaryl, -OR, -O(CH2) p N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R 22 、-O(CH2) p OR, -N(R)C(=NR 23 )N(R)2、-N(R)C(=CHR 23 )N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR 23 )N(R)2、-N(OR)C(=CHR 23 )N(R)2、-C(=NR 23 )N(R)2、-C(=NR 23 )R, -C(O)N(R)OR or -C(R)N(R)2C(O)OR, and each p is independently 1, 2, 3, 4 or 5;

[0224] R 22 It is C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4 to 8 membered heterocyclic group, C6-C 10 aryl or 5- to 10-membered heteroaryl;

[0225] R 23 is H, -CN, -NO2, C1-C6 alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C2-C6 alkenyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C 10 aryl or 5- to 10-membered heteroaryl;

[0226] Each R is independently H, C1-C3 alkyl or C2-C3 alkenyl; or the two Rs in the N(R)2 moiety together with the nitrogen to which they are attached form a cyclic moiety; and

[0227] Each X is independently F, CI, Br or I.

[0228] In one embodiment, G 1 In one embodiment, G 1 It is C2-C 12 In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 It is C2-C 12 In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 1 It is a C7 alkenylene group.

[0229] In one embodiment, G 2 In one embodiment, G 2 It is C2-C 12 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 It is C2-C 12 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 In one embodiment, G 2 It is a C7 alkenylene group.

[0230] In one embodiment, G 1 and G 2 Each independently is C2-C 12 In one embodiment, G 1and G 2 Each is independently C2 alkylene. In one embodiment, G 1 and G 2 Each is independently C5 alkylene. In one embodiment, G 1 and G 2 are each independently a C7 alkylene group.

[0231] In one embodiment, G 1 In one embodiment, G 1 In one embodiment, G 2 In one embodiment, G 2 Replaced.

[0232] In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 OR-P(=O)(OR b )(OR c In one embodiment, L 1 Yes-(C6-C 10 arylene)-R 1 In one embodiment, L 1 is -(6- to 10-membered heteroarylene)-R 1 In one embodiment, L 1 It is R 1 .

[0233] In one embodiment, L 1 Yes -C(=O)R 1 、-OC(=O)R 1 、-C(=O)OR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-NR a C(=O)R 1 or -C(=O)NR b R c In one embodiment, L 1 Yes -C(=O)R 1 In one embodiment, L 1 Yes-OC(=O)R 1 In one embodiment, L 1 is -C(=O)OR 1 In one embodiment, L 1 Yes-NR a C(=O)R 1 In one embodiment, L 1 is -C(=O)NR b R c In one embodiment, L 1 Yes-NR a C(=O)NR b R c In one embodiment, L 1 Yes-OC(=O)NR b R c In one embodiment, L 1 Yes-NR a C(=O)OR 1 .

[0234] In one embodiment, L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 OR-P(=O)(OR e )(OR f In one embodiment, L 2 Yes-(C6-C 10 arylene)-R 2 In one embodiment, L 2 is -(6- to 10-membered heteroarylene)-R 2 In one embodiment, L 2 It is R 2 .

[0235] In one embodiment, L 2 Yes -C(=O)R 2 、-OC(=O)R 2 、-C(=O)OR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 or -C(=O)NR e R f In one embodiment, L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-NR d C(=O)R 2 or -C(=O)NR e R f In one embodiment, L 2 Yes -C(=O)R 2 In one embodiment, L 2Yes-OC(=O)R 2 In one embodiment, L 2 is -C(=O)OR 2 In one embodiment, L 2 Yes-NR d C(=O)R 2 In one embodiment, L 2 is -C(=O)NR e R f In one embodiment, L 2 Yes-NR d C(=O)NR e R f In one embodiment, L 2 Yes-OC(=O)NR e R f In one embodiment, L 2 Yes-NR d C(=O)OR 2 .

[0236] In one embodiment, L 1 Yes-OC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)OR 1 or -C(=O)NR b R c , and L 2 Yes-OC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)OR 2 or -C(=O)NR e R f In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 or -C(=O)NR b R c , and L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 or -C(=O)NR e R f In one embodiment, L 1 Yes-OC(=O)R 1 , and L 2 Yes-OC(=O)R 2 In one embodiment, L 1Yes-OC(=O)R 1 , and L 2 Yes-NR d C(=O)R 2 In one embodiment, L 1 Yes-NR a C(=O)R 1 , and L 2 Yes-NR d C(=O)R 2 In one embodiment, L 1 is -C(=O)OR 1 , and L 2 is -C(=O)OR 2 In one embodiment, L 1 is -C(=O)OR 1 , and L 2 is -C(=O)NR e R f In one embodiment, L 1 is -C(=O)NR b R c , and L 2 is -C(=O)NR e R f .

[0237] In one embodiment, L 1 Yes-NR a C(=O)NR b R c , and L 2 Yes-NR d C(=O)NR e R f In one embodiment, L 1 Yes-OC(=O)NR b R c , and L 2 Yes-OC(=O)NR e R f In one embodiment, L 1 Yes-NR a C(=O)OR 1 , and L 2 Yes-NR d C(=O)OR 2 .

[0238] In one embodiment, L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-C(=O)R 1、-C(=O)NR b R c or R 1 ; and L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-C(=O)R 2 、-C(=O)NR e R f or R 2 .

[0239] In one embodiment, -G 1 -L 1 It is R 1 , and -G 2 -L 2 It is R 2 In one embodiment, -G 1 -L 1 It is R 1 , and -G 2 -L 2 Yes -C(=O)R 2 In one embodiment, -G 1 -L 1 It is R 1 , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)OR 2 In one embodiment, -G 1 -L 1 It is R 1 , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)NR e R f .

[0240] In one embodiment, -G 1 -L 1 Yes -C(=O)R 1 , and -G 2 -L 2 It is R 2 In one embodiment, -G 1 -L 1 Yes -C(=O)R 1 , and -G 2 -L 2 Yes -C(=O)R 2 In one embodiment, -G 1 -L 1 Yes -C(=O)R1 , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)OR 2 In one embodiment, -G 1 -L 1 Yes -C(=O)R 1 , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)NR e R f .

[0241] In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)OR 1 , and -G 2 -L 2 It is R 2 In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)OR 1 , and -G 2 -L 2 Yes -C(=O)R 2 In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)OR 1 , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)OR 2 In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)OR 1 , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)NR e R f .

[0242] In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)NR b Rc , and -G 2 -L 2 It is R 2 In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)NR b R c , and -G 2 -L 2 Yes -C(=O)R 2 In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)NR b R c , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)OR 2 In one embodiment, -G 1 -L 1 Yes-(C2-C 12 alkylene)-C(=O)NR b R c , and -G 2 -L 2 Yes-(C2-C 12 alkylene)-C(=O)NR e R f .

[0243] In one embodiment of Formula (I) (or subformulae thereof), -G 1 -L 1 Not R 1 , or -G 2 -L 2 Not R 2 , or -G 1 -L 1 Not R 1 , and -G 2 -L 2 Not R 2 In one embodiment of formula (IV) (or its subformula), -G 1 -L 1 Not R 1 , or -G 2 -L 2 Not R 2 , or -G 1 -L 1 Not R 1 , and -G 2-L 2 Not R 2 .

[0244] In one embodiment, the compound is of Formula (IV-A), (IV-B), (IV-C), (IV-D), (IV-E), (IV-F), (IV-G), or (IV-H):

[0245]

[0246] wherein y and z are each independently an integer from 2 to 12,

[0247] t is an integer from 2 to 12,

[0248] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0249] In one embodiment, the compound is of Formula (VA), (VB), (VC), (VD), (VE), (VF), (VG), or (VH):

[0250]

[0251] wherein y and z are each independently an integer from 2 to 12, and

[0252] t is an integer from 2 to 12,

[0253] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0254] In one embodiment, the compound is of Formula (VI-A), (VI-B), (VI-C), or (VI-D):

[0255]

[0256] wherein z is an integer from 2 to 12, and

[0257] t is an integer from 2 to 12,

[0258] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0259] In one embodiment, y is an integer from 2 to 12. In one embodiment, y is an integer from 1 to 10. In one embodiment, y is an integer from 1 to 8. In one embodiment, y is an integer from 1 to 6. In one embodiment, y is an integer from 1 to 4. In one embodiment, y is an integer from 1 to 3. In one embodiment, y is an integer from 1 to 2. In one embodiment, y is 1. In one embodiment, y is 2. In one embodiment, y is 3. In one embodiment, y is 4. In one embodiment, y is 5. In one embodiment, y is 6. In one embodiment, y is 7.

[0260] In one embodiment, z is an integer from 2 to 12. In one embodiment, z is an integer from 1 to 10. In one embodiment, z is an integer from 1 to 8. In one embodiment, z is an integer from 1 to 6. In one embodiment, z is an integer from 1 to 4. In one embodiment, z is an integer from 1 to 3. In one embodiment, z is an integer from 1 to 2. In one embodiment, z is 1. In one embodiment, z is 2. In one embodiment, z is 3. In one embodiment, z is 4. In one embodiment, z is 5. In one embodiment, z is 6. In one embodiment, z is 7.

[0261] In one embodiment, y and z are different. In one embodiment, y and z are the same. In one embodiment, y and z are the same and are selected from 2, 3, 4, 5, 6, 7, 8, and 9. In one embodiment, y is 2 and z is 2. In one embodiment, y is 5 and z is 5.

[0262] In one embodiment, R 1 It is a straight chain C5-C 32 In one embodiment, R 1 It is a straight chain C6-C 32 In one embodiment, R 1 It is a straight chain C6-C 24 In one embodiment, R 1 It is a straight chain C7-C 15 In one embodiment, R 1 In one embodiment, R 1 In one embodiment, R 1 In one embodiment, R 1 It is a straight chain C 10 In one embodiment, R 1 It is a straight chain C 11 In one embodiment, R 1It is a straight chain C 12 In one embodiment, R 1 It is a straight chain C 13 In one embodiment, R 1 It is a straight chain C 14 In one embodiment, R 1 It is a straight chain C 15 alkyl.

[0263] In one embodiment, R 1 It is a straight chain C5-C 32 In one embodiment, R 1 It is a straight chain C6-C 32 In one embodiment, R 1 It is a straight chain C6-C 24 In one embodiment, R 1 It is a straight chain C7-C 17 In one embodiment, R 1 In one embodiment, R 1 In one embodiment, R 1 In one embodiment, R 1 It is a straight chain C 10 In one embodiment, R 1 It is a straight chain C 11 In one embodiment, R 1 It is a straight chain C 12 In one embodiment, R 1 It is a straight chain C 13 In one embodiment, R 1 It is a straight chain C 14 In one embodiment, R 1 It is a straight chain C 15 In one embodiment, R 1 It is a straight chain C 16 In one embodiment, R 1 It is a straight chain C 17 Alkenyl.

[0264] In one embodiment, R 1 It is a branched C5-C 32 In one embodiment, R 1 It is a branched C6-C 32 In one embodiment, R 1 It is a branched C6-C 24 In one embodiment, R 1 Yes-R 7-CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 1 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0265] In one embodiment, R 1 It is a branched C5-C 32 In one embodiment, R 1 It is a branched C6-C 32 In one embodiment, R 1 It is a branched C6-C 24 In one embodiment, R 1 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 1 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 Independently C6-C 10 Alkenyl.

[0266] In one embodiment, R 2 It is a straight chain C5-C 32 In one embodiment, R 2 It is a straight chain C6-C 32 In one embodiment, R 2 It is a straight chain C6-C 24 In one embodiment, R 2 It is a straight chain C7-C 15 In one embodiment, R 2 In one embodiment, R 2In one embodiment, R 2 In one embodiment, R 2 It is a straight chain C 10 In one embodiment, R 2 It is a straight chain C 11 In one embodiment, R 2 It is a straight chain C 12 In one embodiment, R 2 It is a straight chain C 13 In one embodiment, R 2 It is a straight chain C 14 In one embodiment, R 2 It is a straight chain C 15 alkyl.

[0267] In one embodiment, R 2 It is a straight chain C5-C 32 In one embodiment, R 2 It is a straight chain C6-C 32 In one embodiment, R 2 It is a straight chain C6-C 24 In one embodiment, R 2 It is a straight chain C7-C 17 In one embodiment, R 2 In one embodiment, R 2 In one embodiment, R 2 In one embodiment, R 2 It is a straight chain C 10 In one embodiment, R 2 It is a straight chain C 11 In one embodiment, R 2 It is a straight chain C 12 In one embodiment, R 2 It is a straight chain C 13 In one embodiment, R 2 It is a straight chain C 14 In one embodiment, R 2 It is a straight chain C 15 In one embodiment, R 2 It is a straight chain C 16 In one embodiment, R 2 It is a straight chain C 17 Alkenyl.

[0268] In one embodiment, R 2 It is a branched C5-C32 In one embodiment, R 2 It is a branched C6-C 32 In one embodiment, R 2 It is a branched C6-C 24 In one embodiment, R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0269] In one embodiment, R 2 It is a branched C5-C 32 In one embodiment, R 2 It is a branched C6-C 32 In one embodiment, R 2 It is a branched C6-C 24 In one embodiment, R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 Independently C6-C 10 Alkenyl.

[0270] In one embodiment, R c It is a straight chain C5-C 32 In one embodiment, R c It is a straight chain C6-C 32In one embodiment, R c It is a straight chain C6-C 24 In one embodiment, R c It is a straight chain C7-C 15 In one embodiment, R c In one embodiment, R c In one embodiment, R c In one embodiment, R c It is a straight chain C 10 In one embodiment, R c It is a straight chain C 11 In one embodiment, R c It is a straight chain C 12 In one embodiment, R c It is a straight chain C 13 In one embodiment, R c It is a straight chain C 14 In one embodiment, R c It is a straight chain C 15 alkyl.

[0271] In one embodiment, R c It is a straight chain C5-C 32 In one embodiment, R c It is a straight chain C6-C 32 In one embodiment, R c It is a straight chain C6-C 24 In one embodiment, R c It is a straight chain C7-C 17 In one embodiment, R c In one embodiment, R c In one embodiment, R c In one embodiment, R c It is a straight chain C 10 In one embodiment, R c It is a straight chain C 11 In one embodiment, R c It is a straight chain C 12 In one embodiment, R c It is a straight chain C 13 In one embodiment, R c It is a straight chain C 14 In one embodiment, R c It is a straight chain C15 In one embodiment, R c It is a straight chain C 16 In one embodiment, R c It is a straight chain C 17 Alkenyl.

[0272] In one embodiment, R c It is a branched C5-C 32 In one embodiment, R c It is a branched C6-C 32 In one embodiment, R c It is a branched C6-C 24 In one embodiment, R c Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R c Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0273] In one embodiment, R c It is a branched C5-C 32 In one embodiment, R c It is a branched C6-C 32 In one embodiment, R c It is a branched C6-C 24 In one embodiment, R c Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R c Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8and R 9 Independently C6-C 10 Alkenyl.

[0274] In one embodiment, R f It is a straight chain C5-C 32 In one embodiment, R f It is a straight chain C6-C 32 In one embodiment, R f It is a straight chain C6-C 24 In one embodiment, R f It is a straight chain C7-C 15 In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R f It is a straight chain C 10 In one embodiment, R f It is a straight chain C 11 In one embodiment, R f It is a straight chain C 12 In one embodiment, R f It is a straight chain C 13 In one embodiment, R f It is a straight chain C 14 In one embodiment, R f It is a straight chain C 15 alkyl.

[0275] In one embodiment, R f It is a straight chain C5-C 32 In one embodiment, R f It is a straight chain C6-C 32 In one embodiment, R f It is a straight chain C6-C 24 In one embodiment, R f It is a straight chain C7-C 17 In one embodiment, R f In one embodiment, R f In one embodiment, R f In one embodiment, R f It is a straight chain C 10 In one embodiment, R f It is a straight chain C 11 In one embodiment, Rf It is a straight chain C 12 In one embodiment, R f It is a straight chain C 13 In one embodiment, R f It is a straight chain C 14 In one embodiment, R f It is a straight chain C 15 In one embodiment, R f It is a straight chain C 16 In one embodiment, R f It is a straight chain C 17 Alkenyl.

[0276] In one embodiment, R f It is a branched C5-C 32 In one embodiment, R f It is a branched C6-C 32 In one embodiment, R f It is a branched C6-C 24 In one embodiment, R f Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R f Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0277] In one embodiment, R f It is a branched C5-C 32 In one embodiment, R f It is a branched C6-C 32 In one embodiment, R f It is a branched C6-C 24 In one embodiment, R f Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R9 Independently C2-C 10 In one embodiment, R f Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 Independently C6-C 10 Alkenyl.

[0278] In one embodiment, R 1 、R 2 、R c and R f Each independently a straight chain C6-C 18 Alkyl, straight chain C6-C 18 Alkenyl or -R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 Alkyl or C2-C 10 Alkenyl.

[0279] In one embodiment, R 1 、R 2 、R c and R f Each independently is a straight chain C7-C 15 Alkyl, straight chain C7-C 15 Alkenyl or -R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl or C6-C 10 Alkenyl.

[0280] In one embodiment, R 1 、R 2 、R c and R f Each independently a branched C6-C 24 Alkyl or branched C6-C 24 In one embodiment, R c and R f Each independently is -R 7 -CH(R 8 )(R9 ), where R 7 is a C1-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 Alkyl or C2-C 10 Alkenyl.

[0281] In one embodiment of Formula (I) (or subformulae thereof), R 1 It is a straight chain C5-C 32 Alkyl, and R 2 It is a straight chain C5-C 32 In one embodiment, R 1 It is a straight chain C7-C 15 Alkyl, and R 2 It is a straight chain C7-C 15 alkyl.

[0282] In one embodiment of Formula (I) (or subformulae thereof), R 1 It is a branched C5-C 32 Alkyl, and R 2 It is a branched C5-C 32 In one embodiment, R 1 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 1 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8and R 9 are independently C4-C8 alkyl.

[0283] In one embodiment of formula (II) (or subformulae thereof), R 1 It is a straight chain C5-C 32 Alkyl, and R 2 It is a branched C5-C 32 In one embodiment, R 1 It is a straight chain C7-C 15 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 1 It is a straight chain C7-C 15 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0284] In one embodiment of formula (III) (or subformulae thereof), R 1 It is a branched C5-C 32 Alkyl, and R 2 It is a branched C5-C 32 In one embodiment, R 1 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 1 Yes-R 7 -CH(R8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0285] In one embodiment of formula (III) (or subformulae thereof), R 1 It is a straight chain C5-C 32 Alkyl, and R 2 It is a branched C5-C 32 In one embodiment, R 1 It is a straight chain C7-C 15 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 In one embodiment, R 1 It is a straight chain C7-C 15 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C0-C1 alkylene group, and R 8 and R 9 are independently C4-C8 alkyl.

[0286] In one embodiment, R 1 、R 2 、R c and R f Each independently is one of the following structures:

[0287]

[0288] In one embodiment, R 1 、R 2 、R c and R f Each independently is optionally substituted. In one embodiment, R1 In one embodiment, R 1 In one embodiment, R 2 In one embodiment, R 2 In one embodiment, R c In one embodiment, R c In one embodiment, R f In one embodiment, R f Replaced.

[0289] In one embodiment, R a and R d are each independently H. In one embodiment, R a 、R b 、R d and R e are each independently H. In one embodiment, R a and R d Each independently is C1-C 24 In one embodiment, R a and R d Each independently is C1-C 18 In one embodiment, R a and R d Each independently is C1-C 12 In one embodiment, R a and R d Each is independently C1-C6 alkyl. In one embodiment, R a 、R b 、R d and R e Each is independently unsubstituted or substituted.

[0290] In one embodiment, R b 、R c 、R e and R f Each is independently n-hexyl or n-octyl.

[0291] In one embodiment, the compound is a compound in Table 1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0292] Table 1.

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303] In one embodiment, the compound is a compound in Table 2, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0304] Table 2.

[0305]

[0306]

[0307] Certain compounds of formula (III) are described in International Patent Application No. PCT / CN2021 / 122704 filed on October 8, 2021 and International Patent Application No. PCT / CN2022 / 071251 filed on January 11, 2022, the entire contents of each case are incorporated herein by reference.

[0308] In one embodiment, the compound is a compound in Table 3, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0309] Table 3.

[0310]

[0311]

[0312] In one embodiment, provided herein is a compound of Formula (XI), (XII), (XIII), (XIV), or (XV):

[0313]

[0314]

[0315] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein G 1 , G2 , G 3 , L 1 , L 2 , Y, R 0 , s, and t are as defined herein or elsewhere, and wherein Z is -OH, a halogen, or a leaving group (eg, -OMs or -OTs).

[0316] In one embodiment, Z is -OH. In one embodiment, Z is halogen. In one embodiment, Z is -Cl. In one embodiment, Z is -OMs.

[0317] In one embodiment, the compound of Formula (XI), (XII), (XIII), (XIV), (XV), (XVI), or (XVII) is an intermediate used in the preparation of a compound of Formula (I), (II), (IV), (V), (VI), or (VII), respectively, e.g., as exemplified in the Examples provided herein.

[0318] In one embodiment, the compound of Formula (XI), (XII), (XIII), (XIV), (XV), (XVI), or (XVII) is itself a lipid compound and is used in the lipid nanoparticles or methods provided herein.

[0319] It should be understood that any embodiment of the compound provided herein as shown above, and any specific substituent and / or variable of the compound provided herein as shown above can be independently combined with other embodiments of the compound and / or substituent and / or variable to form the above embodiments not specifically set forth. In addition, in the case of listing the substituent and / or variable list of any specific group or variable, it should be understood that each individual substituent and / or variable can be deleted from the specific embodiment and / or claim, and the remaining substituent and / or variable list will be considered to be within the scope of the embodiment provided herein.

[0320] It is understood that in this specification, combinations of substituents and / or variables in the various formulae depicted are permissible only if such contributions result in stable compounds.

[0321] 6.4 Nanoparticle Composition

[0322] In one aspect, described herein are nanoparticle compositions comprising lipid compounds described herein. In certain embodiments, the nanoparticle compositions comprise a compound according to formula (I), (II) or (III) (and subformulae thereof) as described herein.

[0323] In some embodiments, the maximum dimension of the nanoparticle compositions provided herein is 1 μm or shorter (e.g., ≤1 μm, ≤900 nm, ≤800 nm, ≤700 nm, ≤600 nm, ≤500 nm, ≤400 nm, ≤300 nm, ≤200 nm, ≤175 nm, ≤150 nm, ≤125 nm, ≤100 nm, ≤75 nm, ≤50 nm or shorter) when measured, for example, by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticles provided herein have at least one dimension in the range of about 40 nm to about 200 nm. In one embodiment, the at least one dimension is in the range of about 40 nm to about 100 nm.

[0324] Nanoparticle compositions that can be used in conjunction with the present disclosure include, for example, lipid nanoparticles (LNPs), nanolipoprotein particles, liposomes, lipid vesicles, and lipid complexes. In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers can be functionalized and / or cross-linked to each other. The lipid bilayers can include one or more ligands, proteins, or channels.

[0325] The characteristics of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipid can have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipid. Characteristics can also vary depending on the method and conditions used to prepare the nanoparticle composition.

[0326] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle compositions. Zeta potential can be measured using dynamic light scattering or potentiometric methods (e.g., potentiometric titration). Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malverm Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of the nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0327] Dh (size): The average size of the nanoparticle composition can be between tens of nanometers and hundreds of nanometers. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the nanoparticle composition may have an average size of about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the nanoparticle composition may have an average size of about 70 nm to about 100 nm. In some embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

[0328] PDI: The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

[0329] Encapsulation efficiency: The encapsulation efficiency of a therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent encapsulated or otherwise associated with the nanoparticle composition after preparation, relative to the initial amount provided. Encapsulation efficiency is desirably high (e.g., approaching 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after disruption of the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0330] Apparent pKa: The zeta potential of a nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other components of the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0331] In another embodiment, the self-replicating RNA can be formulated in liposomes. As a non-limiting example, the self-replicating RNA can be formulated in liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety. In one aspect, the liposomes may comprise lipids having a pKa value that is favorable for delivery of the mRNA. In another aspect, the liposomes may have a substantially neutral surface charge at physiological pH and thus may be effectively used for immunization (see, for example, the liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).

[0332] In some embodiments, the nanoparticle composition comprises a lipid component comprising at least one lipid, such as a compound according to one of Formula (I), (II), or (III) (and subformulae thereof) as described herein. For example, in some embodiments, the nanoparticle composition can comprise a lipid component comprising a compound as provided herein. The nanoparticle composition can also comprise one or more other lipid or non-lipid components as described below.

[0333] In one embodiment, nanoparticle compositions comprising a compound provided herein and mRNA exhibit increased mRNA expression levels (e.g., compared to standard cationic lipid compounds known in the art, such as MC3).

[0334] 6.4.1 Cationic / ionizable lipids

[0335] As described herein, in some embodiments, the nanoparticle compositions provided herein comprise, in addition to the lipids according to formula (I), (II) or (III) (and subformulae thereof), one or more charged or ionizable lipids. Without being bound by theory, it is expected that certain charged or zwitterionic lipid components of the nanoparticle compositions are similar to lipid components in cell membranes, thereby improving the cellular uptake of the nanoparticles. Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tri(dodecyl)-1-piperazineethylamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tri(dodecyl)-1,4-piperazinediethylamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-triacontane (KL25), 1,2-dilinoleyloxy-N,N -dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 4-(dimethylamino)butyric acid heptathriacontac-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane ( DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), nDMA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylheneicosaf-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine.Additional exemplary charged or ionizable lipids that can form part of the inventive nanoparticle compositions include lipids (e.g., lipid 5) described in Sabnis et al., “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates,” Molecular Therapy, Vol. 26, No. 6, 2018, which is incorporated herein by reference in its entirety.

[0336] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[ [Bis(3-amino-propyl)amino]butylformamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5); dioctadecylamido-glycylsilane tetramine (DOGS); 3b-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol); dioctadecyldimethylammonium bromide (DDAB); SAINT-2,N-methyl-4-(dioleyl)methylpyridinium; 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoyl-3-dimethylhydroxyethylammonium bromide (DORIE); 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI); dialkylated amino acids (DILA 2)(e.g., C18:1-norArg-C16); dioleyldimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl); (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G); and (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentan-1-aminium chloride (DOTAPen). Cationic lipids with charged head groups at physiological pH are also suitable, such as primary amines (e.g., DODAGN', N'-dioctadecyl-N-4,8-diaza-10-aminodecanoylglycine amide) and guanidinium head groups (e.g., bis-guanidinium-spermtriamine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)). Another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl). In certain embodiments, the cationic lipid is a specific enantiomer or racemic form, and includes various salt forms (e.g., chlorides or sulfates) of the above cationic lipids. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipid is an ionizable cationic lipid, such as dioctadecyldimethylammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); 4-(dimethylamino)butyric acid heptathriacontac-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and N-morpholino cholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticles include a combination of two or more cationic lipids (e.g., two or more of the above cationic lipids).

[0337] Additionally, in some embodiments, the charged or ionizable lipid that may form part of the nanoparticle composition of the present invention is a lipid that includes a cyclic amine group. Additional cationic lipids suitable for use in the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each of which are incorporated herein by reference in their entirety.

[0338] 6.4.2 Polymer-bound lipids

[0339] In some embodiments, the lipid component of nanoparticle composition can include one or more polymer-bound lipids, such as pegylated lipids (PEG lipids). Without being bound by theory, it is expected that the polymer-bound lipid component in the nanoparticle composition can improve colloidal stability and / or reduce the protein absorption of nanoparticles. Exemplary cationic lipids that can be used in conjunction with the present disclosure include but are not limited to PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol and mixtures thereof. For example, PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000 or Chol-PEG2000.

[0340] In one embodiment, the polymer-bound lipid is a pegylated lipid. For example, some embodiments include pegylated diacylglycerols (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); pegylated phosphatidylethanolamine (PEG-PE); PEG succinate diacylglycerols (PEG-S-DAG), such as 4-O-(2',3'-di-tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG); pegylated ceramide (PEG-cer); or PEG dialkoxypropylcarbamates, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di-tetradecanoyloxy)propyl)carbamate or 2,3-di-tetradecanoyloxypropyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.

[0341] In one embodiment, the polymer-bound lipid is present at a concentration within the range of 1.0 mol % to 2.5 mol %. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.7 mol %. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol %.

[0342] In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100: 1 to about 20: 1.

[0343] In one embodiment, the PEGylated lipid has the formula:

[0344]

[0345] or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:

[0346] R 12 and R 13 are each independently a linear or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester linkages; and

[0347] w has an average value ranging from 30 to 60.

[0348] In one embodiment, R 12 and R 13 Each is independently a linear saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, the average w is in the range of 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, the average w is about 49.

[0349] In one embodiment, the PEGylated lipid has the formula:

[0350]

[0351] The average w is about 49.

[0352] 6.4.3 Structural lipids

[0353] In some embodiments, the lipid component of the nanoparticle composition may include one or more structural lipids. Without being bound by theory, it is expected that structural lipids can stabilize the amphiphilic structure of the nanoparticle, such as, but not limited to, the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatin, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and a corticosteroid (e.g., prednisolone, dexamethasone, prednisone, and hydrocortisone) or a combination thereof.

[0354] In one embodiment, the lipid nanoparticle provided herein comprises a steroid or a steroid analog. In one embodiment, the steroid or the steroid analog are cholesterol. In one embodiment, the steroid exists at a concentration within the range of 39 mol % to 49 mol %, 40 mol % to 46 mol %, 40 mol % to 44 mol %, 40 mol % to 42 mol %, 42 mol % to 44 mol % or 44 mol % to 46 mol %. In one embodiment, the steroid exists at a concentration of 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol %, 45 mol % or 46 mol %.

[0355] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32 mol % to 40 mol % steroid.

[0356] 6.4.4 Phospholipids

[0357] In some embodiments, the lipid component of the nanoparticle composition can include one or more phospholipids, such as one or more (poly)unsaturated lipids. Without being bound by theory, it is expected that phospholipids can assemble into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 LysoPC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-arachidonoyl-sn-glycero-3-phosphocholine, 1,2-di(docosahexaenoyl)-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME In some embodiments, the nanoparticle composition comprises DSPC. In some embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.

[0358] Additional exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE) and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE) and 1,2-ditransoleoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, and SM.

[0359] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0360] Additional phospholipids that may form part of the nanoparticle compositions of the present invention also include those described in WO2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.

[0361] 6.4.5 Therapeutic Payloads

[0362] According to the present disclosure, the nanoparticle compositions described herein may further comprise one or more therapeutic and / or prophylactic agents. These therapeutic and / or prophylactic agents are sometimes referred to as "therapeutic payloads" or "payloads" in this disclosure. In some embodiments, the therapeutic payloads can be administered in vivo or in vitro using nanoparticles as delivery vehicles.

[0363] In some embodiments, the nanoparticle compositions comprise as therapeutic payloads small molecule compounds (e.g., small molecule drugs), such as anticancer agents (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antitumor agents (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, cytosine pyruvate ... arabinoside), anthracyclines, alkylating agents, platinum compounds, antimetabolites and nucleoside analogs such as methotrexate and purine and pyrimidine analogs), anti-infectives, local anesthetics (such as dibucaine and chlorpromazine), beta-adrenergic blocking agents (such as propranolol, timolol and labetalol), antihypertensives (such as clonidine and hydralazine), antidepressants (such as imipramine, amitriptyline and doxepin), anticonvulsants (such as phenytoin), antihistamines

[0014] Examples of the present invention include antihistamines, antifungals, and antidepressants (e.g., diphenhydramine, chlorpheniramine, and promethazine), antibiotics / antibacterials (e.g., gentamycin, ciprofloxacin, and cefoxitin), antifungals (e.g., miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitics, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and imaging agents.

[0364] In some embodiments, the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that elicits an immune response, and / or another therapeutic and / or prophylactic agent. Cytotoxins or cytotoxic agents include any agent that may be harmful to cells. Examples include, but are not limited to, paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, rachelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to, iodine (eg, iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium-90, samarium-153, and praseodymium.

[0365] In other embodiments, the therapeutic payload of the nanoparticle compositions of the invention can include, but is not limited to, therapeutic and / or prophylactic agents, such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa, chlorambucil, razithromycin (CC-1065), melphalan, carmustine (BSNU), lomustine (

[0015] Examples of the present invention include, but are not limited to, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines such as daunomycin (formerly daunomycin) and doxorubicin, antibiotics such as dactinomycin (formerly actinomycin), bleomycin, milramycin, and anthramycin (AMC), and antimitotics such as vincristine, vinblastine, paclitaxel, and maytansine.

[0366] In some embodiments, the nanoparticle composition comprises biomolecules such as peptides and polypeptides as therapeutic payloads. The biomolecules forming part of the nanoparticle composition of the present invention may be of natural origin or synthetic. For example, in some embodiments, the therapeutic payload of the nanoparticle composition of the present invention may include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.

[0367] 6.4.5.1 Nucleic Acids

[0368] In some embodiments, the nanoparticle compositions of the present invention comprise one or more nucleic acid molecules (e.g., DNA or RNA molecules) as therapeutic payloads. Exemplary forms of nucleic acid molecules that may be included in the nanoparticle compositions of the present invention as therapeutic payloads include, but are not limited to, one or more of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In certain embodiments, the therapeutic payload comprises RNA. RNA molecules that may be included in the nanoparticle compositions of the present invention as therapeutic payloads include, but are not limited to, shortmers, agomirs, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA molecules known in the art. In certain embodiments, the RNA is mRNA.

[0369] In other embodiments, the nanoparticle composition comprises an siRNA molecule as a therapeutic payload. Specifically, in some embodiments, the siRNA molecule is capable of selectively interfering with and downregulating the expression of a gene of interest. For example, in some embodiments, upon administration of a nanoparticle composition comprising an siRNA to a subject in need thereof, the siRNA payload selectively silences a gene associated with a specific disease, condition, or disorder. In some embodiments, the siRNA molecule comprises a sequence complementary to an mRNA sequence encoding a protein product of interest. In some embodiments, the siRNA molecule is an immunomodulatory siRNA.

[0370] In some embodiments, the nanoparticle composition comprises an shRNA molecule or a vector encoding an shRNA molecule as a therapeutic payload. Specifically, in some embodiments, the therapeutic payload produces shRNA within the target cell after administration to the target cell. The constructs and mechanisms associated with shRNA are well known in the art.

[0371] In some embodiments, nanoparticle compositions comprise mRNA molecules as therapeutic payloads. Specifically, in some embodiments, the mRNA molecules encode polypeptides of interest, including any naturally occurring or non-naturally occurring or otherwise modified polypeptides. The polypeptides encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptides encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.

[0372] In some embodiments, the nucleic acid molecules of the present disclosure include mRNA molecules. In specific embodiments, the nucleic acid molecules include at least one coding region (e.g., open reading frame (ORF)) encoding a peptide or polypeptide of interest. In some embodiments, the nucleic acid molecules also include at least one untranslated region (UTR). In specific embodiments, the untranslated region (UTR) is located upstream (5' end) of the coding region and is referred to herein as 5'-UTR. In specific embodiments, the untranslated region (UTR) is located downstream (3' end) of the coding region and is referred to herein as 3'-UTR. In specific embodiments, the nucleic acid molecules include both 5'-UTR and 3'-UTR. In some embodiments, the 5'-UTR includes a 5'-cap structure. In some embodiments, the nucleic acid molecules include a Kozak sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecules include a poly-A region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecules include a polyadenylation signal (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecules include a stabilizing region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in a 5'-UTR and / or a 3'-UTR). In some embodiments, the nucleic acid molecule comprises one or more intron regions that can be excised during splicing. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR and a coding region. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a coding region and a 3'-UTR. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR, a coding region, and a 3'-UTR.

[0373] Coding region

[0374] In some embodiments, nucleic acid molecules of the present disclosure include at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region includes at least two ORFs, each ORF encoding a peptide or protein. In embodiments where the coding region includes more than one ORF, the encoded peptides and / or proteins may be identical or different from each other. In some embodiments, the multiple ORFs in the coding region are separated by non-coding sequences. In specific embodiments, the non-coding sequence separating two ORFs includes an internal ribosome entry site (IRES).

[0375] Without being bound by theory, it is expected that an internal ribosome entry site (IRES) can serve as a sole ribosome binding site, or as one of multiple ribosome binding sites of an mRNA. An mRNA molecule comprising more than one functional ribosome binding site can encode several peptides or polypeptides that are independently translated by ribosomes (e.g., polycistronic mRNA). Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in conjunction with the present disclosure include, but are not limited to, those from picornaviruses (e.g., FMDV), insect pest viruses (CFFV), polioviruses (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV).

[0376] In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 100 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encoding has a peptide or polypeptide of at least about 300 amino acids. In some embodiments, the nucleic acid molecule encoding has a peptide or polypeptide of at least about 500 amino acids. In some embodiments, the nucleic acid molecule encoding has a peptide or polypeptide of at least about 1000 amino acids.

[0377] In some embodiments, the nucleic acid molecules of the present disclosure are at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecules are at least about 35 nt in length. In some embodiments, the nucleic acid molecules are at least about 40 nt in length. In some embodiments, the nucleic acid molecules are at least about 45 nt in length. In some embodiments, the nucleic acid molecules are at least about 50 nt in length. In some embodiments, the nucleic acid molecules are at least about 55 nt in length. In some embodiments, the nucleic acid molecules are at least about 60 nt in length. In some embodiments, the nucleic acid molecules are at least about 65 nt in length. In some embodiments, the nucleic acid molecules are at least about 70 nt in length. In some embodiments, the nucleic acid molecules are at least about 75 nt in length. In some embodiments, the nucleic acid molecules are at least about 80 nt in length. In some embodiments, the nucleic acid molecules are at least about 85 nt in length. In some embodiments, the nucleic acid molecules are at least about 90 nt in length. In some embodiments, the nucleic acid molecules are at least about 95 nt in length. In some embodiments, the nucleic acid molecules are at least about 100 nt in length. In some embodiments, the nucleic acid molecules are at least about 120 nt in length. In some embodiments, the nucleic acid molecule is at least about 140 nt in length. In some embodiments, the nucleic acid molecule is at least about 160 nt in length. In some embodiments, the nucleic acid molecule is at least about 180 nt in length. In some embodiments, the nucleic acid molecule is at least about 200 nt in length. In some embodiments, the nucleic acid molecule is at least about 250 nt in length. In some embodiments, the nucleic acid molecule is at least about 300 nt in length. In some embodiments, the nucleic acid molecule is at least about 400 nt in length. In some embodiments, the nucleic acid molecule is at least about 500 nt in length. In some embodiments, the nucleic acid molecule is at least about 600 nt in length. In some embodiments, the nucleic acid molecule is at least about 700 nt in length. In some embodiments, the nucleic acid molecule is at least about 800 nt in length. In some embodiments, the nucleic acid molecule is at least about 900 nt in length. In some embodiments, the nucleic acid molecule is at least about 1000 nt in length. In some embodiments, the nucleic acid molecule is at least about 1100 nt in length. In some embodiments, the nucleic acid molecule is at least about 1200 nt in length. In some embodiments, the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the length of the nucleic acid molecule is at least about 1400nt. In some embodiments, the length of the nucleic acid molecule is at least about 1500nt. In some embodiments, the length of the nucleic acid molecule is at least about 1600nt. In some embodiments, the length of the nucleic acid molecule is at least about 1700nt. In some embodiments, the length of the nucleic acid molecule is at least about 1800nt. In some embodiments, the length of the nucleic acid molecule is at least about 1900nt.In some embodiments, the length of the nucleic acid molecule is at least about 2000nt. In some embodiments, the length of the nucleic acid molecule is at least about 2500nt. In some embodiments, the length of the nucleic acid molecule is at least about 3000nt. In some embodiments, the length of the nucleic acid molecule is at least about 3500nt. In some embodiments, the length of the nucleic acid molecule is at least about 4000nt. In some embodiments, the length of the nucleic acid molecule is at least about 4500nt. In some embodiments, the length of the nucleic acid molecule is at least about 5000nt.

[0378] In certain embodiments, the therapeutic payload comprises a vaccine composition as described herein (e.g., a gene vaccine). In some embodiments, the therapeutic payload comprises a compound capable of eliciting immunity against one or more target diseases or diseases. In some embodiments, the target disease is associated with or caused by infection with a pathogen, such as a coronavirus (e.g., 2019-nCoV), influenza virus, measles virus, human papillomavirus (HPV), rabies virus, meningitis virus, pertussis virus, tetanus virus, plague virus, hepatitis virus, and tuberculosis virus. In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a pathogen-specific pathogenic protein or its antigenic fragment or epitope. After being administered to a vaccinated subject, the vaccine allows expression of the encoded pathogenic protein (or its antigenic fragment or epitope), thereby eliciting immunity against the pathogen in the subject.

[0379] In some embodiments, the target disease is associated with or caused by the neoplastic growth of cells (e.g., cancer). In some embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g., mRNA) encoding a tumor-associated antigen (TAA) or an antigenic fragment or epitope thereof that is specific to cancer. Upon administration to a vaccinated subject, the vaccine allows expression of the encoded TAA (or its antigenic fragment or epitope), thereby eliciting immunity against neoplastic cells expressing the TAA in the subject.

[0380] 5'-cap structure

[0381] Without being bound by theory, it is expected that the 5'-cap structure of the polynucleotide participates in nuclear export and increases polynucleotide stability, and binds to mRNA cap binding protein (CBP), which is responsible for polynucleotide stability in the cell and causes translational competence through the formation of mature circular mRNA species through the association of CBP with poly-A binding protein. The 5'-cap structure further facilitates the removal of 5'-proximal introns during mRNA splicing. Therefore, in some embodiments, the nucleic acid molecules of the present disclosure include a 5'-cap structure.

[0382] Nucleic acid molecules can be capped at their 5' ends by the cell's endogenous transcriptional machinery, thereby generating a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the sense nucleotide transcribed at the 5' end. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides at the 5' end of the polynucleotide can also be optionally 2'-O-methylated. 5'-Decapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0383] In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more alterations to the native 5'-cap structure produced by endogenous processes. Without being bound by theory, modifications to the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase the translation efficiency of the polynucleotide.

[0384] Exemplary changes to the natural 5'-cap structure include the creation of a non-hydrolyzable cap structure to prevent decapping and thereby increase the half-life of the polynucleotide. In some embodiments, because cap hydrolysis requires cleavage of the 5'-ppp-5' phosphodiester linkage, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, the vaccinia capping enzyme from New England Biolabs (Ipswich, Mass.) may be used for α-thioguanosine nucleotides to create thiophosphate linkages in the 5'-ppp-5' cap, according to the manufacturer's instructions. Additional modified guanosine nucleotides, such as α-methylphosphonic acid and selenophosphate nucleotides, may be used.

[0385] Additional exemplary alterations to the native 5'-cap structure also include modifications at the 2' and / or 3' position of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen (resulting in the oxygen of the carbocyclic ring) with a methylene moiety (CH2), modifications at the triphosphate bridge portion of the cap structure, or modifications at the nucleobase (G) portion.

[0386] Additional exemplary changes to the natural 5'-cap structure include, but are not limited to, 2'-O-methylation of the ribose sugar at the 5'-terminus of the polynucleotide and / or the 5'-terminal nucleotide at the sugar 2'-hydroxyl group (as described above). A plurality of different 5'-cap structures can be used to produce the 5'-cap of a polynucleotide (e.g., an mRNA molecule). Additional exemplary 5'-cap structures that can be used in conjunction with the present disclosure further include those described in International Patent Publication Nos. WO2008127688, WO2008016473, and WO 2011015347, the entire contents of each of which are incorporated herein by reference.

[0387] In various embodiments, the 5'-terminal cap may comprise a cap analog. Cap analogs are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, which differ in chemical structure from a natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized and / or attached to polynucleotides chemically (i.e., non-enzymatically) or enzymatically.

[0388] For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked via a 5'-5'-triphosphate group, one of which contains an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, i.e., m 7 G-3'mppp-G, which can be equivalently referred to as 3'O-Me-m7G(5')ppp(5')G. The 3'-O atom of another unchanged guanosine is attached to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, i.e., m7Gm-ppp-G).

[0389] In some embodiments, the cap analog can be a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog can be modified with boranophosphate or phophoroselenoate at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Patent No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.

[0390] In some embodiments, the cap analog can be an N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574 for various cap analogs and methods for synthesizing cap analogs; the entire contents of which are incorporated herein by reference). In other embodiments, the cap analog that can be used in conjunction with the nucleic acid molecules of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0391] In various embodiments, the cap analog may comprise a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0392] Without being bound by theory, it is expected that although cap analogs allow simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, along with the structural differences between cap analogs and the natural 5'-cap structure of polynucleotides produced by the cell's endogenous transcription machinery, may lead to reduced translational capacity and cellular stability.

[0393] Therefore, in some embodiments, the nucleic acid molecules of the present disclosure can also be capped after transcription using enzymes to produce a more authentic 5'-cap structure. As used herein, the phrase "more authentic" refers to a feature that closely reflects or mimics an endogenous or wild-type feature in structure or function. That is, a "more authentic" feature better represents endogenous, wild-type, natural or physiological cellular function and / or structure than a synthetic feature or analog of the prior art, or it outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more aspects. Non-limiting examples of more authentic 5'-cap structures that can be used in conjunction with the nucleic acid molecules of the present disclosure are structures that, in particular, have enhanced binding to cap-binding proteins, increased half-life, reduced sensitivity to 5'-endonucleases and / or reduced 5'-decapping compared to synthetic 5'-cap structures known in the art (or compared to wild-type, natural or physiological 5'-cap structures). For example, in some embodiments, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase can generate a classic 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, wherein the cap guanosine contains an N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl group. This structure is referred to as the cap 1 structure. Compared to other 5' cap analog structures known in the art, for example, this cap results in higher translational capacity, cellular stability, and reduced activation of cellular proinflammatory cytokines. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0394] Without being bound by theory, it is contemplated that the nucleic acid molecules of the present disclosure can be capped post-transcriptionally, and because this method is relatively efficient, nearly 100% of the nucleic acid molecules can be capped.

[0395] Untranslated region (UTR)

[0396] In some embodiments, the nucleic acid molecules of the present disclosure include one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region in the nucleic acid molecule and is referred to as a 5'-UTR. In some embodiments, the UTR is located downstream of the coding region in the nucleic acid molecule and is referred to as a 3'-UTR. The sequence of the UTR may be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs may be included in the nucleic acid molecule and may have the same or different sequences and / or gene origins. According to the present disclosure, any portion of the UTR in the nucleic acid molecule (including without any portion) may be codon optimized, and any portion may independently contain one or more different structures or chemical modifications before and / or after codon optimization.

[0397] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are homologous to each other. In other embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are heterologous to each other. In some embodiments, to monitor the activity of UTR sequences, nucleic acid molecules comprising coding sequences of UTRs and detectable probes can be administered in vitro (e.g., in cell or tissue culture) or in vivo (e.g., to a subject), and the effects of the UTR sequences (e.g., regulating expression levels, cellular localization of the encoded product, or half-life of the encoded product) can be measured using methods known in the art.

[0398] In some embodiments, the UTR of the nucleic acid molecules (e.g., mRNA) of the present disclosure includes at least one translation enhancer element (TEE), which plays a role in increasing the amount of the polypeptide or protein produced by the nucleic acid molecules. In some embodiments, the TEE is located in the 5'-UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3'-UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5'-UTR and 3'-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure may include one or more copies of the TEE sequence or include more than one different TEE sequence. In some embodiments, the different TEE sequences present in the nucleic acid molecules of the present disclosure may be homologous or heterologous relative to each other.

[0399] Various TEE sequences are known in the art and can be used in conjunction with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or an IRES element. Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004; Zhou et al., Proc. Natl. Acad. Sci. 102:6273-6278, 2005. Additional internal ribosome entry sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776, and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication No. WO 2007 / 025008 and International Patent Publication No. WO 2001 / 055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the TEE can be a TEE described in Supplementary Table 1 and Supplementary Table 2 of Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8):747-750; the contents of each of which are incorporated herein by reference in their entirety.

[0400] Additional exemplary TEEs that may be used in conjunction with the present disclosure include, but are not limited to, U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. 2009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644 and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, and European Patent No. 2610340, the contents of each of which are incorporated herein by reference in their entirety.

[0401] In various embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure include at least one UTR comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. In some embodiments, the TEE sequence in the nucleic acid molecule UTR is a copy of the same TEE sequence. In other embodiments, at least two TEE sequences in the nucleic acid molecule UTR have different TEE sequences. In some embodiments, a plurality of different TEE sequences are arranged in the UTR district of the nucleic acid molecule with one or more repeat patterns. For illustration purposes only, repetitive pattern can be such as ABABAB, AABBAABBABB, ABCABCABC etc., wherein in these exemplary patterns, each capital letter (A, B or C) represents a different TEE sequence. In some embodiments, in the UTR of a nucleic acid molecule, at least two TEE sequences are continuous to each other (that is, without a spacer sequence therebetween). In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, UTR may include a TEE sequence-spacer sequence module, which is repeated in UTR at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or more than 9 times. In any embodiment described in this paragraph, UTR can be 5'-UTR, 3'-UTR or both 5'-UTR and 3'-UTR of a nucleic acid molecule.

[0402] In some embodiments, the UTR of the nucleic acid molecules (e.g., mRNA) disclosed herein comprises at least one translation inhibition element that acts to reduce the amount of the polypeptide or protein produced by the nucleic acid molecules. In some embodiments, the UTR of the nucleic acid molecules comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences (seed sequence)) recognized by one or more microRNAs. In some embodiments, the UTR of the nucleic acid molecules comprises one or more stem-loop structures that lower the translation activity of the nucleic acid molecules. Other mechanisms for inhibiting the translation activity associated with nucleic acid molecules are known in the art. In any embodiment described in this section, the UTR may be 5'-UTR, 3'-UTR, or both 5'-UTR and 3'-UTR of the nucleic acid molecules.

[0403] Polyadenylation (Poly-A) region

[0404] During natural RNA processing, long chains of adenosine nucleotides (poly-A regions) are typically added to messenger RNA (mRNA) molecules to increase the molecule's stability. Immediately after transcription, the 3'-end of the transcript is cleaved to release the 3'-hydroxyl group. Poly-A polymerase then adds a series of adenosine nucleotides to the RNA. This process, known as polyadenylation, adds a poly-A region between 100 and 250 residues in length. Without being bound by theory, it is contemplated that poly-A regions may confer a number of advantages to the nucleic acid molecules of the present disclosure.

[0405] Therefore, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise a polyadenylation signal. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region is entirely composed of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end and at least one poly-A region at its 3' end.

[0406] According to the present disclosure, in different embodiments, the poly-A region may have different lengths. Specifically, in some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 30 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 35 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 40 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 45 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 50 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 55 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 60 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 65 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 70 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 75 nucleotides. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 95 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 140 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 200 nucleotides in length.In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 300 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 600 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2500 nucleotides in length.In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 3000 nucleotides in length.

[0407] In some embodiments, the length of the poly-A region in a nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (e.g., the length of the coding region of the nucleic acid molecule or the length of the open reading frame, etc.). For example, in some embodiments, the poly-A region comprises about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of the total length of the nucleic acid molecule containing the poly-A region.

[0408] Without being bound by theory, it is contemplated that certain RNA-binding proteins can bind to the poly-A region located at the 3' end of an mRNA molecule. These poly-A binding proteins (PABPs) can regulate mRNA expression, for example, by interacting with the translation initiation machinery in the cell and / or protecting the 3'-poly-A tail from degradation. Thus, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise at least one binding site for a poly-A binding protein (PABP). In other embodiments, the nucleic acid molecule forms a conjugate or complex with the PABP prior to loading it into a delivery vehicle (e.g., a lipid nanoparticle).

[0409] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise poly-AG quadruplexes. A G quadruplex is a circular array of four hydrogen-bonded guanosine nucleotides that can be formed by G-rich sequences in DNA and RNA. In this embodiment, the G quadruplex is incorporated into one end of the poly-A region. The stability, protein yield, and other parameters of the resulting polynucleotide (e.g., mRNA) can be measured, including half-life at different time points. It has been found that the poly-AG quadruplex structure results in a protein yield equivalent to at least 75% of the protein yield observed using a 120-nucleotide poly-A region alone.

[0410] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure may include a poly-A region and may be stabilized by adding a 3'-stabilizing region. In some embodiments, the 3'-stabilizing region that can be used to stabilize nucleic acid molecules (e.g., mRNA) includes a poly-A or poly-AG quadruplex structure as described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety.

[0411] In other embodiments, 3'-stabilizing regions that can be used in conjunction with the nucleic acid molecules of the present disclosure include chain-terminating nucleosides such as, but not limited to, 3'-deoxyadenosine (cordycepin); 3'-deoxyuridine; 3'-deoxycytosine; 3'-deoxyguanosine; 3'-deoxythymidine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine; 2'-deoxynucleosides; or O-methyl nucleosides; 3'-deoxynucleosides; 2',3'-dideoxynucleosides; 3'-O-methyl nucleosides; 3'-O-ethyl nucleosides; 3'-arabinoside, as well as other alternative nucleosides known in the art and / or described herein.

[0412] Secondary structure

[0413] Without being bound by theory, it is expected that the stem-loop structure can guide RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR sequences and / or TEE sequences will change the shape of the stem-loop region, thereby increasing and / or decreasing translation (Kedde et al., APomilio-induced RNA structure switch in p27-3'UTR controls miR-221and miR-222accessibility. Nat Cell Biol., 2010 Oct;12(10):1014-20, the contents of which are incorporated herein by reference in their entirety).

[0414] Therefore, in some embodiments, the nucleic acid molecules described herein (e.g., mRNA) or a portion thereof may be in a stem-loop structure, such as, but not limited to, a histone stem-loop. In some embodiments, the stem-loop structure is formed by a stem-loop sequence having a length of about 25 or about 26 nucleotides, such as, but not limited to, the structure described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include sequences described in International Patent Publication No. WO2012 / 019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the stem-loop sequence comprises TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In specific embodiments, the stem-loop sequence may include a miR-122 seed sequence. In specific embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCC ACCA (SEQ ID NO: 2).

[0415] In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise a stem-loop sequence located upstream of the coding region (at the 5' end) in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5'-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise a stem-loop sequence located downstream of the coding region (at the 3' end) in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule comprises at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.

[0416] In some embodiments, the nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain-terminating nucleoside, which acts to slow degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain-terminating nucleosides that can be used in conjunction with the nucleic acid molecules of the present disclosure include, but are not limited to, 3'-deoxyadenosine (cordycepin); 3'-deoxyuridine; 3'-deoxycytosine; 3'-deoxyguanosine; 3'-deoxythymidine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine; 2'-deoxynucleosides; or O-methyl nucleosides; 3'-deoxynucleosides; 2',3'-dideoxynucleosides; 3'-O-methyl nucleosides; 3'-O-ethyl nucleosides; 3'-arabinoside, as well as other alternative nucleosides known in the art and / or described herein. In other embodiments, the stem-loop structure can be stabilized by altering the 3'-region of the polynucleotide that prevents and / or inhibits the addition of oligo(U) (International Patent Publication No. WO 2013 / 103659, which is herein incorporated by reference in its entirety).

[0417] In some embodiments, the nucleic acid molecules of the present disclosure comprise at least one stem-loop sequence and a poly-A region or a polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-A region or a polyadenylation signal include sequences described in International Patent Publication No. WO2013 / 120497, International Patent Publication No. WO2013 / 120629, International Patent Publication No. WO2013 / 120500, International Patent Publication No. WO2013 / 120627, International Patent Publication No. WO2013 / 120498, International Patent Publication No. WO2013 / 120626, International Patent Publication No. WO2013 / 120499, and International Patent Publication No. WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0418] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal may encode a pathogen antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0419] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120497 and International Patent Publication No. WO2013 / 120629, the contents of each of which are incorporated herein by reference in their entirety.

[0420] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120500 and International Patent Publication No. WO2013 / 120627, the contents of each of which are incorporated herein by reference in their entirety.

[0421] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or polyadenylation signal may encode a sensitizing antigen or an autoimmune autoantigen, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120498 and International Patent Publication No. WO2013 / 120626, the contents of each of which are incorporated herein by reference in their entirety.

[0422] Functional nucleotide analogs

[0423] In some embodiments, the payload nucleic acid molecules described herein contain only canonical nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is expected that certain functional nucleotide analogs can confer useful properties on nucleic acid molecules. In the context of the present disclosure, examples of such useful properties include, but are not limited to, increased stability of the nucleic acid molecule, reduced immunogenicity of the nucleic acid molecule in inducing an innate immune response, increased production of the protein encoded by the nucleic acid molecule, increased intracellular delivery and / or retention of the nucleic acid molecule, and / or reduced cytotoxicity of the nucleic acid molecule, etc.

[0424] Thus, in some embodiments, the payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification to a nucleobase, a sugar group, and / or a phosphate group. Thus, the payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification to a nucleobase, a sugar group, and / or an internucleoside linkage. Exemplary chemical modifications to a nucleobase, a sugar group, or an internucleoside linkage of a nucleic acid molecule are provided herein.

[0425] As described herein, 0% to 100% of the nucleotides in the payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the functional nucleotide analogs can be present at any position of the nucleic acid molecule, including the 5'-end, the 3'-end and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (eg, backbone structures).

[0426] As described herein, ranging from 0% to 100% of all nucleotides of one type (e.g., all purine-containing nucleotides as a type, or all pyrimidine-containing nucleotides as a type, or all A, G, C, T, or U as a type) in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In any one of these embodiments, the functional nucleotide analogs can be present at any position of the nucleic acid molecule, including the 5'-end, the 3'-end and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (eg, backbone structures).

[0427] Nucleobase modification

[0428] In some embodiments, functional nucleotide analogs contain non-classical nucleobases. In some embodiments, the classical nucleobases in a nucleotide (e.g., adenine, guanine, uracil, thymine, and cytosine) can be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused rings or ring opening, oxidation, and / or reduction.

[0429] In some embodiments, the non-classical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides with modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halouracil (e.g., 5-iodouracil or 5-bromouracil), 3-methyluracil (m 3 U), 5-methoxyuracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracil 5-oxyacetate (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thiouracil (nm 5 s 2 U), 5-methylaminomethyluracil (mnm 5 U), 5-methylaminomethyl-2-thiouracil (mnm 5 s 2 U), 5-methylaminomethyl-2-selenouracil (mnm 5 se 2 U), 5-carbamoylmethyluracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurine methyl-uracil (τm 5 U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uracil (τm 5 5s 2 U), 1-taurine methyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., with the nucleobase deoxythymidine), 1-methyl-pseudouridine (m1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl) uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl) pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (m 5 U), 5-(isopentenylaminomethyl)-2-thio-uracil (m 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um) and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-methoxycarbonylvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5-[3-(1-E-propenylamino)]uracil.

[0430] In some embodiments, the non-classical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-azacytosine, 6-azacytosine, pseudoisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolocytosine, pyrrolopseudoisocytidine, 2-thiocytosine (s2C), 2-thio-5-methylcytosine, 4-thiopseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5- -aza-zebulin, 5-methyl-zebulin, 5-aza-2-thio-zebulin, 2-thio-zebulin, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4-ethyl Acyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (fSCm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine and 5-(2-azidoethyl)-cytosine.

[0431] In some embodiments, the non-classical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with alternative adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza -2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycylcarbamyl N6-methyl-N6-threonylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A) , 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxahedronadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine and N6-hydroxymethyl-adenine.

[0432] In some embodiments, the non-classical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanines include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methyl wyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*), 7-deaza- Guanine, queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine (galQ), mannosylqueuosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6- Thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine and O-6-methyl-guanine.

[0433] In some embodiments, the non-classical nucleobase of the functional nucleotide analog can independently be a purine, a pyrimidine, a purine analog, or a pyrimidine analog. For example, in some embodiments, the non-classical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-classical nucleobases may also include, for example, naturally occurring and synthetic derivatives of bases, including pyrazolo[3,4-d]pyrimidine; 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2-thiocytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halogenated (e.g., 8-bromo), 8-amino, 8-thiol , 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines; 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; deazaguanine, 7-deazaguanine, 3-deazaguanine; deazaadenine, 7-deazaadenine, 3-deazaadenine; pyrazolo[3,4-d]pyrimidine; imidazo[1,5-a]1,3,5-triazinone; 9-deazapurine; imidazo[4,5-d]pyrazine; thiazolo[4,5-d]pyrimidine; pyrazin-2-one; 1,2,4-triazine; pyridazine; or 1,3,5-triazine.

[0434] Sugar modification

[0435] In some embodiments, the functional nucleotide analogs contain non-classical sugar groups. In various embodiments, the non-classical sugar group can be a 5- or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) having one or more substitutions, such as halogen, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, etc.

[0436] In general, RNA molecules contain a ribose moiety that is an oxygen-containing 5-membered ring. Exemplary non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or an alkylene group, such as a methylene or ethylene group); addition of a double bond (e.g., replacement of ribose with a cyclopentenyl or cyclohexenyl group); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring with additional carbon or heteroatoms, such as for anhydrohexitol, altritol, mannitol, cyclohexane, cyclohexane, etc.); hexenyl and N-morpholinyl (which also have a phosphoramidate backbone); polycyclic forms (e.g., tricyclic and "unlocked" forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which the ribose is replaced by a glycol unit linked to a phosphodiester linkage), threose nucleic acids (TNA, in which the ribose is replaced by an α-L-threofuranosyl-(3'→2')) and peptide nucleic acids (PNA, in which a 2-amino-ethyl-glycine linkage replaces the ribose and phosphodiester backbone)).

[0437] In some embodiments, the sugar group contains one or more carbons that have a stereochemical configuration opposite to the corresponding carbon in ribose. Thus, a nucleic acid molecule can include nucleotides containing, for example, arabinose or L-ribose as a sugar. In some embodiments, a nucleic acid molecule includes at least one nucleoside wherein the sugar is L-ribose, 2'-O-methyl ribose, 2'-fluororibose, arabinose, a hexitol, LNA, or PNA.

[0438] Modification of internucleoside linkages

[0439] In some embodiments, the payload nucleic acid molecules of the present disclosure may contain one or more modified internucleoside linkages (e.g., phosphate backbones). The backbone phosphate groups may be altered by replacing one or more oxygen atoms with different substituents.

[0440] In some embodiments, functional nucleotide analogs can include another internucleoside linkage replacement unaltered phosphate moiety as described herein.The example of alternative phosphate groups includes but is not limited to phosphorothioate, phosphoroselenoate, borane phosphate, borane phosphate, hydrogen phosphonate, phosphoramidate, diamino phosphoroate, alkyl or aryl phosphonate and phosphotriester.Two non-connected oxygens of dithiophosphate are all replaced through sulphur.It is also possible to change phosphate joint by connecting oxygen with nitrogen (phosphoramidate of bridging), sulphur (phosphorothioate of bridging) and carbon (methylene phosphonate of bridging) replacement.

[0441] Alternative nucleosides and nucleotides can include one or more non-bridging oxygens replaced by a borane moiety (BH3), sulfur (thio), methyl, ethyl and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., alpha (α), beta (β) or gamma (γ) position) can be replaced by sulfur (thio) and methoxy. One or more oxygen atoms at the position of a replacement phosphate moiety (e.g., α-phosphorothioate) can impart RNA and DNA stability (e.g., stability against exonucleases and endonucleases) via non-natural thiophosphate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore have a longer half-life in a cellular environment.

[0442] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom.

[0443] Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations, and / or methods that can be used in conjunction with the present disclosure further include WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, , WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326 , WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, W O2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO The contents of each of the foregoing are incorporated herein in their entirety.

[0444] 6.5 Preparation

[0445] According to the present disclosure, the nanoparticle compositions described herein can include at least one lipid component and one or more additional components, such as therapeutic and / or prophylactic agents. Nanoparticle compositions can be designed for one or more specific applications or goals. The ingredients of the nanoparticle composition can be selected based on the specific application or goal, and / or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more ingredients. Similarly, the specific formulation of the nanoparticle composition can be selected for a specific application or goal based on, for example, the efficacy and toxicity of a specific combination of each ingredient.

[0446] The lipid component of the nanoparticle composition can include, for example, lipids according to one of formula (I), (II) or (III) (and subformulas thereof) as described herein, phospholipids (e.g., unsaturated lipids such as DOPE or DSPC), PEG lipids, and structural lipids. The components of the lipid component can be provided in specific fractions.

[0447] In one embodiment, a nanoparticle composition is provided herein, comprising a cationic or ionizable lipid compound, a therapeutic agent, and one or more excipients as provided herein. In one embodiment, the cationic or ionizable lipid compound comprises a compound according to one of formulas (I), (II), or (III) (and subformulas thereof) as described herein, and optionally one or more additional ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids. In one embodiment, the therapeutic agent is encapsulated in or associated with the lipid nanoparticles.

[0448] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:

[0449] i) 40 mol% to 50 mol% of a cationic lipid;

[0450] ii) neutral lipids;

[0451] iii) steroids;

[0452] iv) polymer-bound lipids; and

[0453] v) Therapeutic agents.

[0454] As used herein, "molar percentage" refers to the molar percentage of a component relative to the total moles of all lipid components in the LNP (ie, the total moles of cationic lipids, neutral lipids, steroids, and polymer-bound lipids).

[0455] In one embodiment, the lipid nanoparticles comprise 41 to 49 mol%, 41 to 48 mol%, 42 to 48 mol%, 43 to 48 mol%, 44 to 48 mol%, 45 to 48 mol%, 46 to 48 mol%, or 47.2 to 47.8 mol% of cationic lipids. In one embodiment, the lipid nanoparticles comprise about 47.0 mol%, 47.1 mol%, 47.2 mol%, 47.3 mol%, 47.4 mol%, 47.5 mol%, 47.6 mol%, 47.7 mol%, 47.8 mol%, 47.9 mol%, or 48.0 mol% of cationic lipids.

[0456] In one embodiment, the neutral lipid is present at a concentration within the range of 5 to 15 mole %, 7 to 13 mole %, or 9 to 11 mole %. In one embodiment, the neutral lipid is present at a concentration of about 9.5 to 10 mole %, or 10.5 mole %. In one embodiment, the molar ratio of cationic lipid to neutral lipid is within the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.

[0457] In one embodiment, the steroid is present at a concentration within the range of 39 to 49 mole %, 40 to 46 mole %, 40 to 44 mole %, 40 to 42 mole %, 42 to 44 mole % or 44 to 46 mole %. In one embodiment, the steroid is present at a concentration of 40 to 41 mole %, 42 to 43 mole %, 44 to 45 mole % or 46 mole %. In one embodiment, the steroid is present at a concentration of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.

[0458] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the number of moles of cationic lipid and P represents the number of moles of phosphate present as part of the nucleic acid backbone) is in the range of 2: 1 to 30: 1, for example, in the range of 3: 1 to 22: 1. In one embodiment, N / P is in the range of 6: 1 to 20: 1 or 2: 1 to 12: 1. Exemplary N / P ranges include about 3: 1, about 6: 1, about 12: 1, and about 22: 1.

[0459] In one embodiment, provided herein is a lipid nanoparticle comprising:

[0460] i) a cationic lipid having an effective pKa greater than 6.0; ii) 5 mol% to 15 mol% of a neutral lipid;

[0461] iii) 1 mol% to 15 mol% of anionic lipids;

[0462] iv) 30 mol% to 45 mol% of a steroid;

[0463] v) polymer-bound lipids; and

[0464] vi) a therapeutic agent, or a pharmaceutically acceptable salt or prodrug thereof,

[0465] The mole percentages are based on the total moles of lipid present in the lipid nanoparticles.

[0466] In one embodiment, the cationic lipid can be any of a variety of lipid species that have a net positive charge at a selected pH, such as physiological pH. Exemplary cationic lipids are described below. In one embodiment, the pKa value of the cationic lipid is greater than 6.25. In one embodiment, the pKa value of the cationic lipid is greater than 6.5. In one embodiment, the pKa value of the cationic lipid is greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.

[0467] In one embodiment, the lipid nanoparticles comprise 40 mol% to 45 mol% cationic lipids. In one embodiment, the lipid nanoparticles comprise 45 mol% to 50 mol% cationic lipids.

[0468] In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 2: 1 to about 8: 1. In one embodiment, the lipid nanoparticles comprise 5 mol% to 10 mol% neutral lipid.

[0469] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), or 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).

[0470] In one embodiment, the lipid nanoparticles comprise 1 to 10 mol% of anionic lipids. In one embodiment, the lipid nanoparticles comprise 1 to 5 mol% of anionic lipids. In one embodiment, the lipid nanoparticles comprise 1 to 9 mol%, 1 to 8 mol%, 1 to 7 mol%, or 1 to 6 mol% of anionic lipids. In one embodiment, the molar ratio of anionic lipids to neutral lipids is in the range of 1:1 to 1:10.

[0471] In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the lipid nanoparticles comprise 32 mol% to 40 mol% of the steroid.

[0472] In one embodiment, the sum of the mole percent of neutral lipids and the mole percent of anionic lipids is in the range of 5 mole percent to 15 mole percent. In one embodiment, the sum of the mole percent of neutral lipids and the mole percent of anionic lipids is in the range of 7 mole percent to 12 mole percent.

[0473] In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1: 1 to 1: 10. In one embodiment, the sum of the molar percentage of neutral lipid and the molar percentage of steroid is in the range of 35 mol% to 45 mol%.

[0474] In one embodiment, the lipid nanoparticle comprises:

[0475] i) 45 mol% to 55 mol% of a cationic lipid;

[0476] ii) 5 mol% to 10 mol% neutral lipids;

[0477] iii) 1 mol% to 5 mol% of anionic lipids; and

[0478] iv) 32 mol% to 40 mol% of a steroid.

[0479] In one embodiment, the lipid nanoparticles comprise 1.0 mol% to 2.5 mol% polymer-bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.

[0480] In one embodiment, the neutral lipid is present at a concentration within the range of 5 to 15 mole %, 7 to 13 mole %, or 9 to 11 mole %. In one embodiment, the neutral lipid is present at a concentration of about 9.5 to 10 mole %, or 10.5 mole %. In one embodiment, the molar ratio of cationic lipid to neutral lipid is within the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.

[0481] In one embodiment, the steroid is cholesterol. In some embodiments, the steroid exists with a concentration within the range of 39 to 49 mole %, 40 to 46 mole %, 40 to 44 mole %, 40 to 42 mole %, 42 to 44 mole % or 44 to 46 mole %. In one embodiment, the steroid exists with a concentration of 40 to 41 mole %, 42 to 43 mole %, 44 to 45 mole % or 46 mole %. In certain embodiments, the molar ratio of cationic lipid to steroid is within the range of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2.

[0482] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 5:1 to 1:1.

[0483] In one embodiment, the lipid nanoparticles comprise 1.0 mol% to 2.5 mol% polymer-bound lipid. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol%.

[0484] In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 100: 1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to polymer-bound lipid is in the range of about 35: 1 to about 25: 1.

[0485] In one embodiment, the average diameter of the lipid nanoparticles is in the range of 50 nm to 100 nm or 60 nm to 85 nm.

[0486] In one embodiment, the composition comprises cationic lipid, DSPC, cholesterol and PEG-lipid provided herein, and mRNA. In one embodiment, the molar ratio of cationic lipid, DSPC, cholesterol and PEG-lipid provided herein is about 50:10:38.5:1.5.

[0487] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed for delivering therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs, or systems or groups thereof in a mammal. The physicochemical properties of the nanoparticle compositions can be altered to increase selectivity for specific body targets. For example, the particle size can be adjusted based on the window size of different organs. The therapeutic and / or prophylactic agents contained in the nanoparticle compositions can also be selected based on one or more desired delivery targets. For example, the therapeutic and / or prophylactic agents can be selected for specific indications, illnesses, diseases, or conditions and / or for delivery to specific cells, tissues, organs, or systems or groups thereof (e.g., local or specific delivery). In certain embodiments, the nanoparticle compositions can include mRNA encoding a polypeptide of interest that can be translated intracellularly to produce the polypeptide of interest. Such compositions can be designed for specific delivery to specific organs. In certain embodiments, the compositions can be designed for specific delivery to the liver of a mammal.

[0488] In nanoparticle compositions, the amount of therapeutic and / or prophylactic agent can depend on the size, composition, desired target and / or application of nanoparticle compositions, or other characteristics, and the characteristic of therapeutic and / or prophylactic agent. For example, the amount of RNA that can be used in nanoparticle compositions can depend on the size, sequence and other characteristics of RNA. The relative amounts of therapeutic and / or prophylactic agent and other ingredients (such as lipid) can also change in nanoparticle compositions. In some embodiments, the wt / wt ratio of lipid component and therapeutic and / or prophylactic agent in nanoparticle compositions can be about 5:1 to about 60:1, for example, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1 and 60:1. For example, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent can be about 10: 1 to about 40: 1. In certain embodiments, the wt / wt ratio is about 20: 1. The amount of the therapeutic and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., UV-visible spectroscopy).

[0489] In some embodiments, the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a specific N:P ratio. The N:P ratio of a composition refers to the molar ratio of the nitrogen atoms in the one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. The one or more RNAs, lipids, and amounts thereof can be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio can be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio may be about 5.0: 1, about 5.5: 1, about 5.67: 1, about 6.0: 1, about 6.5: 1, or about 7.0: 1. For example, the N:P ratio may be about 5.67:1.

[0490] The physical properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipid can have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipid. Characteristics can also vary depending on the method and conditions used to prepare the nanoparticle composition.

[0491] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle compositions. Zeta potential can be measured using dynamic light scattering or potentiometric methods (e.g., potentiometric titration). Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malverm Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of the nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0492] In various embodiments, the nanoparticle composition can have an average size ranging from tens of nanometers to hundreds of nanometers. For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the nanoparticle composition may have an average size of about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the nanoparticle composition may have an average size of about 70 nm to about 100 nm. In some embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

[0493] The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the uniformity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be from about 0.10 to about 0.20.

[0494] The zeta potential of a nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because higher charged species can interact undesirably with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0495] The encapsulation efficiency of a therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent encapsulated or otherwise associated with a nanoparticle composition after preparation relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after disrupting the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0496] The nanoparticle compositions can optionally include one or more coatings. For example, the nanoparticle compositions can be formulated into capsules, films, or tablets having a coating. The capsules, films, or tablets containing the compositions described herein can have any useful size, tensile strength, hardness, or density.

[0497] 6.6 Pharmaceutical Compositions

[0498] According to the present disclosure, nanoparticle compositions can be formulated, in whole or in part, into pharmaceutical compositions. A pharmaceutical composition can comprise one or more nanoparticle compositions. For example, a pharmaceutical composition can comprise one or more nanoparticle compositions comprising one or more different therapeutic and / or prophylactic agents. The pharmaceutical composition can further comprise one or more pharmaceutically acceptable excipients or adjuvants, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents can be found, for example, in Remington's The Science and Practice of Pharmacy, 21st ed., AR Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and adjuvants can be used in any pharmaceutical composition, unless any conventional excipient or adjuvant is incompatible with one or more components of the nanoparticle composition. An excipient or adjuvant is incompatible with a component of the nanoparticle composition if the combination of the excipient or adjuvant with the component of the nanoparticle composition would result in any undesirable biological or other deleterious effect.

[0499] In some embodiments, the one or more excipients or adjuvants may constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, the one or more excipients or adjuvants may constitute 50%, 60%, 70%, 80%, 90% or more of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and / or the International Pharmacopoeia.

[0500] The relative amounts of the one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated and further on the route of administration of the composition. For example, a pharmaceutical composition may comprise between 0.1% and 100% (wt / wt) of the one or more nanoparticle compositions.

[0501] In some embodiments, nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are stored and / or shipped refrigerated or frozen (for example, at 4°C or lower, for example, between about -150°C and about 0°C or between about -80°C and about -20°C (for example, about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C)). For example, a pharmaceutical composition comprising a compound of any of Formula (I), (II), or (III) (and subformulae thereof) is a solution that is stored and / or shipped refrigerated at, for example, about -20°C, 30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the disclosure is also directed to a method of increasing the stability of a nanoparticle composition and / or a pharmaceutical composition comprising a compound of any of Formula (I), (II), or (III) (and subformulae thereof) by storing the nanoparticle composition and / or pharmaceutical composition at 4°C or lower, for example, between about -150°C and about 0°C, or between about -80°C and about -20°C, for example, at about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months at a temperature of, for example, 4° C. or less (e.g., between about 4° C. and −20° C.). In one embodiment, the formulation is stable for at least 4 weeks at about 4° C. In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of: Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain embodiments, the pH of the pharmaceutical compositions of the present disclosure is between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and has a pH of about 7.5-8, which is suitable for storage and / or transportation at, for example, about -20°C.For example, a pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and PBS and has a pH of about 7-7.8, which is suitable for storage and / or transportation at, for example, about 4° C. or lower. In the context of the present disclosure, “stability,” “stabilization,” and “stable” refer to the nanoparticle composition and / or pharmaceutical composition disclosed herein being resistant to chemical or physical changes (e.g., degradation, particle size changes, aggregation, changes in encapsulation, etc.) under given manufacturing, preparation, transportation, storage, and / or use conditions, for example, when stress, such as shear force, freeze / thaw stress, etc., is applied.

[0502] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including patients or subjects who may benefit from the therapeutic effects provided by delivering a therapeutic and / or prophylactic agent to one or more specific cells, tissues, organs, or systems or groups thereof, such as the renal system. Although the descriptions of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions provided herein are primarily directed to compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Modifications to compositions suitable for administration to humans in order to make the compositions suitable for administration to various animals are well known, and such modifications can be designed and / or performed by a veterinary pharmacologist of ordinary skill with only ordinary experimentation (if any). It is contemplated that subjects to whom the compositions may be administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0503] Pharmaceutical compositions comprising one or more nanoparticle compositions can be prepared by any method known or later developed in the art of pharmacology. Generally, such preparation methods comprise combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if desired or necessary, dividing, shaping, and / or packaging the product into desired single-dose or multi-dose units.

[0504] Pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient is generally equal to the dose of the active ingredient to be administered to a subject and / or a convenient fraction of such a dose, such as half or one-third of such a dose.

[0505] Pharmaceutical compositions can be prepared into various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared into liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0506] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and / or elixirs. In addition to the active ingredient, the liquid dosage form may also contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and sorbitan fatty acid esters, and mixtures thereof. In addition to inert diluents, oral compositions may also contain additional therapeutic and / or prophylactic agents, additional agents such as wetting agents, emulsifiers and suspending agents, sweeteners, flavorings and / or flavoring agents. In certain embodiments for parenteral administration, the composition is mixed with a solubilizer, such as Cremophor TM , alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers and / or combinations thereof.

[0507] Injectable preparations, such as sterile injectable aqueous or oily suspensions, can be prepared according to known techniques using suitable dispersants, wetting agents and / or suspending agents. Sterile injectable preparations can be sterile injectable solutions, suspensions and / or emulsions in non-toxic parenteral acceptable diluents and / or solvents, such as solutions in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution (USP) and isotonic sodium chloride solution. Sterile fixed oils are typically used as solvents or suspending media. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid can be used to prepare injections.

[0508] The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0509] The present disclosure features methods of delivering therapeutic and / or prophylactic agents to mammalian cells or organs, producing polypeptides of interest in mammalian cells, and treating a disease or condition in a mammal in need thereof, the methods comprising administering to the mammal a nanoparticle composition comprising the therapeutic and / or prophylactic agent and / or contacting mammalian cells with the nanoparticle composition.

[0510] 7. Examples

[0511] The examples in this section are provided by way of example only, not by way of limitation.

[0512] General method.

[0513] General Preparative HPLC Methods: HPLC purifications were performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, typically using water with 0.1% TFA as solvent A and acetonitrile as solvent B.

[0514] General LCMS methods: LCMS analysis was performed on a Shimadzu (LC-MS 2020) system. Chromatography was performed on a SunFire C18 system, typically using water containing 0.1% formic acid as solvent A and acetonitrile containing 0.1% formic acid as solvent B.

[0515] 7.1 Example 1: Preparation of starting materials and intermediates.

[0516] Preparation of Compound A

[0517]

[0518] Preparation of compound B

[0519]

[0520] Preparation of compound C

[0521]

[0522] Preparation of compound D

[0523]

[0524] Preparation of Compound E

[0525]

[0526] Preparation of compound F

[0527]

[0528] To a solution of compound B (446.0 mg, 1.0 mmol, 1.0 equivalent) and ethanolamine (180.0 mg, 3.0 mmol, 3.0 equivalents) dissolved in ACN (10.0 mL) was added CsCO (97.5 mg, 0.3 mmol, 0.3 equivalents), KCO (414.0 mg, 3.0 mmol, 3.0 equivalents) and NaI (14.6 mg, 0.1 mmol, 0.1 equivalents) at room temperature. The mixture was stirred at 85 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was evaporated under reduced pressure and purified by FCC (DCM / MeOH=1 / 0-20 / 1) to provide compound F (0.35 g, 82% yield) as a yellow oil.

[0529] Preparation of Compound G

[0530]

[0531] Step 1: Preparation of compound G-1

[0532] To a solution of compound A (1.87 g, 12.38 mmol) in EtOH (50 mL) was added 2-(benzyloxy)ethane-1-amine (2.0 g, 8.25 mmol). The reactants were stirred at room temperature for 12 hours. The reaction mixture was concentrated in vacuo and purified by flash column chromatography (CH2Cl2:MeOH=10:1) to give the target product (1.4 g, yield: 43%) as a yellow oil. LCMS: Rt: 0.824 min; MS m / z (ESI): 394.3 [M+H] + .

[0533] Step 2: Preparation of Compound G

[0534] To a solution of compound G-1 (1.4 g, 3.56 mmol) in CH 3 CN (50 mL) was added K 2 CO 3 (1.47 g, 10.67 mmol), Cs 2 CO 3 (350 mg, 1.07 mmol), NaI (160 mg, 1.07 mmol) and compound B (2.24 g, 5.34 mmol). The reactants were stirred at 80 ° C for 10 hours. The reaction mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (CH 2 Cl 2 : MeOH = 20: 1) to give the target product (2.0 g, yield: 76%) as a yellow oil. LCMS: Rt: 1.750 min; MS m / z (ESI): 732.6 [M + H] + .

[0535] Preparation of compound H

[0536]

[0537] Preparation of Compound I

[0538]

[0539] Preparation of Compound J

[0540]

[0541] To a solution of compound H-1 (2.0 g, 4.0 mmol, 1.0 equiv) in DMF (40 mL) was added NaH (320 mg, 8.0 mmol, 2.0 equiv) at room temperature. The mixture was stirred at room temperature for 1 hour. 1-iodohexane (1.7 g, 8.0 mmol, 2.0 equiv) and NaI (120 mg, 0.8 mmol, 0.2 equiv) were then added. The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (PE / EA = 40 / 1) to give the title compound (1.2 g, 52% yield) as a yellow oil. LCMS: Rt: 1.070 min; MS m / z (ESI): 584.4 [M + H] + .

[0542] Preparation of compound K

[0543]

[0544] Preparation of Compound M

[0545]

[0546] Step 1: Preparation of compound M-2

[0547] To a solution of compound M-1 (30.0 g, 98.25 mmol) in DMF (800 mL) was added NaCN (9.63 g, 196.5 mmol). The reactants were stirred at 60 ° C for 10 hours. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 × 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and concentrated in vacuo. The crude product was purified by flash column chromatography (EtOAc: PE = 1: 20) to give the target product (18.3 g, yield: 74%) as a yellow oil.

[0548] Step 2: Preparation of Compound M-3

[0549] To a solution of compound M-2 (17.0 g, 67.61 mmol) in EtOH (200 mL) was added HSO (40 mL). The reaction was stirred at 90°C for 48 hours. The reaction mixture was poured into water (500 mL) and extracted with EtOAc (3 x 500 mL). The combined organic layers were washed with brine, dried over anhydrous NaSO, and concentrated in vacuo to afford the desired product (15 g, 75% yield) as a yellow oil.

[0550] Step 3: Preparation of Compound M-4

[0551] To a solution of compound M-3 (14 g, 46.90 mmol) in MeOH (240 mL) and H2O (60 mL) was added LiOH.H2O (9.84 g, 234.5 mmol). The reactants were stirred at 50 ° C for 10 hours. The reaction mixture was concentrated in vacuo to give the target product. The crude product was dissolved in water. The residue was adjusted to pH = 2 with 6M HCl and extracted with EtOAc (3 × 500 mL). The combined organic layers were washed with brine, dried over anhydrous Na2SO4, and concentrated in vacuo to give the target product (15 g, yield: 75%) as a yellow oil.

[0552] Step 4: Preparation of Compound M

[0553] To a solution of compound M-4 (1.0 g, 4.0 mmol) in DCM (10 mL) was added SOCl2 (0.9 g, 8.0 mmol). The reaction was stirred at 35°C for 2 hours. The solvent was removed to give compound M (1.2 g, crude) as a brown oil.

[0554] Preparation of compound N

[0555]

[0556] Preparation of compound O

[0557]

[0558] Preparation of compound P

[0559]

[0560] Preparation of compound Q

[0561]

[0562] Step 1: Preparation of compound Q-1

[0563] At 0 ° C under N2, dimethyl malonate (4 g, 30 mmol, 1.0 equivalent) was added to a mixture of NaH (3 g, 74.07 mmol, 2.5 equivalents) in DMF (30 mL). The reaction mixture was stirred at 0 ° C for 0.5 hours. 1-iodohexane (16 g, 75 mmol, 2.5 equivalents) in DMF (30 ml) was added thereto. The reaction mixture was stirred at room temperature for 16 hours. TLC showed that the reaction was complete. The mixture was poured into water and washed with EA. The combined organic layers were separated and dried over Na2SO4. The solvent was removed and FCC was used to obtain compound Q-1 (5.4 g, 59.92%) as a brown oil.

[0564] 1 H NMR (400MHz, CCl3D): δ: 3.70 (s, 6H), 1.88-1.84 (m, 4H), 1.63 (s, 1H), 1.27 (s, 10H), 1.13 (s, 5H), 0.88-0.86 (m, 6H).

[0565] Step 2: Preparation of compound Q-2

[0566] To a solution of compound Q-1 (5.4 g, 17.97 mmol, 1.0 equiv) in DMF (100 mL) was added LiCl (7.6 g, 179.7 mmol, 10.0 equiv). The reaction mixture was stirred at 120 ° C for 12 hours. TLC showed that the reaction was complete. The mixture was poured into water and washed with EA. The combined organic layer was separated and dried over Na2SO4. The solvent was removed and FCC was used to obtain compound Q-2 (3.1 g, 71.17%) as a brown oil.

[0567] 1 H NMR (400MHz, CCl3D): δ: 3.67 (s, 3H), 2.35-2.31 (m, 1H), 1.61-1.54 (m, 2H), 1.47-1.40 (m, 2H), 1.26 (s, 16H), 0.89-0.86 (m, 6H).

[0568] Step 3: Preparation of compound Q-3

[0569] To a solution of compound Q-2 (3.1 g, 12.79 mmol, 1.0 equivalent) in THF (100 mL) was slowly added LiAlH4 (972 mg, 25.58 mmol, 2.0 equivalents) at 0 ° C. The reaction mixture was stirred at reflux for 1 hour. TLC showed that the reaction was complete. After cooling to 0 ° C, the mixture was quenched by continuously adding water (1.3 ml), 15% NaOH aqueous solution (1.3 ml) and water (3.9 ml). The resulting mixture was diluted with EA and the precipitate was removed by titration. The filtrate was evaporated under reduced pressure, and FCC gave compound Q-3 (2.7 g, 98.46%) as a yellow oil.

[0570] 1 H NMR (400MHz, CCl3D): δ: 3.54 (d, J = 5.2Hz, 2H), 1.47-1.43 (m, 2H), 1.28 (s, 20H), 0.90-0.87 (m, 6H).

[0571] Step 4: Preparation of Compound Q

[0572] To a solution of compound Q-3 (1 g, 4.664 mmol, 1.0 equiv) in DCM (15 mL) was added 6-bromohexanoic acid (1.1 g, 5.597 mmol, 1.2 equiv), EDCI (1.34 g, 6.996 mmol, 1.5 equiv), DMAP (114 mg, 0.9328 mmol, 0.2 equiv), DIEA (1.2 g, 9.328 mmol, 2.0 equiv). The reaction mixture was stirred at 50 ° C for 16 hours. TLC showed that the reaction was complete. The solvent was removed and FCC gave compound Q (650 mg, 35.61%) as a yellow oil.

[0573] Preparation of compound SM2

[0574]

[0575] Preparation of compound R

[0576]

[0577] Preparation of compound S

[0578]

[0579] Preparation of compound SM5

[0580]

[0581] Step 1: Preparation of compound SM5-3

[0582] To a solution of compound SM5-1 (5 g, 47.56 mmol, 1.0 eq.) in MeOH (200 mL) was added compound SM5-2 (9.33 g, 95.11 mmol, 2.0 eq.) and Pd / C (1.0 g). The mixture was stirred at room temperature under H2 for 10 hours. The mixture was filtered, concentrated, and purified by silica gel column chromatography (DCM / MeOH=10 / 1) to give the title compound (5.0 g, 56% yield) as a colorless oil.

[0583] Step 2: Preparation of compound SM5

[0584] To a solution of compound SM5-3 (500 mg, 2.67 mmol, 1.0 equiv) and DIPEA (690 mg, 5.34 mmol, 2.0 equiv) in DCM (20 mL) was added MsCl (305 mg, 2.67 mmol, 1.0 equiv). The mixture was stirred at room temperature for 2 hours. The mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated to give the title compound (450 mg, 63% yield) as a yellow oil. It was used in the next step without further purification.

[0585] Preparation of compound SM6

[0586]

[0587] 7.2 Example 2: Preparation of Compound 1.

[0588]

[0589] Step 1: Preparation of compound 1-1

[0590] A mixture of cyclobutanone (463 mg, 6.6 mmol, 1.0 equiv), 2-(benzyloxy)ethyl-1-amine (1.0 g, 6.6 mmol, 1.0 equiv) and titanium tetraisopropoxide (2.3 g, 7.9 mol, 1.2 equiv) in methanol (50 mL) was stirred at room temperature under argon for 16 hours. Sodium borohydride (250 mg, 6.6 mmol, 1.0 equiv) was then added, and the resulting mixture was stirred for another 2 hours. LCMS showed that the reaction was complete. The reactant was quenched with water, then filtered through a celite pad and washed with MeOH. The filtrate was concentrated and extracted with EA. The combined organic layers were dried over Na2SO4 and evaporated under reduced pressure and purified by silica gel column chromatography (DCM / MeOH=50 / 1) to give the title compound (930 mg, 69% yield) as a yellow oil. LCMS: Rt: 0.750 min; MS m / z (ESI): 206.2 [M+H] + .

[0591] Step 2: Preparation of compound 1-2

[0592] To a solution of compound A (915 mg, 3.77 mmol, 1.0 eq) in EtOH (40 mL) was added compound 1-1 (930 mg, 4.53 mmol, 1.2 eq). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was evaporated under reduced pressure and purified by silica gel column chromatography (DCM / MeOH=100 / 1) to give the title compound (920 mg, 54%) as a yellow oil. LCMS: Rt: 0.870 min; MS m / z (ESI): 448.3 [M+H] + .

[0593] Step 3: Preparation of compound 1-3

[0594] To a stirred solution of compound 1-2 (500 mg, 1.12 mmol, 1.0 equiv) in DMF (10 mL) was added NaH (58 mg, 1.46 mmol, 1.3 equiv) at 0 ° C. The mixture was stirred at room temperature for 2 hours. 1-bromododecane (416 mg, 1.68 mmol, 1.5 equiv) was then added to this mixture. The mixture was stirred at 120 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was poured into water (20 mL) and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (PE / EA=2 / 1) to give the title compound (300 mg, 43% yield) as a yellow oil. LCMS: Rt: 1.360 min; MS m / z (ESI): 616.5 [M+H] + .

[0595] Step 4: Preparation of compound 1

[0596] To a solution of 1-3 (300 mg, 0.48 mmol, 1.0 equivalent) in MeOH (10 mL) was added Pd / C (64 mg) and concentrated HCl (4 drops). The mixture was stirred at room temperature under H for 2 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and purified by preparative HPLC to give the title compound (16 mg, 6.5% yield) as a yellow oil.

[0597] 1H NMR(400MHz, CDCl3)δ: 0.79-0.83(m,6H),1.14-1.26(m,38H),1.47-1.61(m,6H),1.8 6-1.96(m,4H),2.51-2.58(m,4H),3.17(s,1H),3.32-3.44(m,5H),3.51-3.66(m,3H). LCMS:Rt:0.94min;MS m / z(ESI):526.5[M+H] + .

[0598] 7.3 Example 3: Preparation of Compound 2.

[0599]

[0600] Step 1: Preparation of compound 2-1

[0601] To a stirred solution of 1-2 (300 mg, 0.67 mmol, 1.0 equiv), DIPEA (260 mg, 2.01 mmol, 3.0 equiv) in DCM (10 mL) was added dodecanoyl chloride (293 mg, 1.34 mmol, 2.0 equiv) and DMAP (16 mg, 0.134 mmol, 0.2 equiv). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was poured into water (20 mL) and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (DCM / MeOH=150 / 1) to give the title compound (320 mg, 76% yield) as a yellow oil. LCMS: Rt: 1.340 min; MS m / z (ESI): 630.5 [M+H] + .

[0602] Step 2: Preparation of compound 2

[0603] To a solution of compound 2-1 (320 mg, 0.51 mmol, 1.0 equivalent) in MeOH (10 mL) was added Pd / C (64 mg) and concentrated HCl (4 drops). The mixture was stirred at room temperature under H for 2 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and purified by preparative HPLC to give the title compound (75 mg, 27% yield) as a yellow oil.

[0604] 1H NMR(400MHz, CDCl3)δ:0.86-0.90(m,6H),1.25-1.33(m,35H),1.50-1.69(m,7H),1.87-1.99(m,1H),2.00-2.08(m,2H) ,2.33(t,J=7.6Hz,2H),2.56-2.81(m,4H),3.17-3.27(m,1H),3.38-3.48(m,3H),3.50-3.65(m,3H),5.08-5.14(m,1H). LCMS:Rt:1.180min;MS m / z(ESI):540.4[M+H] + .

[0605] 7.4 Example 4: Preparation of Compound 3.

[0606]

[0607] Compound 3-1

[0608] LCMS:Rt:1.140min;MS m / z(ESI):546.4[M+H] + .

[0609] Compound 3

[0610] 1 H NMR(400MHz, CDCl3)δ:0.86-0.93(m,6H),1.25-1.33(m,23H),1.49-1.69(m,7H),1.90-1.99(m,1H),2.00-2.12(m,2H) ,2.34(t,J=7.6Hz,2H),2.56-2.79(m,4H),3.20-3.29(m,1H),3.38-3.48(m,3H),3.50-3.67(m,3H),5.09-5.17(m,1H). LCMS:Rt:0.890min;MS m / z(ESI):456.4[M+H] + .

[0611] 7.5 Example 5: Preparation of Compound 4.

[0612]

[0613] Compound 4-1

[0614] LCMS:Rt:1.380min; MS m / z(ESI):786.6[M+H] + .

[0615] Compound 4

[0616] 1 H NMR(400MHz, CDCl3)δ:0.80-0.83(m,13H),1.20-1.26(m,58H),1.48-1.51(m,2H), 1.52-1.55(m,7H),2.24(m,1H),3.34(m,1H),3.46-3.48(m,2H),3.89-3.90(m,1H). LCMS:Rt:1.050min;MS m / z(ESI):696.6[M+H] + .

[0617] 7.6 Example 6: Preparation of Compound 5.

[0618]

[0619] Step 1: Preparation of compound 5-1

[0620] A mixture of compound A (1.0 g, 4.1 mmol, 1 equivalent) and N-methyl-1-phenyl-methylamine (1 g, 8.2 mmol, 2 equivalents) in EtOH (15 mL) was stirred at room temperature overnight. The mixture was concentrated under vacuum and purified by silica gel column chromatography (PE: EA = 1: 0 to 5: 3) to give the desired product (1.3 g, 86.7% yield) as a yellow oil. LCMS: Rt: 0.880 min; MS m / z (ESI): 364.3 [M + H] + .

[0621] Step 2: Preparation of compound 5-2

[0622] To a stirred solution of compound 5-1 (1 g, 2.8 mmol, 1 equivalent) in DMF (10 ML) was added sodium hydride (164 mg, 4.1 mmol, 1.5 equivalents) at room temperature. After 0.5 hours, 1-iodohexane (875 mg, 4.1 mmol, 1.5 equivalents) was added to the mixture. The mixture was stirred at 110 ° C overnight. The mixture was quenched with water (10 ML) and extracted with EA (3 × 10 ML). The combined organic layers were washed with brine (2 × 10 ML), dried over anhydrous sodium sulfate, and then concentrated under vacuum. The residue was purified by silica gel column chromatography (PE: EA = 1: 0 to 10: 1) to give the desired product 9001-119-3 (340 mg, 27.6% yield) as a yellow oil. LCMS: Rt: 1.080 min; MS m / z (ESI): 448.4 [M + H] + .

[0623] Step 3: Preparation of compound 5-3

[0624] A mixture of compound 5-2 (340 mg, 0.76 mmol, 1 eq) and Pd / C (90 mg, 10%) in MeOH (10 ML) was stirred overnight. The mixture was filtered and the filtrate was concentrated under vacuum to give the desired product (250 mg, crude) as a colorless oil. LCMS: Rt: 0.997 min; MS m / z (ESI): 358.4 [M+H] + .

[0625] Step 4: Preparation of compound 5-4

[0626] A mixture of compound 5-3 (250 mg, 0.7 mmol, 1.0 eq), 2-bromoethanol (175 mg, 1.4 mmol, 2 eq) and DIEA (181 mg, 1.4 mmol, 2 eq) in EtOH (16 ML) was stirred at 70 ° C overnight. The mixture was concentrated under vacuum to give the desired product (444 mg, crude) as a colorless semisolid. LCMS: Rt: 1.020 min; MS m / z (ESI): 402.4 [M + H] + .

[0627] Step 5: Preparation of compound 5-5

[0628] A mixture of compound 5-4 (330 mg, 0.82 mmol, 1 eq) and thionyl chloride (294 mg, 02.46 mmol, 3 eq) in DCM (6 ML) was stirred at room temperature overnight. The mixture was concentrated under vacuum to give the desired product (331 mg, crude) as a brown oil. LCMS: Rt: 1.127 min; MS m / z (ESI): 420.3 [M+H] + .

[0629] Step 6: Preparation of compound 5

[0630] A mixture of 5-5 (220 mg, 0.52 mmol, 1 eq), compound D (203 mg, 1.56 mmol, 3 eq), DIEA (338 mg, 2.60 mmol, 5 eq) and NaI catalyst in THF (6 ML) was stirred overnight at 70° C. The mixture was concentrated under vacuum and the residue was purified by preparative HPLC to give the desired product (23 mg, 12.8% yield) as a yellow oil.

[0631] 1H NMR(400MHz, CDCl3)δ:0.84-0.93(m,6H),1.13-1.40(m,27H),1.48-1.61(m,7H),1.66-1.77(m ,2H),1.80-1.94(m,2H),2.48(s,3H),2.67-3.05(m,7H),3.35-3.51(m,5H),3.54-3.81(m,4H). LCMS:Rt:0.960min; MS m / z(ESI):513.5[M+H] + .

[0632] 7.7 Example 7: Preparation of Compound 6.

[0633]

[0634] Step 1: Preparation of compound 6-1

[0635] To a stirred solution of 5-1 (1.4 g, 3.9 mmol, 1 equiv) in DMF (14 mL) was added sodium hydride (231 mg, 5.8 mmol, 1.5 equiv) at room temperature. After 0.5 hours, 1-bromododecane (1.45 g, 5.8 mmol, 1.5 equiv) and NaI catalyst were added to the mixture. The mixture was stirred at 110 ° C overnight. The mixture was quenched with water (15 mL) and extracted with EA (3 × 15 mL). The combined organic layers were washed with brine (2 × 15 mL), dried over anhydrous sodium sulfate, and then concentrated under vacuum. The residue was purified by silica gel column chromatography (PE: EA = 1: 0 to 1: 1) to give the desired product (244 mg, 11.9% yield) as a brown oil. LCMS: Rt: 1.680 min; MS m / z (ESI): 532.5 [M + H] + .

[0636] Step 2: Preparation of compound 6-2

[0637] A mixture of 6-1 (244 mg, 0.46 mmol, 1 eq) and Pd / C (100 mg, 10%) in MeOH (5 mL) was stirred overnight under a hydrogen atmosphere. The mixture was filtered and the filtrate was concentrated under vacuum to give the desired product (146 mg, crude) as a light yellow oil. LCMS: Rt: 1.250 min; MS m / z (ESI): 442.4 [M+H] + .

[0638] Step 3: Preparation of compound 6-3

[0639] A mixture of 6-2 (146 mg, 0.33 mmol, 1.0 eq), 2-bromoethanol (83 mg, 0.66 mmol, 2 eq) and DIEA (86 mg, 0.66 mmol, 2 eq) in EtOH (5 mL) was stirred at 70 ° C overnight. The mixture was concentrated under vacuum to give the desired product (438 mg, crude) as a yellow oil. LCMS: Rt: 1.270 min; MS m / z (ESI): 486.5 [M + H] + .

[0640] Step 4: Preparation of compound 6-4

[0641] A mixture of 6-3 (219 mg, 0.45 mmol, 1 eq) and thionyl chloride (161 mg, 1.35 mmol, 3 eq) in DCM (6 mL) was stirred at 35 ° C overnight. The mixture was concentrated under vacuum to give the desired product (133 mg, crude) as a yellow oil. LCMS: Rt: 1.860 min; MS m / z (ESI): 504.4 [M+H] + .

[0642] Step 5: Preparation of compound 6

[0643] A mixture of compound 6-4 (133 mg, 0.26 mmol, 1 eq), compound E (114 mg, 0.79 mmol, 3 eq), DIEA (170 mg, 1.32 mmol, 5 eq) and NaI catalyst in THF (3 ML) was stirred overnight at 70° C. The mixture was concentrated under vacuum and the residue was purified by preparative HPLC to give the desired product, compound 6 (19 mg, 11.8% yield), as a yellow oil.

[0644] 1 H NMR(400MHz, CDCl3)δ:0.81-0.93(m,6H),0.99-1.14(m,2H),1.26(s,39H),1.49-1.59(m,4H),1.61-1.7 0(m,1H),1.76-1.87(m,2H),1.90-2.19(m,9H),2.53-2.95(m,6H),3.35-3.53(m,5H),3.54-3.75(m,3H). LCMS:Rt:1.500min;MS m / z(ESI):611.6[M+H] + .

[0645] 7.8 Example 8: Preparation of Compound 7.

[0646]

[0647] Step 1: Preparation of compound 7-1

[0648] To a solution of N1, N1-dimethylethane-1,2-diamine (1.2 g, 13.6 mmol, 2.0 equiv) and compound B (2.8 g, 6.8 mmol, 1.0 equiv) in ACN (100 mL) was added K2CO3 (2.8 g, 20.4 mmol, 3.0 equiv), Cs2CO3 (665 mg, 2.04 mmol, 0.3 equiv) and NaI (306 mg, 2.04 mmol, 0.3 equiv). The mixture was stirred at 80 ° C for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (DCM / MeOH=50 / 1-30 / 1) to give the title compound (900 mg, 31% yield) as a yellow oil. LCMS:Rt:0.780min;MS m / z(ESI):427.4[M+H] + .

[0649] Step 2: Preparation of compound 7

[0650] To a solution of compound A (190 mg, 0.78 mol, 1.0 equiv) in EtOH (20 mL) was added 7-1 (400 mg, 0.94 mmol, 1.2 equiv). The mixture was stirred at room temperature for 48 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated under reduced pressure and purified by preparative HPLC to give the title compound (25 mg, 5% yield) as a white solid.

[0651] 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,9H),1.26-1.35(m,45H),1.41-1.67(m,7H),2.28-2.32(m,3H) ),2.36-2.70(m,11H),2.79-2.83(m,2H),3.35-3.46(m,4H),3.77-3.85(m,1H),3.96-3.97(m,2H). LCMS:Rt:1.220min;MS m / z(ESI):669.6[M+H] + .

[0652] 7.9 Example 9: Preparation of Compound 8.

[0653]

[0654] Step 1: Preparation of compound 8-1

[0655] To a solution of compound A (500 mg, 2.06 mol, 1.0 equiv) in EtOH (20 mL) was added 2- (piperidin-1-yl) ethyl-1-amine (529 mg, 4.12 mmol, 2.0 equiv). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated under reduced pressure and purified by silica gel column chromatography (DCM / MeOH = 50 / 1-30 / 1) to give the title compound (480 mg, 63% yield) as a yellow oil. LCMS: Rt: 0.730 min; MS m / z (ESI): 371.3 [M + H] + .

[0656] Step 2: Preparation of compound 8

[0657] To a solution of 8-1 (480 mg, 1.30 mmol, 1.0 equivalent) and compound B (1.1 g, 2.60 mmol, 2.0 equivalent) in ACN (50 mL) is added KCO (539 mg, 3.90 mmol, 3.0 equivalent), CsCO (98 mg, 0.39 mmol, 0.3 equivalent) and NaI (58 mg, 0.39 mmol, 0.3 equivalent). The mixture is stirred at 80 ° C for 16 hours. LCMS shows that the reaction is complete. The reaction mixture is concentrated and purified by silica gel column chromatography (DCM / MeOH=100 / 1-70 / 1) to give the title compound (600 mg, 65% yield) as a yellow oil. The 150 mg product is then further purified by preparative HPLC to give the title compound (43 mg) as a yellow oil.

[0658] 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,9H),1.25-1.27(m,47H),1.40-1.49(m,4H),1.56-1.73(m,8H),2.30(t,J =7.6Hz,3H),2.40-2.82(m,10H),3.32-3.38(m,1H),3.43-3.46(m,3H),3.70-3.80(m,1H),3.92-3.97(m,2H). LCMS:Rt:1.090min;MS m / z(ESI):709.6[M+H] + .

[0659] 7.10 Example 10: Preparation of Compound 9.

[0660]

[0661] To a solution of 8 (120 mg, 0.17 mol, 1.0 equiv) and DIPEA (66 mg, 0.51 mmol, 3.0 equiv) in DCM (8 mL) was added acetic anhydride (35 mg, 0.34 mmol, 2.0 equiv) at 0 ° C. The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated under reduced pressure and purified by preparative HPLC to give the title compound (28 mg, 22% yield) as a yellow oil.

[0662] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90(m,9H),1.25-1.27(m,47H),1.41-1.48(m,4H),1.53-1.67(m,8H),2.06( s,3H),2.29(t,J=7.4Hz,2H),2.45-2.75(m,10H),3.35-3.52(m,4H),3.95-3.97(m,2H),4.98-5.00(m,1H). LCMS:Rt:1.260min; MS m / z(ESI):751.6[M+H] + .

[0663] 7.11 Example 11: Preparation of Compound 10.

[0664]

[0665] Compound 10-1

[0666] LCMS:Rt:0.880min; MS m / z(ESI):357.3[M+H] + .

[0667] Compound 10

[0668] 1 H NMR(400MHz, CDCl3)δ:0.83-0.93(m,9H),1.16-1.37(m,43H),1.43-1.69(m,8H),1.92-2.24(m,11 H),2.27-2.35(m,3H),2.44-2.65(m,4H),3.35-3.50(m,4H),3.78-3.90(m,1H),3.93-4.01(m,2H). LCMS:Rt:1.660min;MS m / z(ESI):695.6[M+H] + .

[0669] 7.12 Example 12: Preparation of Compound 11.

[0670]

[0671] Compound 11-1

[0672] LCMS:Rt:0.880min; MS m / z(ESI):359.3[M+H] + .

[0673] Compound 11

[0674] 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,9H),1.05(s,6H),1.25(s,45H),1.45-1.65(m,7H),2 .28-2.32(m,2H),2.43-2.70(m,12H),3.43-3.44(m,4H),3.75(s,1H),3.96-3.97(m,2H). LCMS:Rt:1.060min;MS m / z(ESI):697.6[M+H] + .

[0675] 7.13 Example 13: Preparation of Compound 13.

[0676]

[0677] To a solution of compound F (660 mg, 1.65 mmol) in EtOH (20 mL) was added compound A (200 mg, 0.82 mmol). The reactant was stirred at room temperature for 10 hours. The reaction mixture was concentrated in vacuo and purified by preparative HPLC to give the target product (20 mg, yield: 4%) as a yellow oil.

[0678] 1 HNMR (400MHz, CDCl3): δ: 0.87 (t, J = 8Hz, 9H), 1.35-1.68 (m, 35H), 1.43-1.91 (m, 18H), 2.29-2.33 (m, 2H),2.51-2.71(m,6H),3.35-3.47(m,4H),3.58-3.63(m,2H),3.83-3.86(m,1H),3.96-3.97(m,2H). LCMS:Rt:1.059min;MS m / z(ESI):642.5[M+H] + .

[0679] 7.14 Example 14: Preparation of Compound 14.

[0680]

[0681] Step 1: Preparation of compound 14-1

[0682] To a solution of compound G (500 mg, 0.68 mmol) in CHCl (20 mL) was added DIEA (300 mg, 2.05 mmol) and hexanoyl chloride (185 mg, 1.37 mmol). The reaction was stirred at room temperature for 2 hours. The reaction mixture was poured into NaHCO (aqueous solution) (50 ml) and extracted with CHCl (3 × 50 mL). The combined organic layers were washed with brine, dried over anhydrous NaSO and concentrated in vacuo. The crude product was purified by flash column chromatography (PE: EtOAc = 5: 1) to give the target product (280 mg, yield: 48%) as a yellow oil.

[0683] Step 4: Preparation of compound 14

[0684] To a solution of compound 14-1 (250 mg, 0.3 mmol) in MeOH (10 mL) was added HCl (12 N) (0.3 mL) and Pd / C (50 mg). The reactant was stirred at room temperature under H for 1 hour. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give the target product (30 mg, yield: 13%) as a yellow oil.

[0685] 1 HNMR (400MHz, CDCl3): δ: 0.87 (t, J = 8Hz, 12H), 1.11-1.31 (m, 42H), 1.39-1.68 (m, 1 7H),2.28-2.69(m,11H),3.39-3.55(m,4H),3.96-3.97(m,2H),5.05-5.08(m,1H). LCMS:Rt:1.932min;MS m / z(ESI):740.6[M+H] + .

[0686] 7.15 Example 15: Preparation of Compound 15.

[0687]

[0688] Compound 15 1H NMR(400MHz, CDCl3)δ:0.86-0.91(m,12H),1.25-1.39(m,51H),1.40-1.47(m,3H),1.50-1.66(m,11 H),2.27-2.31(m,4H),2.45-2.65(m,10H),3.35-3.51(m,4H),3.95-3.97(m,2H),4.99-5.04(m,1H). LCMS:Rt:1.540min;MS m / z(ESI):807.6[M+H] + .

[0689] 7.16 Example 16: Preparation of Compound 16.

[0690]

[0691] Step 1: Preparation of compound 16-1

[0692] To a solution of compound H (400 mg, 0.94 mmol, 1.2 equiv) and 1-bromohexane (165 mg, 0.78 mmol, 1.0 equiv) in ACN (15 mL) was added KCO (323 mg, 2.34 mmol, 3.0 equiv), CsCO (76 mg, 0.23 mmol, 0.3 equiv) and NaI (35 mg, 0.23 mmol, 0.3 equiv). The mixture was stirred at 80 ° C for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 70 / 1) to give the title compound (290 mg, 73% yield) as a yellow oil. LCMS: Rt: 1.050 min; MS m / z (ESI): 512.5 [M + H] + .

[0693] Step 2: Preparation of compound 16-2

[0694] To a solution of 16-1 (290 mg, 0.57 mmol, 1.0 equiv) in EtOH (10 mL) was added 2-bromoethanol (143 mg, 1.14 mmol, 2.0 equiv) and DIPEA (221 mg, 1.71 mmol, 3.0 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the desired MS was detected. The reaction mixture was concentrated under reduced pressure. The residue was diluted with DCM and washed with water, brine, dried over Na2SO4 and concentrated to give the title compound (300 mg, 95%) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 1.220 min; MS m / z (ESI): 556.5 [M + H] +.

[0695] Step 3: Preparation of compound 16-3

[0696] To a solution of 16-2 (300 mg, 0.54 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl2 (193 mg, 1.62 mmol, 3.0 equiv). The mixture was stirred at 30 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was washed with saturated NaHCO3 solution, dried over Na2SO4, and concentrated. The residue was purified by silica gel column chromatography (PE / EA=10 / 1) to give the title compound (120 mg, 39% yield) as a yellow oil. LCMS: Rt: 0.950 min; MS m / z (ESI): 538.5 [M-Cl] + .

[0697] Step 4: Preparation of compound 16

[0698] To a solution of 16-3 (120 mg, 0.21 mmol, 1.0 equiv) and compound 1 (73 mg, 0.63 mmol, 3.0 equiv) in THF (10 mL) was added DIPEA (136 mg, 1.05 mmol, 5.0 equiv) and NaI (6 mg, 0.042 mmol, 0.2 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (27 mg, 20% yield) as a yellow oil.

[0699] 1 H NMR (400MHz, CDCl3) δ: 0.86-0.90(m,9H), 1.26-1.39(m,44H), 1.47-1.70(m,8H), 1.83-2.19(m,6H), 2.41-2.74(m,8H), 3.40-3.62(m,9H). LCMS:Rt:1.290min;MS m / z(ESI):653.6[M+H] + .

[0700] 7.17 Example 17: Preparation of Compound 17.

[0701]

[0702] Compound 17-1

[0703] LCMS:Rt:1.210min; MS m / z(ESI):596.6[M+H] + .

[0704] Compound 17-2

[0705] LCMS:Rt:1.740min;MS m / z(ESI):640.5[M+H] + .

[0706] Compound 17

[0707] 1 H NMR(400MHz,CCl3D): δ:3.61-3.41(m,8H),3.19-3.14(m,1H),2.63-2.45(m, 9H),2.03-1.84(m,6H),1.66-1.41(m,9H),1.26(s,54H),0.90-0.86(m,9H). LCMS:Rt:1.860min; MS m / z(ESI):737.6[M+H] + .

[0708] 7.18 Example 18: Preparation of Compound 18.

[0709]

[0710] Step 1: Preparation of compound 18-1

[0711] To a solution of compound G (500 mg, 0.68 mmol) in CHCl (20 mL) was added DIEA (270 mg, 2.05 mmol) and AcCl (110 mg, 1.37 mmol). The reactants were stirred at room temperature for 2 hours. The reaction mixture was poured into NaHCO (aqueous solution) (50 ml) and extracted with CHCl (3 × 100 mL). The combined organic layers were washed with brine, dried over anhydrous NaSO and concentrated in vacuo. The crude product was purified by flash column chromatography (PE: EtOAc = 5: 1) to give the target product (300 mg, yield: 57%) as a yellow oil. LCMS: Rt: 2.360 min; MS m / z (ESI): 774.6 [M + H] + .

[0712] Step 2: Preparation of compound 18

[0713] To a solution of 18-1 (300 mg, 0.39 mmol) in MeOH (10 mL) was added HCl (12 N) (0.3 mL) and Pd / C (50 mg). The reactant was stirred at room temperature under H for 1 hour. The reaction mixture was filtered and concentrated in vacuo. The crude product was purified by preparative HPLC to give the target product (30 mg, yield: 11%) as a yellow oil.

[0714] 1 HNMR (400MHz, CDCl3): δ: 0.87 (t, J = 8Hz, 9H), 1.11-1.31 (m, 42H), 1.39-1.68 (m, 9H), 2.04 (s, 3H), 2.28-2. 32(m,2H),2.48-2.73(m,6H),2.89-2.91(m,1H),3.39-3.55(m,6H),3.96-3.97(m,2H),5.05-5.08(m,1H). LCMS:Rt:1.530min;MS m / z(ESI):684.5[M+H] + .

[0715] 7.19 Example 19: Preparation of Compound 19.

[0716]

[0717] Step 1: Preparation of compound 19-1

[0718] A mixture of compound G (320 mg, 0.44 mmol, 1 eq), propionic anhydride (171 mg, 1.32 mmol, 3 eq) and DIEA (568 mg, 4.40 mmol, 10 eq) in DCM (5 mL) was stirred at room temperature overnight. The mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography (PE: EA = 60: 1 to 10: 1) to give the desired product (340 mg, 98.8% yield) as a colorless oil. LCMS: Rt: 2.170 min; MS m / z (ESI): 788.6 [M + H] + .

[0719] Step 2: Preparation of compound 19

[0720] A mixture of 19-1 (340 mg, 0.43 mmol, 1.0 equiv), one drop of HCl (36.5%) and Pd / C (60 mg) in MeOH (15 mL) was stirred at room temperature overnight. The mixture was filtered through celite. The filter cake was washed with MeOH (8 × 10 mL). The filtrate was concentrated under vacuum. The residue was purified by preparative HPLC to give the desired product (34 mg, 11.3% yield) as a light brown oil.

[0721] 1HNMR(400MHz, CDCl3): δ:0.83-0.92(m,9H),0.93-0.99(m,1H),1.08-1.18(m,3H),1.19-1.37(m,42 H),1.39-1.76(m,13H),2.16-2.42(m,4H),2.44-2.81(m,3H),3.35-3.65(m,5H),3.92-4.03(m,2H). LCMS:Rt:1.480min; MS m / z(ESI):698.5[M+H] + .

[0722] 7.20 Example 20: Preparation of Compound 20.

[0723]

[0724] Step 1: Preparation of compound 20-1

[0725] To a solution of compound 18 (1.0 g, 1.46 mmol, 1.0 eq) in DCM (30 mL) was added SOCl2 (521 mg, 4.38 mmol, 3.0 eq). The mixture was stirred at 30 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated under reduced pressure to give the title compound (1.0 g, 97%) as a brown oil. LCMS: Rt: 0.960 min; MS m / z (ESI): 666.5 [M-Cl] + .

[0726] Step 2: Preparation of compound 20

[0727] To a solution of 20-1 (250 mg, 0.36 mmol, 1.0 equiv) and compound 1 (124 mg, 1.08 mmol, 3.0 equiv) in THF (10 mL) was added DIPEA (233 mg, 1.80 mmol, 3.0 equiv) and NaI (11 mg, 0.072 mmol, 0.2 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (33 mg, 12% yield) as a yellow oil.

[0728] 1HNMR (400MHz, CDCl3): δ: 0.86-0.90 (m, 9H), 1.26-1.40 (m, 45H), 1.48-1.68 (m, 9H), 1.81-2.07 (m, 8H), 2.31 (t, J = 7.4Hz, 2H), 2.4 0-2.55(m,5H),2.61-2.75(m,3H),3.07-3.17(m,2H),3.34-3.51(m,4H),3.71-3.80(m,1H),3.96-3.97(m,2H),4.09-4.14(m,2H). LCMS:Rt:1.330min; MS m / z(ESI):781.6[M+H] + .

[0729] 7.21 Example 21: Preparation of Compound 21.

[0730]

[0731] Compound 21 1 H NMR (400MHz, CCl3D): δ: 4.09-4.06 (m, 1H), 3.96 (d, J = 6Hz, 2H), 3.75 (s, 1H), 3.46-3.38 (m, 4H), 2.72-2.45 (m, 10H), 2.32-2.28(m,2H),2.05(s,3H),1.78(d,J=9.2Hz,4H),1.65-1.47(m,9H),1.26(d,J=3.2Hz,51H),0.90-0.86(m,9H). LCMS:Rt:1.430min; MS m / z(ESI):809.6[M+H] + .

[0732] 7.22 Example 22: Preparation of Compound 22.

[0733]

[0734] Step 1: Preparation of compound 22-1

[0735] A mixture of compound J (1.0 g, 1.7 mmol, 1 equiv) and Pd / C (100 mg) in MeOH (100 mL) was stirred at room temperature under a hydrogen atmosphere overnight. The mixture was filtered through celite; the filtrate was concentrated to give the desired product 22-1 (504 mg, 85.6% yield) as a light brown oil. LCMS: Rt: 0.840 min; MS m / z (ESI): 344.3 [M+H] + .

[0736] Step 2: Preparation of compound 22-2

[0737] A mixture of compound 22-1 (504 mg, 1.47 mmol, 1 eq), potassium carbonate (607 mg, 4.40 mmol, 3 eq), cesium carbonate (13 mg, 0.04 mmol, 0.03 eq), compound B (493 mg, 1.18 mmol, 0.8 eq) and sodium iodide (50 mg, 0.33 mmol, 0.23 eq) in ACN (35 mL) was stirred at 80 ° C overnight. The mixture was filtered. The filtrate was concentrated. The residue was purified by silica gel column chromatography (MeOH: DCM = 0% to 2.5%) to give the desired product (500 mg, 49.9% yield) as a yellow oil. LCMS: Rt: 1.140 min; MS m / z (ESI): 682.6 [M + H] + .

[0738] Step 3: Preparation of compound 22-3

[0739] A mixture of compound 22-2 (500 mg, 0.73 mmol, 1 eq), 2-bromoethanol (138 mg, 1.10 mmol, 1.5 eq), DIEA (283 mg, 2.19 mmol, 3 eq) and sodium iodide (50 mg, 0.33 mmol, 0.45 mmol) in THF (10 mL) was stirred at 70 ° C overnight. The mixture was washed with water, extracted with EA (3×10 mL), dried and concentrated under vacuum to give the desired product (433 mg, crude) as a yellow oil. LCMS: Rt: 1.550in; MS m / z (ESI): 726.6 [M+H] + .

[0740] Step 4: Preparation of compound 22-4

[0741] A mixture of compound 22-3 (433 mg, 0.60 mmol, 1 eq) and SOCl2 (114 mg, 1.8 mmol, 3 eq) in DCM (8 mL) was stirred at 35° C. overnight. The mixture was concentrated and the residue was purified by silica gel column chromatography (MeOH:DCM=0:100 to 1:100) to give the desired product 22-4 (230 mg, 51.8% yield).

[0742] Step 5: Preparation of compound 22

[0743] A mixture of compound 22-4 (115 mg, 0.15 mmol, 1 eq), compound k (47 mg, 0.46 mmol, 3 eq), sodium iodide (15 mg, 0.10 mmol, 0.6 eq) and DIEA (100 mg, 0.78 mmol, 3 eq) in THF (5 mL) was stirred at 70 ° C overnight. The mixture was concentrated under vacuum. The residue was purified by preparative HPLC to give the desired product (23 mg, 18.4% yield) as a light brown oil.

[0744] 1 H NMR (400MHz, CDCl3): δ: 0.82-0.94(m,12H),1.12-1.38(m,53H),1.49-1.69(m,8H),1.73-2.07(m,10H),2.18-2.25(m ,1H),2.26-2.37(m,2H),2.87(s,1H),3.04-3.37(m,4H),3.38-3.53(m,4H),3.54-3.79(m,2H),3.96(d,J=5.6Hz,2H). LCMS:Rt:1.320min; MSm / z(ESI):809.7[M+H] + .

[0745] 7.23 Example 23: Preparation of Compound 23.

[0746]

[0747] Compound 23 1 H NMR (400MHz, CCl3D): δ: 0.87-0.90 (m, 12H), 1.26-1.40 (m, 52H), 1.50-1.68 (m, 10H), 2.08-2.23 (m, 7H), 2.31 (t, J = 7.6Hz, 2H), 2.4 2-2.57(m,3H),2.76-2.84(m,3H),2.98-3.18(m,4H),3.42-3.57(m,4H),3.61-3.65(m,2H),3.79-3.85(m,1H),3.95-3.97(m,2H). LCMS:Rt:1.480min;MS m / z(ESI):823.6[M+H] + .

[0748] 7.24 Example 24: Preparation of Compound 24.

[0749]

[0750] Compound 24 1H NMR(400MHz,CCl3D): δ:0.82-0.94(m,12H),1.19-1.40(m,47H),1.41-1.69(m,13H),1.73-2.14(m,13 H), 2.18-2.36 (m, 3H), 2.43-2.84 (m, 4H), 3.01-3.25 (m, 2H), 3.35-3.65 (m, 7H), 3.96 (d, J = 5.6Hz, 2H). LCMS:Rt:1.560min;MS m / z(ESI):837.7[M+H] + .

[0751] 7.25 Example 25: Preparation of Compound 25.

[0752]

[0753] Compound 25 1 H NMR(400MHz, CDCl3): δ:0.82-0.95(m,12H),1.16-1.38(m,50H),1.40-1.87(m,26H),1.96-2 .07(m,2H),2.18-2.34(m,2H),2.39-2.66(m,6H),3.35-3.75(m,6H),3.96(d,J=5.6Hz,1H). LCMS:Rt:1.980min;MS m / z(ESI):851.7[M+H] + .

[0754] 7.26 Example 26: Preparation of Compound 26.

[0755]

[0756] Compound 26 1 H NMR (400MHz, CDCl3): δ: 0.81-0.93(m,12H),1.15-1.36(m,50H),1.38-1.87(m,23H),1.75-1.87(m,2H) ),2.18-2.34(m,2H),2.39-2.66(m,9H),3.35-3.52(m,7H),3.53-3.62(m,1H),3.96(d,J=5.6Hz,2H). LCMS:Rt:1.860min; MS m / z(ESI):865.7[M+H] + .

[0757] 7.27 Example 27: Preparation of Compound 27.

[0758]

[0759] Step 1: Preparation of compound 27-1

[0760] A mixture of compound H (2.0 g, 4.7 mmol, 1 eq), potassium carbonate (1.9 g mg, 14.1 mmol, 3 eq), cesium carbonate (460 mg, 1.4 mmol, 0.3 eq), compound B (2.2 g, 5.1 mmol, 1.1 eq) and sodium iodide (210 mg, 1.4 mmol, 0.3 eq) in ACN (70 mL) was stirred at 80 ° C overnight. The mixture was filtered. The filtrate was concentrated. The residue was purified by silica gel column chromatography (MeOH: DCM = 0% to 2.5%) to give the desired product (1.8 g, 50.3% yield) as a yellow oil. LCMS: Rt: 1.970 min; MS m / z (ESI): 767.6 [M + H] + .

[0761] Step 2: Preparation of compound 27-2

[0762] A mixture of 27-1 (1.8 g, 2.3 mmol, 1 eq), 2-bromoethanol (880 mg, 7.0 mmol, 3.0 eq), DIEA (910 mg, 7.0 mmol, 3 eq) in ethanol (30 mL) was stirred at 80 ° C overnight. The mixture was diluted with EA and washed with water and brine, and concentrated. The residue was purified by column chromatography to give the product (1.6 g, 84.4% yield) as a yellow oil. LCMS: Rt: 2.180in; MS m / z (ESI): 810.7 [M + H] + .

[0763] Step 3: Preparation of compound 27-3

[0764] A mixture of 27-2 (1.6 g, 2.0 mmol, 1 eq) and SOCl2 (720 mg, 6.0 mmol, 3 eq) in DCM (20 mL) was stirred overnight at 35° C. The mixture was concentrated and the residue was purified by column chromatography to give the desired product 27-3 (1.4 g, 84.5% yield) as a yellow oil.

[0765] Step 4: Preparation of compound 27

[0766] A mixture of 27-3 (200 mg, 0.24 mmol, 1 eq), compound K (242 mg, 2.4 mmol, 10 eq), sodium iodide (18 mg, 0.12 mmol, 0.5 eq) and DIEA (100 mg, 0.72 mmol, 3 eq) in THF (5 mL) was stirred at 70 ° C overnight. The mixture was concentrated under vacuum. The residue was purified by preparative HPLC to give the desired product (56 mg, 26% yield) as a light brown oil.

[0767] 1 H NMR(400MHz, CDCl3)δ:0.43-0.47(m,4H),0.86-0.90(m,12H),1.26(s,63H),1.43-1.67(m,11H),2.28-2.32 (m,2H),2.44-2.62(m,5H),2.72-2.79(m,4H),3.40-3.50(m,6H),3.56-3.58(m,3H),3.97(d,J=6.0Hz,2H). LCMS:Rt:2.270min;MS m / z(ESI):893.7[M+H] + .

[0768] 7.28 Example 28: Preparation of Compound 28.

[0769]

[0770] Compound 28 1 H NMR (400MHz, CDCl3): δ: 0.86-0.90(m,12H),1.26(s,59H),1.44-1.68(m,15H),1.86(m,2H),1.99-2.05 (m,2H),2.28-2.32(m,2H),2.45-2.57(m,10H),3.12(m,1H),3.40-3.58(m,9H),3.96(d,J=6.0Hz,2H). LCMS:Rt:2.20min;MS m / z(ESI):907.7[M+H] + .

[0771] 7.29 Example 29: Preparation of Compound 29.

[0772]

[0773] Compound 29 1H NMR(400MHz, CDCl3): δ:0.86-0.90(m,12H),1.26(s,61H),1.39-1.75(m,22H),2.28-2.3 2(m,2H),2.47-2.61(m,9H),3.08-3.12(m,1H),3.40-3.60(m,9H),3.96(d,J=5.6Hz,2H). LCMS:Rt:1.690min; MS m / z(ESI):921.7[M+H] + .

[0774] 7.30 Example 30: Preparation of Compound 30.

[0775]

[0776] Compound 30 1 H NMR(400MHz, CDCl3): δ:0.86-0.90(m,12H),1.26(s,63H),1.51-1.77(m,20H),2 .28-2.32(m,2H),2.45-2.61(m,10H),3.40-3.56(m,9H),3.96(d,J=5.6Hz,2H). LCMS:Rt:1.590min;MS m / z(ESI):935.8[M+H] + .

[0777] 7.31 Example 31: Preparation of Compound 31.

[0778]

[0779] Compound 31 1 H NMR(400MHz, CDCl3): δ:0.86-0.90(m,12H),1.26(s,61H),1.39-1.79(m,24H),2 .28-2.32(m,2H),2.45-2.58(m,10H),3.40-3.58(m,9H),3.96(d,J=5.6Hz,2H). LCMS:Rt:2.510min; MS m / z(ESI):949.8[M+H] + .

[0780] 7.32 Example 32: Preparation of Compound 32.

[0781]

[0782] Step 1: Preparation of compound 32-1

[0783] To a solution of 1-1 (1 g, 4.88 mmol, 1.0 equiv) in DMF (10 mL) was added NaH (250 mg, 6.25 mmol, 1.3 equiv). The mixture was stirred at 0 ° C for 1 hour. 2-(Bromomethyl)oxirane (868 mg, 6.25 mmol, 1.3 equiv) was added to this mixture. The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was extracted with EA (50 ml), washed with brine (50 ml × 3), and evaporated under reduced pressure and purified by silica gel column chromatography (PE / EA = 5 / 1) to give the title compound (687 mg, 54%) as a yellow oil. LCMS: Rt: 0.74 min; MS m / z (ESI): 262 [M + H] + .

[0784] Step 2: Preparation of compound 32-2

[0785] To a solution of 32-1 (500 mg, 1.92 mmol, 1.0 equiv) in H2O (5 mL) was added perchloric acid (0.2 ml). The mixture was stirred at 80 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was purified by preparative HPLC to give the title compound (220 mg, 41%) as a yellow oil. LCMS: Rt: 0.735 min; MS m / z (ESI): 280.2 [M + H] + .

[0786] Step 3: Preparation of compound 32-3

[0787] To a stirred solution of 32-2 (188 mg, 0.67 mmol, 1.0 equiv), DIPEA (260 mg, 2.01 mmol, 3.0 equiv) in DCM (10 mL) was added compound M (578 mg, 2.01 mmol, 3.0 equiv) and DMAP (16 mg, 0.134 mmol, 0.2 equiv). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was poured into water (20 mL) and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (PE / EA=5 / 1) to give the title compound (346 mg, 66% yield) as a yellow oil.

[0788] Step 4: Preparation of compound 32

[0789] To a solution of 32-3 (320 mg, 0.44 mmol, 1.0 equivalent) in MeOH (10 mL) was added Pd / C (64 mg) and concentrated HCl (4 drops). The mixture was stirred at room temperature under H for 2 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and purified by preparative HPLC to give the title compound (40 mg, 13.2% yield) as a yellow oil.

[0790] 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,12H),1.31-1.41(m,48H),2.05-1.61(m,10H),2.19-2.28(m,4 H),2.64-2.78(m,3H),3.18-3.21(m,1H),3.22-3.59(m,2H),4.01-4.35(m,2H),5.18-5.22(m,1H). LCMS:Rt:1.240min;MS m / z(ESI):694.4[M+H] + .

[0791] 7.33 Example 33: Preparation of Compound 33.

[0792]

[0793] Step 1: Preparation of compound 33-1

[0794] To a solution of J-1 (5.5 g, 11.0 mmol, 1.0 equiv) in DMF (110 mL) was added NaH (880 mg, 22.0 mmol, 2.0 equiv) at room temperature. The mixture was stirred at room temperature for 1 hour. 1-Bromooctane (4.2 g, 22.0 mmol, 2.0 equiv) and NaI (330 mg, 2.2 mmol, 0.2 equiv) were then added. The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (PE / EA = 40 / 1) to give the title compound (3.5 g, 52% yield) as a yellow oil. LCMS: Rt: 1.040 min; MS m / z (ESI): 612.4 [M + H] + .

[0795] Step 2: Preparation of compound 33-2

[0796] To a solution of 33-1 (3.5 g, 5.72 mmol, 1.0 equiv) in MeOH (60 mL) was added Pd / C (350 mg). The mixture was stirred at room temperature under H2 for 16 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM / MeOH=30 / 1-20 / 1) to give the title compound (1.8 g, 86% yield) as a light yellow oil. LCMS: Rt: 1.080 min; MS m / z (ESI): 372.3 [M+H] + .

[0797] Step 3: Preparation of compound 33-3

[0798] To a solution of 33-2 (1.8 g, 4.8 mmol, 1.2 equiv) and compound B (1.7 g, 4.0 mmol, 1.0 equiv) in ACN (50 mL) was added KCO (1.6 g, 12.0 mmol, 3.0 equiv), CsCO (391 mg, 1.2 mmol, 0.3 equiv) and NaI (180 mg, 1.2 mmol, 0.3 equiv). The mixture was stirred at 80 ° C for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated and purified by silica gel column chromatography (DCM / MeOH = 50 / 1) to give the title compound (1.7 g, 61% yield) as a yellow oil. LCMS: Rt: 1.420 min; MS m / z (ESI): 710.6 [M + H] + .

[0799] Step 4: Preparation of compound 33-4

[0800] To a solution of 33-3 (1.7 g, 2.4 mmol, 1.0 equiv) in EtOH (25 mL) was added 2-bromoethanol (600 mg, 4.8 mmol, 2.0 equiv) and DIPEA (930 mg, 7.2 mmol, 3.0 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the desired MS was detected. The reaction mixture was concentrated under reduced pressure. The residue was diluted with DCM and washed with water, brine, dried over Na2SO4 and concentrated to give the title compound (1.8 g, 100%) as a yellow oil. It was used in the next step without further purification. LCMS: Rt: 1.980 min; MS m / z (ESI): 754.6 [M + H] + .

[0801] Step 5: Preparation of compound 33-5

[0802] To a solution of 33-4 (1.8 g, 2.39 mmol, 1.0 equiv) in DCM (30 mL) was added SOCl2 (853 mg, 7.17 mmol, 3.0 equiv). The mixture was stirred at 30 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was washed with saturated NaHCO3 solution, dried over Na2SO4, and concentrated. The residue was purified by silica gel column chromatography (PE / EA = 10 / 1) to give the title compound (750 mg, 42% yield) as a yellow oil. LCMS: Rt: 1.230 min; MS m / z (ESI): 736.6 [M-Cl] + .

[0803] Step 6: Preparation of compound 33

[0804] To a solution of 33-5 (150 mg, 0.19 mmol, 1.0 equiv) and compound 1 (66 mg, 0.57 mmol, 3.0 equiv) in THF (10 mL) was added DIPEA (123 mg, 0.95 mmol, 5.0 equiv) and NaI (6 mg, 0.038 mmol, 0.2 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (65 mg, 40% yield) as a yellow oil.

[0805] 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,12H),1.26-1.40(m,56H),1.46-1.67(m,11H),1.80-1.92(m,1H),1.96-2. 08(m,2H),2.30(t,J=7.6Hz,2H),2.41-2.73(m,10H),3.15-3.25(m,1H),3.40-3.61(m,9H),3.95-3.97(m,2H). LCMS:Rt:2.250min;MS m / z(ESI):851.7[M+H] + .

[0806] 7.34 Example 34: Preparation of Compound 34.

[0807]

[0808] Compound 34 1H NMR(400MHz, CDCl3)δ:0.40-0.52(m,4H),0.86-0.90(m,12H),1.26-1.40(m,56H),1.44-1.65(m,9H) ,1.84-1.92(m,1H),2.30(t,J=7.6Hz,2H),2.40-2.82(m,9H),3.38-3.63(m,9H),3.95-3.97(m,2H). LCMS:Rt:2.090min; MS m / z(ESI):837.7[M+H] + .

[0809] 7.35 Example 35: Preparation of Compound 35.

[0810]

[0811] Compound 35 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,12H),1.26-1.42(m,56H),1.44-1.55(m,9H),1.56-1.73(m,5H) ,1.76-1.82(m,1H),2.30(t,J=7.4Hz,2H),2.47-2.68(m,9H),3.40-3.60(m,9H),3.95-3.97(m,2H). LCMS:Rt:2.520min;MS m / z(ESI):865.7[M+H] + .

[0812] 7.36 Example 36: Preparation of Compound 36.

[0813]

[0814] Compound 36 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,12H),1.26-1.40(m,58H),1.41-1.63(m,11H),1.70-1.85(m,4H),2.05-2 .07(m,1H),2.30(t,J=7.4Hz,2H),2.39-2.65(m,9H),2.85-3.03(m,1H),3.40-3.61(m,9H),3.95-3.97(m,2H). LCMS:Rt:2.480min;MS m / z(ESI):879.7[M+H] + .

[0815] 7.37 Example 37: Preparation of Compound 37.

[0816]

[0817] Compound 37 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,12H),1.26-1.40(m,56H),1.41-1.69(m,16H),1.75-1.84(m,2H),2.07-2.2 4(m,4H),2.30(t,J=7.6Hz,2H),2.40-2.61(m,5H),2.74-2.80(m,2H),3.00-3.06(m,1H),3.16-3.23(m,1H),3.40 -3.61(m,7H),3.84-3.89(m,1H),3.95-3.97(m,2H). LCMS:Rt:2.520min;MS m / z(ESI):893.7[M+H] + .

[0818] 7.38 Example 38: Preparation of Compound 38.

[0819]

[0820] Compound 38 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,6H),1.26-1.54(m,25H),1.56-1.70(m,6H),1.9 1-2.02(m,4H),2.32(s,3H),2.48-2.58(m,8H),3.11-3.23(m,1H),3.41-3.60(m,9H). LCMS:Rt:0.909min; MS m / z(ESI):499.4[M+H] + .

[0821] 7.39 Example 39: Preparation of Compound 39.

[0822]

[0823] Compound 39 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,12H),1.26-1.54(m,36H),1.52-1.67(m,6H),1.9 1-2.02(m,4H),2.32(s,3H),2.50-2.58(m,8H),3.17-3.21(m,1H),3.43-3.62(m,9H). LCMS:Rt:1.030min; MS m / z(ESI):583.5[M+H]+ .

[0824] 7.40 Example 40: Preparation of Compound 40.

[0825]

[0826] Step 1: Preparation of compound 40-1

[0827] To a solution of 2-(methylamino)ethan-1-ol (7.5 g, 0.10 mol, 1.0 equiv) in DCM (300 mL) was added di-tert-butyl dicarbonate (24.0 g, 0.11 mmol, 1.1 equiv) at 0 ° C. The mixture was stirred at room temperature for 1 hour. LCMS showed that the reaction was complete. The mixture was washed with water, brine, dried over Na2SO4 and concentrated to give the title compound (17.5 g, 100% yield) as a colorless oil. LCMS: Rt: 0.820 min; MS m / z (ESI): 120.2 [M-56] + .

[0828] Step 2: Preparation of compound 40-2

[0829] To a stirred solution of 40-1 (12.5 g, 71.2 mol, 1.0 equiv) and benzyl bromide (14.6 g, 85.4 mmol, 1.2 equiv) in THF (140 mL) was added portionwise NaH (3.4 g, 85.4 mmol, 1.2 equiv) at 0 ° C under N2. The resulting mixture was stirred at room temperature for 16 hours. TLC showed that the reaction was complete. The mixture was poured into water and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (PE / EA=15 / 1) to give the title compound (12.5 g, 60% yield) as a colorless oil.

[0830] Step 3: Preparation of compound 40-3

[0831] To a solution of 40-2 (12.5 g, 47.1 mol, 1.0 eq) in DCM (100 mL) was added a solution of HCl in 1,4-dioxane (23.6 mL, 94.2 mmol, 2.0 eq, 4.0 M) under N2. The resulting mixture was stirred at room temperature for 2 hours. LCMS showed that the reaction was complete. The mixture was basified to pH = 9 with saturated NaHCO3 aqueous solution. The mixture was extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated to give the title compound (5.1 g, 65% yield) as a yellow oil. LCMS: Rt: 0.650 min; MS m / z (ESI): 166.2 [M+H] + .

[0832] Step 4: Preparation of compound 40-4

[0833] To a solution of compound A (6.0 g, 25.0 mmol, 1.0 equiv) in EtOH (100 mL) was added 40-3 (5.0 g, 30.0 mmol, 1.2 equiv). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was evaporated under reduced pressure and purified by silica gel column chromatography (DCM / MeOH=100 / 1-40 / 1) to give the title compound (6.1 g, 61%) as a yellow oil. LCMS: Rt: 0.890 min; MS m / z (ESI): 408.3 [M+H] + .

[0834] Step 5: Preparation of compound 40-5

[0835] To a stirred solution of 40-4 (300 mg, 0.74 mmol, 1.0 equiv), DIPEA (289 mg, 2.22 mmol, 3.0 equiv) in DCM (10 mL) was added valeryl chloride (178 mg, 1.48 mmol, 2.0 equiv) and DMAP (18 mg, 0.15 mmol, 0.2 equiv). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was poured into water (20 mL) and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (DCM / MeOH=100 / 1) to give the title compound (320 mg, 88% yield) as a yellow oil. LCMS: Rt: 0.940 min; MS m / z (ESI): 492.4 [M+H] + .

[0836] Step 6: Preparation of compound 40-6

[0837] To a solution of 40-5 (320 mg, 0.65 mmol, 1.0 equiv) in MeOH (15 mL) was added Pd / C (64 mg) and concentrated HCl (4 drops). The mixture was stirred at room temperature under H2 for 2 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM / MeOH=75 / 1) to give the title compound (200 mg, 77% yield) as a yellow oil. LCMS: Rt: 0.920 min; MS m / z (ESI): 402.3 [M+H] + .

[0838] Step 7: Preparation of compound 40-7

[0839] To a stirred solution of 40-6 (200 mg, 0.50 mmol, 1.0 equiv) and DIPEA (129 mg, 1.0 mmol, 2.0 equiv) in DCM (10 mL) was added methanesulfonyl chloride (69 mg, 0.60 mmol, 1.2 equiv) at 0 ° C. The mixture was stirred at room temperature for 2 hours. LCMS showed that the reaction was complete. The mixture was poured into water (20 mL) and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated to give the title compound (200 mg, 83% yield) as a yellow oil. LCMS: Rt: 1.480 min; MS m / z (ESI): 480.3 [M+H] + .

[0840] Step 8: Preparation of compound 40

[0841] To a solution of 40-7 (200 mg, 0.42 mmol, 1.0 equiv) in ACN (10 mL) was added compound 1 (97 mg, 0.84 mmol, 2.0 equiv) and potassium carbonate (174 mg, 1.26 mmol, 3.0 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (200 mg, 83% yield) as a yellow oil.

[0842] 1 H NMR(400MHz, CDCl3)δ:0.86-0.94(m,6H),1.25-1.38(m,21H),1.54-1.62(m,6H),1.87-1.94(m,2H),1.97-2.04(m,2H),2.31(t,J=7.4Hz, 3H),2.39-2.48(m,3H),2.52-2.66(m,4H),2.72-2.76(m,3H),3.13-3 .21(m,1H),3.42-3.47(m,4H),3.90-3.97(m,1H),4.11-4.15(m,2H). LCMS:Rt:0.910min;MS m / z(ESI):499.4[M+H] + .

[0843] 7.41 Example 41: Preparation of Compound 41.

[0844]

[0845] Step 1: Preparation of compound 41-1

[0846] To a stirred solution of 40-4 (600 mg, 1.47 mmol, 1.0 equiv), DIPEA (570 mg, 4.41 mmol, 3.0 equiv) in DCM (20 mL) was added dodecanoyl chloride (643 mg, 2.94 mmol, 2.0 equiv) and DMAP (35 mg, 0.29 mmol, 0.2 equiv). The mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The mixture was poured into water (20 mL) and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (DCM / MeOH=100 / 1) to give the title compound (750 mg, 75% yield) as a yellow oil. LCMS: Rt: 0.940 min; MS m / z (ESI): 590.4 [M+H] + .

[0847] Step 2: Preparation of compound 41

[0848] To a solution of 41-1 (700 mg, 1.19 mmol, 1.0 equivalent) in MeOH (15 mL) was added Pd / C (140 mg) and concentrated HCl (4 drops). The mixture was stirred at room temperature under H2 for 2 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and purified by silica gel column chromatography (DCM / MeOH=75 / 1) to give the title compound (550 mg, 93% yield) as a yellow oil. The 250 mg product was then further purified by preparative HPLC to give the title compound (62 mg, 10% yield) as a colorless oil.

[0849] 1 H NMR(400MHz, CDCl3)δ:0.88(t,J=6.8Hz,6H),1.26-1.29(m,35H),1.53-1.64(m,4H),2.35(t,J=7.6Hz,2H), 2.44(s,3H),2.66-2.80(m,4H),3.40-3.45(m,2H),3.46-3.59(m,2H),3.64-3.66(m,2H),5.16-5.20(m,1H). LCMS:Rt:1.190min; MS m / z(ESI):500.4[M+H] + .

[0850] 7.42 Example 42: Preparation of Compound 42.

[0851]

[0852] Compound 42-1

[0853] LCMS:Rt:0.920min;MS m / z(ESI):482.5[M-OMs] + .

[0854] Compound 42

[0855] 1 H NMR(400MHz, CDCl3)δ:0.86-0.90(m,6H),1.25-1.38(m,35H),1.56-1.67(m,6H),1.87-1.96(m,2H),1.97-2.04(m,2H),2.05-2.28(m,2H) ),2.30-2.32(m,3H),2.42-2.53(m,3H),2.60-2.79(m,5H),3.16-3.21(m,1H),3.40-3.47(m,4H),3.93-4.00(m,1H),4.12-4.14(m,2H). LCMS:Rt:1.080min; MS m / z(ESI):597.5[M+H] + .

[0856] 7.43 Example 43: Preparation of Compound 43.

[0857]

[0858] Step 1: Preparation of compound 43-1

[0859] A mixture of 3-(methylamino)propane-1,2-diol (5.0 g, 47.6 mmol, 1.0 equiv), ((2-bromoethoxy)methyl)benzene (12.3 g, 57.1 mmol, 1.2 equiv) and DIPEA (18.5 g, 142.8 mmol, 3.0 equiv) in THF (100 mL) was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was poured into water (100 mL) and extracted with EA (50 mL×3). The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by silica gel column chromatography (DCM / MeOH=50 / 1-20 / 1) to give the title compound (3.7 g, 32% yield) as a yellow oil. LCMS: Rt: 0.630 min; MS m / z (ESI): 240.2 [M+H] + .

[0860] Step 2: Preparation of compound 43-2

[0861] To a mixture of 43-1 (2.0 g, 8.36 mmol, 1.0 equiv) in methyl acrylate (12 mL) was added NaOH (66 mg, 1.67 mmol, 0.2 equiv). The resulting mixture was stirred at 50 ° C for 16 hours. TLC showed that the reaction was complete. The mixture was poured into water (40 mL) and extracted with EA. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by preparative HPLC to give the title compound (800 mg, 24% yield) as a colorless oil. LCMS: Rt: 0.730 min; MS m / z (ESI): 412.2 [M + H] + .

[0862] Step 3: Preparation of compound 43-3

[0863] To a solution of 43-2 (800 mg, 1.94 mol, 1.0 equiv) in THF / H2O (8 mL / 8 mL) was added lithium hydroxide monohydrate (326 mg, 7.76 mmol, 4.0 equiv). The reaction mixture was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was concentrated under reduced pressure to remove the organic solvent. The aqueous layer was acidified to pH = 5 with 2N HCl and then purified by preparative HPLC to give the title compound (280 mg, 38% yield) as a colorless oil. LCMS: Rt: 0.740 min; MSm / z (ESI): 384.2 [M+H] + .

[0864] Step 4: Preparation of compound 43-4

[0865] A mixture of 43-3 (280 mg, 0.73 mmol, 1.0 equiv), nonan-1-ol (316 mg, 2.19 mmol, 3.0 equiv), EDCI (420 mg, 2.19 mmol, 3.0 equiv), DMAP (178 mg, 1.46 mmol, 2.0 equiv) and DIPEA (472 mg, 3.65 mmol, 5.0 equiv) in DCM (30 mL) was stirred at reflux for 16 hours. LCMS showed that the reaction was complete. The reaction mixture was poured into water and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by preparative HPLC to give the title compound (150 mg, 32% yield) as a colorless oil. LCMS: Rt: 0.890 min; MS m / z (ESI): 636.4 [M+H] + .

[0866] Step 5: Preparation of compound 43-5

[0867] To a solution of 43-4 (150 mg, 0.24 mmol, 1.0 equiv) in MeOH (10 mL) was added Pd / C (30 mg) and concentrated HCl (5 drops). The mixture was stirred at room temperature under H2 for 2 hours. LCMS showed that the reaction was complete. The mixture was filtered through a celite pad and washed with MeOH. The filtrate was concentrated and the residue was diluted with DCM and washed with saturated NaHCO3 aqueous solution. The combined organic layers were dried over Na2SO4 and concentrated to give the title compound (100 mg, 77% yield) as a yellow oil. LCMS: Rt: 0.860 min; MS m / z (ESI): 546.4 [M+H] + .

[0868] Step 6: Preparation of compound 43-6

[0869] To a solution of 43-5 (100 mg, 0.18 mmol, 1.0 equiv) in DCM (10 mL) was added SOCl2 (65 mg, 0.54 mmol, 3.0 equiv) at room temperature. The mixture was stirred at 30 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was evaporated under reduced pressure to give the title compound (100 mg, 99% yield) as a yellow oil. LCMS: Rt: 0.950 min; MSm / z (ESI): 564.3 [M + H] + .

[0870] Step 7: Preparation of compound 43

[0871] To a solution of 43-6 (100 mg, 0.18 mmol, 1.0 equiv) and compound B (62 mg, 0.54 mmol, 3.0 equiv) in THF (10 mL) was added DIPEA (116 mg, 0.90 mmol, 5.0 equiv) and NaI (5 mg, 0.036 mmol, 0.2 equiv). The mixture was stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. The mixture was concentrated and purified by preparative HPLC to give the title compound (11 mg, 10% yield) as a yellow oil.

[0872] 1H NMR(400MHz, CDCl3)δ:0.86-0.90(m,6H),1.27-1.30(m,25H),1.60-1.70(m,6H),1.90-2.06(m,4H),2.28-2.35(m,3H),2.44-2 .67(m,12H),3.18-3.26(m,1H),3.47-3.55(m,5H),3.61-3.65(m,2H),3.71-3.77(m,1H),3.80-3.90(m,1H),4.05-4.09(m,4H). LCMS:Rt:0.910min;MS m / z(ESI):643.4[M+H] + .

[0873] 7.44 Example 44: Preparation of Compound 44.

[0874]

[0875] Compound 44-1

[0876] LCMS:Rt:0.940min;MS m / z(ESI):506.3[M+H] + .

[0877] Compound 44-2

[0878] LCMS:Rt:1.010min; MS m / z(ESI):416.3[M+H] + .

[0879] Compound 44-3

[0880] LCMS:Rt:1.630min;MS m / z(ESI):398.1[M-OMs] + .

[0881] Compound 44

[0882] 1H NMR(400MHz, CDCl3)δ:0.86-0.94(m,6H),1.25-1.32(m,24H),1.54-1.64(m,6H),1.87-1.93(m,2H),1.97-2.05(m,2H),2.30(t,J=7.6Hz, 3H),2.36-2.39(m,3H),2.46-2.65(m,4H),2.72-2.76(m,2H),3.12-3 .20(m,1H),3.40-3.50(m,4H),3.87-3.90(m,1H),4.12-4.16(m,2H). LCMS:Rt:0.890min; MS m / z(ESI):513.4[M+H] + .

[0883] 7.45 Example 45: Preparation of Compound 45.

[0884]

[0885] Compound 45 1 H NMR(400MHz, CDCl3)δ:0.81-0.93(m,6H),1.01-1.14(m,1H),1.16-1.38(m,29H),1.47-1.60(m,4H),1.61-1 .70(m,1H),1.76-1.91(m,3H),1.98-2.35(m,7H),2.55-2.97(m,6H),3.35-3.53(m,5H),3.54-3.75(m,3H). LCMS:Rt:1.050min;MS m / z(ESI):527.5[M+H] + .

[0886] 7.46 Example 46: Preparation of Compound 46.

[0887]

[0888] Step 1: Preparation of compound 46-1

[0889] To a solution of 2-(bromomethyl)oxirane (5.4 g, 20 mmol, 1.0 eq) in THF (50 ml) was added NaH (1.6 g, 40 mmol, 2.0 eq) and stirred at room temperature for 2 hours. C 18 H 37Br (5.4 g, 40 mmol, 2.0 equiv) and stirred at 70 ° C for 16 hours. LCMS showed that the reaction was complete. H2O was added, extracted with EA, and concentrated and purified by FCC (PE / EA=10 / 1) to give 46-1 (1.0 g, 20% yield) as a colorless oil.

[0890] 1 H NMR(400MHz, CDCl3)δ:0.84-0.89(s,3H),1.30(s,32H),1.50-1.60(m,4H),2.60-2.6 2(m,1H),2.79-2.80(m,1H),3.14-3.16(m,1H),3.36-3.52(m,3H),3.68-3.73(m,1H).

[0891] Step 2: Preparation of compound 46-2

[0892] A solution of 46-1 (1.0 g, 3.07 mmol, 1.0 equiv) and bis(4-methoxybenzyl)amine (617 mg, 3.98 mmol, 1.3 equiv) in EtOH (10.0 ml) was stirred at room temperature for 16 hours. LCMS showed that the reaction was complete, and the mixture was concentrated and purified by FCC (PE / EA=10 / 1) to give 46-2 (1.2 g, 68% yield) as a white solid. LCMS: Rt: 1.421 min; MS m / z (ESI): 584.4 [M+H] + .

[0893] Step 3: Preparation of compound 46-3

[0894] To a solution of 46-2 (1.5 g, 2.57 mmol, 1.0 eq) in THF (20 ml) was added NaH (308 mg, 7.72 mmol, 3.0 eq) and stirred at room temperature for 2 hours, and then C6H 13 Br (1.26 g, 7.72 mmol, 3.0 equiv) was added and stirred at 70° C. for 16 hours. LCMS showed that the reaction was complete, H 2 O was added, extracted with EA, concentrated and purified by FCC (PE / EA=10 / 1) to give 46-3 (1.2 g, 70% yield) as a yellow oil. LCMS: Rt: 1.585 min; MS m / z (ESI): 669.1 [M+H] + .

[0895] Step 4: Preparation of compound 46-4

[0896] To a solution of 46-3 (1.2 g, 1.8 mmol, 1.0) in EtOH (10 ml) was added Pd / C (120.0 mg), followed by stirring at room temperature under H 2 for 16 hours. LCMS showed the reaction was complete, filtered and concentrated to afford 46-4 (750.0 mg, 97% yield) as a yellow oil. LCMS: Rt: 1.422 min; MS m / z (ESI): 428.4 [M+H] + .

[0897] Step 5: Preparation of compound 46-5

[0898] To a solution of 46-4 (750.0 mg, 1.75 mmol, 1.0 eq) and compound C (469.0 mg, 1.4 mmol, 0.8 eq) in ACN (10 ml) was added K2CO3 (724.5 mg, 5.25 mmol, 3.0 eq), Cs2CO3 (170 mg, 0.525 mmol, 0.3 eq) and NaI (25 mg, 0.175 mmol, 0.1 eq) and stirred at 85 ° C for 16 hours. LCMS showed that the reaction was complete, concentrated and purified by FCC (DCM / MeOH=20 / 1) to give 46-5 (320 mg, 33% yield) as a brown oil. LCMS: Rt: 1.770 min; MS m / z (ESI): 682.6 [M+H] + .

[0899] Step 6: Preparation of compound 46-6

[0900] To a solution of 46-5 (300 mg, 0.44 mmol, 1.0 equiv) and 2-bromoethanol (110 mg, 0.88 mmol, 4.0 equiv) in EtOH (5 ml) was added DIEA (170 mg, 1.32 mmol, 3.0 equiv) and NaI (25 mg, 0.0176 mmol, 0.1 ...

Claims

1. A compound of formula (III): or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof, wherein: R 1 and R 2 Each independently is C5-C 32 Alkyl or C5-C 32 alkenyl; R 0 It is C1-C 12 Alkyl, C2-C 12 alkenyl, C3-C8 cycloalkyl or 4- to 8-membered heterocycloalkyl; G 3 is C2-C4 alkylene; G 4 It is C2-C 12 alkylene; R 3 is -N(R 4 )R 5 or -OR 6 ; R 4 It is C1-C 12 Alkyl or C3-C8 cycloalkyl; R 5 Yes - (CH2) p Q, wherein Q is -OR, and p is 1, 2, 3, 4, or 5; R is H; and R 6 It's hydrogen.

2. The compound of claim 1, wherein R 3 It is -OH.

3. The compound of claim 1, wherein R 3 Yes-N(R 4 )R 5 .

4. The compound of any one of claims 1 to 3, wherein G 4 It is a C2-C4 alkylene group.

5. The compound according to claim 1, which is a compound of formula (VII): Where t is an integer from 2 to 4, u is an integer from 2 to 12, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. The compound of claim 5 , wherein t is 2 and u is 4.

7. The compound of any one of claims 1 to 3, wherein R 0 It is a C1-C6 alkyl group, a C2-C6 alkenyl group or a C3-C8 cycloalkyl group.

8. The compound of any one of claims 1 to 3, wherein R 4 It is a C1-C6 alkyl group or a C3-C8 cycloalkyl group.

9. The compound of any one of claims 1 to 3, wherein R 5 It is -CH2CH2OH.

10. The compound of any one of claims 1 to 3, wherein R 1 and R 2 Each independently a branched C6-C 24 Alkyl or branched C6-C 24 Alkenyl.

11. The compound of claim 10, wherein R 1 and R 2 Each independently is -R 7 -CH(R 8 )(R 9 ), where R 7 is a C1-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 Alkyl or C2-C 10 Alkenyl.

12. The compound of any one of claims 1 to 3, wherein R 1 It is a straight chain C6-C 24 Alkyl, and R 2 It is a branched C6-C 24 alkyl.

13. The compound of claim 3, wherein R 1 It is a straight chain C6-C 24 Alkyl, and R 2 Yes-R 7 -CH(R 8 )(R 9 ), where R 7 is a C1-C5 alkylene group, and R 8 and R 9 Independently C2-C 10 alkyl.

14. A compound, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof, selected from 15. A composition comprising a compound according to any one of claims 1 to 14 and a therapeutic or prophylactic agent.

16. The composition of claim 15, further comprising one or more structured lipids.

17. The composition of any one of claims 15 to 16, further comprising a steroid.

18. The composition of any one of claims 15 to 16, wherein the composition further comprises one or more polymer-bound lipids.

19. The composition of any one of claims 15 to 16, wherein the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.

20. The composition of any one of claims 15 to 16, wherein the composition is a nanoparticle.

21. A lipid nanoparticle comprising the compound of any one of claims 1 to 14 or the composition of any one of claims 15 to 20.

22. A pharmaceutical composition comprising the compound of any one of claims 1 to 14, the composition of any one of claims 15 to 20, or the lipid nanoparticle of claim 21, and a pharmaceutically acceptable excipient or diluent.

Images