A primer for detecting RPA in fruit-borne anthracnose and its application

By designing specific primers for RPA detection, the problems of slow detection speed and low sensitivity of fruit anthracnose were solved, and a rapid, simple and highly sensitive detection method was established, which is suitable for grassroots laboratories and port inspection and quarantine.

CN116497145BActive Publication Date: 2025-10-31PLANT PROTECTION & QUALITY & SAFETY OF AGRI PRODS INST ANHUI ACAD OF AGRI SCI +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310229055.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-10
Publication Date
2025-10-31
Estimated Expiration
2043-03-10

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid, simple, and highly sensitive detection of fruit anthracnose. Traditional methods are time-consuming, require specialized equipment, and are susceptible to interference from human factors and environmental conditions. PCR methods are slow and have low sensitivity.

Method used

Specific primers were designed for RPA detection, including upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2. The RPA reaction system was reacted at 42℃ for 30 minutes, followed by agarose gel electrophoresis analysis or nucleic acid sequencing detection.

Benefits of technology

It enables rapid, simple, and highly sensitive detection of fruit anthracnose, with strong specificity. It does not require thermal cycling equipment such as PCR instruments, making it suitable for use in grassroots laboratories and applicable to the early detection of fruit anthracnose and port inspection and quarantine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116497145B_ABST
    Figure CN116497145B_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant disease detection technology, specifically to a specific primer for the detection of RPA (reactive protein) in *Anthracnose citrinum* and its application. This invention obtains specific primers for the detection of RPA in *Anthracnose citrinum* through primer design and establishes an RPA-based detection system, reagents, and kits. The *Anthracnose citrinum* RPA detection system of this invention shows no cross-reactivity with other common pathogens, exhibits high specificity, and a detection sensitivity of 10 pg / μL. It does not require thermal cycling equipment such as PCR instruments, is simple to operate, and is particularly suitable for rapid detection of *Anthracnose citrinum* in grassroots facilities or laboratories with limited experimental resources. It has significant practical implications for the early detection of *Anthracnose citrinum* and port inspection and quarantine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant disease detection technology, specifically to a specific primer for detecting RPA of fruit anthracnose and its application. Background Technology

[0002] *Colletotrichum fructicola* is a common pathogen reported in various plants, including those in the genera *Coffee*, *Citrus*, *Pyrus*, *Morch*, *Malus*, and *Camellia*, exhibiting wide geographical and species diversity and causing damage worldwide. Accurate identification is difficult relying solely on morphological characteristics, PCR molecular detection, or single-gene phylogenetic tree construction. Traditional plant disease detection methods, such as direct observation, may miss cases where symptoms are not yet present in the early stages of disease and are susceptible to interference from human factors and environmental conditions. Furthermore, these methods are time-consuming, cumbersome, and require specialized technicians and equipment, making them unsuitable for rapid detection. CN202010673672.4 discloses a specific gene sequence of *Colletotrichum fructicola* and its application. This method obtains the specific sequence of *Colletotrichum fructicola* through genome cluster analysis and then designs primers for PCR amplification and detection. However, this method requires specialized equipment, has a slow detection speed, and low sensitivity. Therefore, researching rapid and simple detection methods is of practical significance for the early detection of fruit anthracnose and for port inspection and quarantine.

[0003] Recombinase polymerase amplification (RPA) is a novel isothermal amplification technique that can amplify detection products in a short reaction under isothermal conditions. It features rapid reaction, high sensitivity, and high specificity, and does not require expensive variable-temperature experimental equipment. It is considered a novel nucleic acid amplification technique that can replace PCR. The key to this technique lies in the design of specific primers. Currently, there are no reported RPA detection methods for *Anthracnose cylindrica*. Summary of the Invention

[0004] The purpose of this invention is to address the problem of rapid RPA detection of *Colletotrichum fructicola*, and to provide a specific primer for RPA detection of *Colletotrichum fructicola*. The nucleotide sequence of the specific primer is as follows:

[0005] Upstream primer SEQ ID NO.1: 5'-CGATTGTGAGTGAGCCCTAGTGGCGAGCCT-3',

[0006] Downstream primer SEQ ID NO.2: 5'-CTTCGTATTTGTGGGAGTTGATTCGGGACT-3'.

[0007] One aspect of the present invention provides a reagent for detecting RPA in *Anthracnose spp.*, the reagent containing the specific primers SEQ ID NO.1 and SEQ ID NO.2 described above. The reagent can be prepared in liquid, lyophilized powder, or other formulations, and may also include various other reagents, such as extraction reagents for total plant nucleic acids and other reagents required for the RPA reaction.

[0008] Another aspect of the present invention provides a detection kit for *Anthracnose spp.* RPA containing the above-mentioned specific primers.

[0009] The fruit anthracnose RPA detection kit also contains a plant total nucleic acid extraction kit, an RPA amplification reaction reagent, and a positive control.

[0010] Another aspect of the present invention provides a method for detecting RPA of fruit-borne anthracnose fungus, comprising the following steps:

[0011] 1) Extract genomic DNA from the sample to be tested;

[0012] 2) RPA reaction is performed using the extracted genomic DNA from the sample, and the specific primers used are the specific primers described in claim 1;

[0013] 3) After the RPA reaction is completed, the reaction products are detected. The sample that detects the target amplification object is a positive sample.

[0014] In the above method, the RPA reaction system includes: RPA amplification reaction reagent, specific primers, and sample genomic DNA.

[0015] In the above method, the RPA reaction conditions are: reaction temperature of 42℃ and reaction time of 30 minutes.

[0016] In the above technical solution, after the RPA reaction in step 3) is completed, the reaction product is detected. The detection method is to perform agarose gel electrophoresis analysis or nucleic acid sequencing on the amplification product.

[0017] When performing agarose gel electrophoresis analysis, the detection of a 367bp band indicates that the sample is a positive sample.

[0018] Another aspect of the present invention provides specific primers, detection reagents, and detection kits for the detection of RPA in *Anthracis citrinum*.

[0019] Beneficial effects

[0020] This invention is the first to apply RPA technology to the detection of fruit anthracnose, and establishes a rapid RPA detection system. This detection system has no cross-reaction with other common pathogens and has high specificity.

[0021] The greatest advantage of RPA technology lies in its isothermal reaction, eliminating the need for thermal cycling equipment such as PCR instruments. Its simplicity greatly enhances its widespread adoption at the grassroots level. The RPA detection method for *Anthracis citrinum* established in this study combines high specificity and sensitivity with the elimination of thermal cycling equipment like PCR instruments, making it particularly suitable for rapid detection of *Anthracis citrinum* in grassroots settings or laboratories with limited resources. This method holds significant practical importance for the early detection of *Anthracis citrinum* and for port inspection and quarantine. Attached Figure Description

[0022] Figure 1 This is the primer design diagram for this invention.

[0023] Figure 2 This is primer-specific detection. Lanes 1-9 are, in order: Colletotrichum fructicola, Colletotrichum gloeosporioides, colletotrichum siamense, Alternaria alternata, Botryosphaeria dothidea, Botrytis cinerea, Fusarium oxysporum, Venturian asicola, and Gymnosporangium haraeanum.

[0024] Figure 3 These are the sensitivity test results. Lanes 1-6: DNA template concentrations were 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL, respectively.

[0025] Figure 4 These are the sample test results. Lanes 1-8: Positive DNA control, negative control, healthy pear fruit, pear fruit with black spot disease, pear fruit with ring rot disease, pear fruit with anthracnose disease, pear leaves with black spot disease, and pear leaves with rust disease. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0027] Example 1: RPA Primer Design and Validation

[0028] Based on the reported Unknown contig sequence of *Anthracnose spp.* (NCBI Reference Sequence: NW_022474237.1:811738-813106), a pair of RPA primers were designed using Primer 5 software. The upstream primer CF-RPA-F (SEQ ID NO.1): CGATTTGTGAGTGAGCCCTAGTGGCGAGCCT; the downstream primer CF-RPA-R (SEQ ID NO.2): CTTCGTATTTGTGGGAGTTGATTCGGGACT. (Specific details are as follows...) Figure 1 As shown, the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0029] The RPA kit used for the assay was a product of Anpu Future Biotechnology Co., Ltd. (catalog number: WLB8201KIT). Following the RPA kit instructions, the reaction system (total volume: 50 μL) was prepared using *Anthracis cirrhosa* DNA as a template. In a reaction tube containing solid reactants, 29.5 μL of Buffer A, 16 μL of ddH2O, 0.5 μL each of forward and reverse primers (10 μmol / L), and 1 μL of DNA template were added sequentially. The mixture was thoroughly mixed, followed by the addition of 2.5 μL of 280 mM magnesium acetate (MgAc). The mixture was then thoroughly vortexed, centrifuged briefly for 3 seconds, and incubated at 42°C for 30 minutes. After the RPA reaction, three volumes of saturated phenol solution were added to the reactants, gently vortexed, and centrifuged at 12000 rpm for 10 minutes. The supernatant was then subjected to agarose gel electrophoresis, and the electrophoresis results were observed.

[0030] The results are as follows Figure 1 As shown, CF-RPA-F / CF-RPA-R can amplify a single target band, which can be further used for specific detection experiments.

[0031] Example 2: Evaluation of RPA primer specificity

[0032] To test whether the designed primers would cross-react with other common pathogens, RPA reactions were performed using the DNA of the pathogens listed in Table 1 as templates, following the reaction system described in Example 1, to evaluate the detection specificity of the designed primers.

[0033] Table 1. Strains used for screening primer specificity in this embodiment.

[0034]

[0035]

[0036] Note: + indicates the presence of a specific test band; - indicates the absence of a test band.

[0037] The results are as follows Figure 2 As shown, the CF-RPA-F / CF-RPA-R primers in this invention can only amplify a single target band in *Anthracnose citrinum*, indicating that the designed RPA detection primers do not cross-react with other pathogens and have intergeneric and intrageneric specificity, and can specifically detect *Anthracnose citrinum*.

[0038] Example 3: Evaluation of RPA primer sensitivity

[0039] To determine the detection sensitivity of the designed primers, DNA template concentrations of 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL were sequentially set, and RPA reactions were performed according to the reaction system described in Example 1 to evaluate the detection sensitivity.

[0040] The results are as follows Figure 3 As shown, the detection sensitivity of the CF-RPA-F / CF-RPA-R primers in this invention can reach 10 pg / μL.

[0041] Example 4 Field Sample Detection

[0042] We collected samples of pear leaves or fruits infected with pear black spot, pear anthracnose, pear ring rot, pear black spot, and pear rust, as well as healthy control materials. We extracted total nucleic acids using a plant genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd., DP305) and stored them at -20℃ for later use.

[0043] The RPA reaction was carried out according to the reaction system described in Example 1, and the electrophoresis results are as follows: Figure 4 The results showed that only pear anthracnose samples infected with *Anthracnose cylindrica* amplified a single bright band, indicating a positive test result. Samples infected with other pathogens and healthy controls all showed negative results. These results demonstrate that the *Anthracnose cylindrica* RPA detection method established in this invention is stable and reliable, and can be used for the rapid detection of pear anthracnose samples infected with *Anthracnose cylindrica* in the field.

[0044] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A specific primer for the detection of RPA in *Anthracis cibarius*, characterized in that, The nucleotide sequence of the specific primer is as follows: Upstream primer SEQ ID NO.1: 5'-CGATTGTGAGTGAGCCCTAGTGGCGAGCCT-3', Downstream primer SEQ ID NO.2: 5'-CTTCGTATTTGTGGGAGTTGATTCGGGACT-3'.

2. A reagent for detecting RPA in fruit-borne anthracnose bacteria, characterized in that, The reagent contains the specific primers as described in claim 1.

3. A detection kit for RPA of *Anthracnose spp.*, characterized in that, The kit contains the specific primers as described in claim 1.

4. The fruit anthracnose RPA detection kit as described in claim 3, characterized in that, The kit contains a plant genomic DNA extraction kit, an RPA amplification reaction reagent, and a positive control.

5. A method for detecting RPA in fruit-borne anthracnose fungi, characterized in that, The method includes the following steps: 1) Extract genomic DNA from the sample to be tested; 2) The extracted genomic DNA from the sample is used to perform an RPA reaction, and the specific primers used in the RPA reaction are the specific primers described in claim 1; 3) After the RPA reaction is completed, the reaction products are detected. The sample that detects the target amplification object is a positive sample.

6. The method as described in claim 5, characterized in that, The reaction system for the RPA reaction in step 2) includes: sample genomic DNA, RPA amplification reaction reagent, and specific primers.

7. The method according to any one of claims 5 to 6, characterized in that, The RPA reaction conditions in step 2) are: reaction temperature of 42℃ and reaction time of 30 minutes.

8. The method according to any one of claims 5 to 6, characterized in that, After the RPA reaction in step 3) is completed, the reaction product is detected by agarose gel electrophoresis or nucleic acid sequencing.

9. The method as described in claim 8, characterized in that, When performing agarose gel electrophoresis analysis, the detection of a 367bp band indicates that the sample is a positive sample.

10. The application of the specific primer as described in claim 1, the detection reagent as described in claim 2, and the detection kit as described in claim 3 in the detection of *Anthracnose cirrhosa*.

Citation Information

Patent Citations

  • Specific gene sequence of colletotrichum fructicola and application of specific gene sequence

    CN111826459A