Methods for constructing sequencing libraries

Abstract

The application provides a method for constructing a sequencing library, which comprises the following steps: providing enzyme cutting fragments of DNA to be detected; connecting the enzyme cutting fragments and sequencing adaptors by using a ligase, and adding a nicking enzyme to prepare an adaptor product; and performing PCR amplification by using the adaptor product as a template to construct a sequencing library; wherein the nucleotide sequence of the sequencing adaptor comprises an enzyme cutting site of the nicking enzyme, and the first base upstream of the enzyme cutting site of the nicking enzyme is specifically changed. By using the method, self-ligation between the sequencing adaptors can be effectively prevented, so that the connection efficiency of the sequencing adaptors and the DNA to be detected and the qualified rate of sequencing data are improved.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for constructing a sequencing library. Background Technology

[0002] Constructing sequencing libraries is a crucial step in sequencing analysis, and the quality of the library directly impacts the sequencing results. DNA or RNA molecules in the sequencing library must undergo a series of processing steps, such as adapter addition, fragmentation, purification, and enrichment, before they can be recognized and sequenced by a high-throughput sequencer. Adapters are an essential component of sequencing library construction; they are special DNA molecules containing two distinct sequences: one attached to the 3' end of the DNA or RNA sample, and the other attached to the primers used by the high-throughput sequencer.

[0003] Next-generation sequencing based on the Illumina or BGI platform uses A / T adapters for library construction. This method results in only one base protrusion at the adapter end, and only one complementary base during ligation. While this prevents adapter self-ligation to some extent, it also reduces ligation efficiency.

[0004] Enzyme digestion is another commonly used method for constructing DNA sequencing libraries. It involves using restriction endonucleases to break DNA into short fragments and attaching adapters to the ends of these fragments for subsequent sequencing. While this method results in more base protrusions at the adapter ends, improving ligation efficiency, the sticky ends produced by most restriction endonucleases are not single bases, which can lead to adapter self-ligation. Self-ligation of sequencing adapters not only reduces the ligation efficiency with the target fragment but also lowers the yield of sequencing data. Summary of the Invention

[0005] Therefore, it is necessary to provide a library construction method that can improve sequencing efficiency, thereby reducing adapter self-ligation rate, thus improving the ligation efficiency between sequencing adapters and the target fragments and the quality rate of sequencing data.

[0006] According to one aspect of the invention, a method is provided

[0007] A method for constructing a sequencing library includes the following steps:

[0008] Provide the restriction enzyme fragments of the DNA to be tested;

[0009] The enzyme fragment and sequencing adapter were ligated using a ligase, and a nicking enzyme was added to prepare the adapter product; and

[0010] The adapter product was used as a template for PCR amplification to construct the sequencing library;

[0011] The nucleotide sequence of the sequencing adapter contains the cleavage site of the nicking enzyme, and the first base upstream of the cleavage site of the nicking enzyme is specifically altered.

[0012] In one embodiment, the enzyme fragment of the DNA to be tested is prepared using the method shown in (a) or (b):

[0013] (a) The DNA to be tested was digested with a methylation-dependent restriction endonuclease to prepare the digested fragment a;

[0014] (b) The DNA to be tested was digested with a nonmethylation-dependent restriction endonuclease to prepare digested fragment b.

[0015] In one embodiment, the methylation-dependent restriction endonuclease is FspEI, MspJ1, or LpnPI.

[0016] In one embodiment, the nonmethylation-dependent restriction endonuclease is MspI, AciI, HinP1I, HpyCH4IV, HpaII, ClaI, BsaHI, SalI, AvaI, BsiEI, Hpy99I, PvuI, MluI, EagI, BstNI, or PcilI.

[0017] In one embodiment, when the enzyme digestion fragment is enzyme digestion fragment a, the 5' end protruding base sequence of the sequencing adapter is NNNN, where each N is independently selected from any one of A, T, C, and G.

[0018] In one embodiment, when the enzyme digestion fragment is enzyme digestion fragment b, the 5' protruding base sequence of the sequencing adapter is CG.

[0019] In one embodiment, the nicking enzyme is Nt.BsmAI.

[0020] In one embodiment, the nicking enzyme is Nb.BsmI, Nb.BsrDI, Nb.BtsI, Ntsc.AlwI, Nt.BstNBI, or Nt.BspQI.

[0021] In one embodiment, when the enzyme fragment is enzyme fragment a, the first base upstream of the cleavage site of the nicking enzyme is specifically changed to G, and the nucleotide sequence of the sequencing adapter includes NNNNGGAGAC.

[0022] In one embodiment, when the enzyme fragment is enzyme fragment b, the first base upstream of the cleavage site of the nicking enzyme is specifically changed to A, and the nucleotide sequence of the sequencing adapter includes CGAGAGAC.

[0023] Compared with traditional technologies, the present invention has the following beneficial effects:

[0024] The sequencing library construction method of this invention uses a DNA fragment with sticky ends, and introduces a nicking enzyme cleavage site sequence and a specifically modifiable base into the sequencing adapter. Simultaneously, ligase and nicking enzyme are added to the reaction system to enable the DNA fragment to ligate with the sequencing adapter. Introducing the nicking enzyme cleavage site sequence into the sequencing adapter allows the nicking enzyme to recognize this sequence and re-cut the self-ligated double-stranded DNA into two sequencing adapters identical to the original adapter when adapter self-ligation occurs. Furthermore, specifically modifying the first base upstream of the nicking enzyme cleavage site avoids the appearance of an endonuclease recognition site during adapter self-ligation. Using the method of this invention, the problem of self-ligation between sequencing adapters can be effectively improved, thereby increasing the ligation efficiency between the sequencing adapter and the DNA fragment and the quality of sequencing data. Attached Figure Description

[0025] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0026] Figure 1 This is a schematic diagram of the synthesis of the sequencing adapter in this invention;

[0027] Figure 2 This is a gel electrophoresis image of the nicking enzyme Nt.BsmAI preventing the self-ligation of the NNNNGGAGAC linker in Example 1;

[0028] Figure 3 This is a gel electrophoresis image showing how the nicking enzyme Nt.BsmAI prevents the self-ligation of the CGAGAGAC linker in Example 2. Detailed Implementation

[0029] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention. Unless otherwise specifically stated, all raw materials, reagents, instruments, and equipment used in this invention are commercially available or can be prepared by existing methods.

[0031] the term

[0032] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0033] "Adapters" or "sequencing adapters" are an important component in constructing sequencing libraries. They are special DNA molecules containing two distinct sequences: one attached to the 3' end of the DNA or RNA sample, and the other attached to the primers of a high-throughput sequencer. The adapter's function is to ligate the sample's DNA or RNA molecules to the primers required by the high-throughput sequencer, enabling them to be recognized and amplified by the primers.

[0034] "Clipping enzyme" refers to an endonuclease that can recognize and cut specific sequences of DNA molecules. Clipping enzymes usually have a certain cleavage site specificity, meaning they can only cut DNA at specific nucleotide sequences.

[0035] "Positive strand" and "negative strand" refer to the positive linker and the negative linker, respectively. The positive linker is attached to the 5' end of the DNA, and the negative linker is attached to the 3' end of the DNA.

[0036] "Specific alteration" refers to artificially changing a base to a recognizable base.

[0037] In this invention, the technical features described in an open-ended manner include both closed-ended technical solutions composed of the listed features and open-ended technical solutions composed of the listed features.

[0038] In this invention, numerical ranges are involved, and unless otherwise specified, they include the two endpoints of the numerical range.

[0039] In this article, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this invention.

[0040] In this invention, terms such as "further," "even more," and "particularly" are used for descriptive purposes and to indicate differences in content, but should not be construed as limiting the scope of protection of this invention.

[0041] In this invention, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0042] Unless otherwise specified, the temperature parameters in this invention can be either constant temperature treatment or variations within a certain temperature range. It should be understood that the constant temperature treatment allows temperature fluctuations within the precision range controlled by the instrument. Fluctuations are permitted within ranges such as ±5℃, ±4℃, ±3℃, ±2℃, and ±1℃.

[0043] Some embodiments of the present invention provide a method for constructing a sequencing library, including steps S10 to S30.

[0044] S10: Provides the enzyme fragment of the DNA to be tested;

[0045] S20: The above-mentioned enzyme-digested fragments and sequencing adapters were ligated using a ligase, and nicking enzyme was added to prepare the adapter product; and

[0046] S30: PCR amplification was performed using the adapter product as a template to construct a sequencing library;

[0047] The nucleotide sequence of the sequencing adapter contains the cleavage site of the nicking enzyme, and the first base upstream of the cleavage site of the nicking enzyme is specifically altered.

[0048] Understandably, specifically altering the first base sequence upstream of the cleavage site of the nicking enzyme can effectively prevent the appearance of an endonuclease recognition site during linker self-ligation.

[0049] In one embodiment, in step S10, the enzyme fragment of the DNA to be tested is prepared using the method shown in (a) or (b):

[0050] (a) The DNA to be tested was digested with a methylation-dependent restriction endonuclease to prepare the digested fragment a;

[0051] (b) The DNA to be tested was digested using a non-methylation-dependent restriction endonuclease to prepare digested fragment b.

[0052] In some specific examples, in step S20, the methylation-dependent restriction endonuclease is FspEI, MspJ1, or LpnPI.

[0053] In some specific examples, in step S20, the nonmethylation-dependent restriction endonuclease is MspI, AciI, HinP1I, HpyCH4IV, HpaII, ClaI, BsaHI, SalI, AvaI, BsiEI, Hpy99I, PvuI, MluI, EagI, BstNI, or PcilI.

[0054] In some specific examples, where the restriction fragment is restriction fragment a, the 5' protruding base sequence of the sequencing adapter is NNNN, where each N is independently selected from any one of A, T, C, and G.

[0055] In some specific examples, where the enzyme fragment is enzyme fragment b, the 5' protruding base sequence of the above sequencing adapter is CG.

[0056] In some specific examples, in step S20, the ligase is T4 DNA ligase.

[0057] In one embodiment, in step S20, the cleavage enzyme is Nt.BsmAI. The cleavage site of Nt.BsmAI is GAGAC.

[0058] In one embodiment, in step S20, the nicking enzyme may also be Nb.BsmI, Nb.BsrDI, Nb.BtsI, Ntsc.AlwI, Nt.BstNBI, or Nt.BspQI.

[0059] The cleavage action of nicking enzymes can create specific nicks in DNA molecules, thereby producing DNA fragments with specific sticky ends.

[0060] Understandably, when nicking enzyme sites are introduced into sequencing adapters, the nicking enzyme sites at both ends can be recognized by the nicking enzyme when the adapter self-ligates, and the self-ligated double-stranded DNA is re-cut into two adapters identical to the original adapter.

[0061] The cleavage site of a nicking enzyme refers to the DNA sequence that the nicking enzyme recognizes and cuts. Different nicking enzymes have different cleavage sites. Nt.BsmAI is a nicking endonuclease that can specifically cleave one strand of a double-stranded DNA substrate.

[0062] In one embodiment, in step S10, when the enzyme fragment is enzyme fragment a, the first base upstream of the cleavage site of the nicking enzyme is specifically changed to G, and the nucleotide sequence of the sequencing adapter includes NNNNGGAGAC.

[0063] In one embodiment, in step S10, when the enzyme fragment is enzyme fragment b, the first base upstream of the cleavage site of the nicking enzyme is specifically changed to A, and the nucleotide sequence of the sequencing adapter includes CGAGAGAC.

[0064] In such Figure 1 In the example shown, the 5' end protruding base of the long sequencing adapter is 5'-CGAGAGAC-3', and the 3' end protruding base sequence of the short adapter is 3'-TCTCTG-5'. Step ① is mediated by the restriction enzyme MspI, step ② by the nicking enzyme Nt.BsmAI, and step ③ by the T4 ligase. When MspI, Nt.BsmAI, and T4 ligase are present simultaneously in the reaction, reactions ① and ② are reversible. When the enzyme digestion products of reactions ① and ② are ligated, reaction ③ occurs under the catalysis of T4 ligase, at which point the template binds to the adapter, generating the adapter product. Because the sequencing adapter sequence contains a specifically modifiable base, when the two bind, the MspI restriction site is eliminated, therefore reaction ③ is a one-way irreversible reaction; the irreversibility of reaction ③ is beneficial for improving the efficiency of library construction.

[0065] The above method can effectively reduce the self-ligation rate between sequencing adapters, thereby improving the ligation efficiency between sequencing adapters and the test fragments and the pass rate of sequencing data, and increasing the proportion of test fragments and adapter ligation products in the sequencing data.

[0066] Other embodiments of the present invention provide a sequencing adapter.

[0067] In some embodiments, the sequencing adapter includes a cleavage site for a nicking enzyme.

[0068] Furthermore, the sequencing adapters described above include cleavage sites for the nicking enzyme Nt.BsmAI.

[0069] In some embodiments, the base sequence protruding from the 5' end of the sequencing adapter is NNNN, where each N is independently selected from any one of A, T, C, and G.

[0070] In some specific examples, the nucleotide sequence of the sequencing adapter mentioned above includes NNNNGGAGAC; its complementary strand includes the nucleotide sequence 3'-CCTCTG-5'.

[0071] In some embodiments, the protruding base sequence at the 5' end of the sequencing adapter is CG.

[0072] In some specific examples, the nucleotide sequence of the sequencing adapter includes CGAGAGAC; its complementary strand includes the nucleotide sequence 3'-TCTCTG-5'.

[0073] The sequencing adapters described above incorporate nicking enzyme sites. Under the action of the nicking enzyme, the self-ligated adapters can be cut and restored to the same adapter as the original adapter, thereby improving the ligation efficiency between the sequencing adapter and the target fragment and the pass rate of sequencing data, and increasing the proportion of the target fragment and adapter ligation products in the sequencing data.

[0074] The present invention will be further described below with reference to specific embodiments and comparative examples, but these should not be construed as limiting the scope of protection of the present invention.

[0075] Example 1:

[0076] (1) Use the positive strand of nucleotide sequence as shown in SEQ ID NO.1 and the reverse strand of nucleotide sequence as shown in SEQ ID NO.2 as sequencing adapters.

[0077] SEQ ID NO.1:

[0078] NNNNGGAGAC AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGNNNNATCTCGTATGCCGTCTTC (The underlined part represents the 5' end protruding base sequence, the specifically altered base sequence, and the cleavage site of the nicking enzyme)

[0079] SEQ ID NO.2:

[0080] ACCACCGAGATCTACACNNNNTGAACCTTACACTCTTTCCCTACACGACGCTCTTCCGATCT GTCTCC

[0081] (2) Enzyme digestion and ligation

[0082] 1 μL of 100 μmol positive and negative strands were taken and synthesized into bilinking heads under 1× annealing buffer (Solarbio).

[0083] Annealing conditions: 95℃ for 3 minutes, decreasing by 1℃ every 2 minutes until reaching 25℃. Store at 4℃.

[0084] The synthesized dual-linked heads were prepared according to the reaction systems shown in Table 1, and ligated and digested overnight at 37°C.

[0085] Table 1

[0086]

[0087] 5 μL of the enzyme digestion product was subjected to agarose gel electrophoresis on a 2% agarose gel at 100 V for 45 min. The electrophoresis results are as follows. Figure 2 As shown, lane M represents the 50bp DNA ladder; lane 1 shows the electrophoresis results of double-linked DNA without ligase; lane 2 shows the electrophoresis results of double-linked DNA with ligase, where self-ligation of the double-linked DNA occurred; lane 3 shows the electrophoresis results of double-linked DNA with ligase, 300 ng of adapter, and then nicking enzyme Nt.BsmAI, where self-ligation of the double-linked DNA did not occur; lane 4 shows the electrophoresis results of double-linked DNA with ligase, 600 ng of adapter, and then nicking enzyme Nt.BsmAI, where self-ligation of the double-linked DNA did not occur. These results indicate that 2.5 μL of nicking enzyme Nt.BsmA, under overnight ligation and digestion conditions at 37°C, can prevent at least 600 ng of double-linked DNA from self-ligating.

[0088] Example 2:

[0089] (1) Use the positive strand of nucleotide sequence as shown in SEQ ID NO.3 and the reverse strand of nucleotide sequence as shown in SEQ ID NO.4 as sequencing adapters.

[0090] SEQ ID NO.3:

[0091] CGAGAGAC AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGNNNNATCTCGTATGCCGTCTTC

[0092] SEQ ID NO.4:

[0093] ACCACCGAGATCTACACNNNNTGAACCTTACACTCTTTCCCTACACGACGCTCTTCCGATCT GTCTCT

[0094] (2) Enzyme digestion and ligation

[0095] 1 μL of 100 μmol positive and negative strands were taken separately and synthesized into bilinking heads under 1× annealing buffer.

[0096] The synthesized dual-linked heads were prepared according to the reaction systems shown in Table 2, and ligated and digested overnight at 37°C.

[0097] Table 2

[0098]

[0099] 5 μL of the enzyme digestion product was subjected to agarose gel electrophoresis on a 2% agarose gel at 100 V for 45 min. The electrophoresis results are as follows. Figure 3 As shown, lane M is the 50bp DNA ladder. Lane 1 shows the electrophoresis results of double-linked DNA without ligase; lane 2 shows the electrophoresis results of double-linked DNA with ligase, where self-ligation of the double-linked DNA occurred; lane 3 shows the electrophoresis results of double-linked DNA with ligase, 300 ng of adapter, and then nicking enzyme Nt.BsmAI, where self-ligation of the double-linked DNA did not occur; lane 4 shows the electrophoresis results of double-linked DNA with ligase, 600 ng of adapter, and then nicking enzyme Nt.BsmAI, where self-ligation of the double-linked DNA did not occur. These results indicate that 2.5 μL of nicking enzyme Nt.BsmA, under overnight ligation and digestion conditions at 37°C, can prevent at least 300 ng of double-linked DNA from self-ligating and significantly reduce the self-ligation of 600 ng of double-linked DNA.

[0100] Example 3:

[0101] (1) The positive chain of the NNNN-3 linker is shown in SEQ ID NO.1, and the anti-chain is shown in SEQ ID NO.5; the positive chain of the NNNN-B4 is shown in SEQ ID NO.1, and the anti-chain is shown in SEQ ID NO.6. 1 μL of the positive and anti-chain at a concentration of 100 μmol were taken respectively, and bi-linked linkers were synthesized under 1× annealing buffer.

[0102] SEQ ID NO.1:

[0103] NNNNGGAGAC AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGNNNNATCTCGTATGCCGTCTTC

[0104] SEQ ID NO.5:

[0105] ACCACCGAGATCTACACNNNNTGTTCCTACACTCTTTCCCTACACGACCGCTCTTCCGATCT GTCTCC

[0106] SEQ ID NO.6:

[0107] ACCACCGAGATCTACACNNNNTAAGACACACACTCTTTCCCTACACGACGCTCTTCCGATCT GTCTCC

[0108] (2) The gDNA of HCT116 cells was digested with the methylation-dependent endonuclease MspJI. The digestion system is shown in Table 3. The reaction procedure was: digestion at 37℃ for 15 minutes, followed by inactivation of MspJI enzyme at 60℃ for 20 minutes.

[0109] Table 3

[0110] Element content HCT116gDNA 100ng 10x CutSmart TM Buffer 3μL MspJI 0.4μL ddH2O To 30μL

[0111] (3) The enzyme fragments prepared in step (2) were ligated using TA ligase, and nicking enzyme Nt.BsmAI was added to prevent self-ligation of the double linker; the ligation reaction system is shown in Table 4. The ligation reaction procedure was: overnight at 37°C, followed by reaction at 65°C for 20 min to inactivate T4 ligase.

[0112] Table 4

[0113]

[0114] (4) PCR amplification

[0115] The PCR reaction system is shown in Table 5. The PCR amplification reaction program is as follows: 95℃ for 2 min, 1 cycle; 95℃ for 10 s, 58℃ for 20 s, 72℃ for 30 s, 10 cycles; 72℃ for 1 min, 1 cycle; store at 4℃.

[0116] Table 5

[0117] Element content 2×taq Master Mix 25μL Primer F 2μL Primer R 2μL Previous step connection product 10μL ddH2O To 50μL

[0118] (5) Next-generation sequencing

[0119] The PCR amplification product from step (4) was sent to Nanjing Jiangbei New Area Biomedical Public Service Platform Co., Ltd. for next-generation sequencing. The nucleotide sequences of the sequencing primers are shown in SEQ ID NO.7 and SEQ ID NO.8. The sequencing results are shown in Table 6.

[0120] SEQ ID NO.7:CAAGCAGAAGACGGCATACGAGAT

[0121] SEQ ID NO.8: AATGATACGGCGACCACCGAGATCTACAC

[0122] Table 6

[0123] serial number NNNN-3 NNNN-B4 RawReads 4489814 4900630 RawBases 646533216 705690720 RawQ20 (%) 92.91 94.27 RawQ30 (%) 85.69 88.20 RawGC (%) 69.24 66.08 CleanReads 356228 1364138 ClanBases 38755642 148320754 CleanQ20 (%) 96.72 96.93 CleanQ30 (%) 91.54 91.87 CleanGC (%) 53.31 53.27 Cleanper (%) 5.99 21.02

[0124] Without the nicking enzyme Nt.BsmAI, the ligation rate of the NNNN-3 adapter was approximately 94%, and the pass rate was approximately 6%. With the nicking enzyme Nt.BsmAI, the ligation rate of the NNNN-B4 adapter was approximately 80%, and the pass rate was 21.02%. Since the ratio of adapters added to the reaction system was 10 times that of the template, adapter self-ligation was always present. However, with the addition of the nicking enzyme, the pass rate of sequencing data was approximately three times that without it. These results indicate that adding the nicking enzyme effectively reduces the adapter self-ligation rate and improves the pass rate of sequencing data during the ligation process between the adapter and the DNA in the test sample.

[0125] Example 4:

[0126] (1) The positive chain of the MspI connector is shown in SEQ ID NO.3, and the negative chain is shown in SEQ ID NO.4; the positive chain of the MspI-B2 connector is shown in SEQ ID NO.3, and the negative chain is shown in SEQ ID NO.9.

[0127] SEQ ID NO.3:

[0128] CGAGAGAC AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGNNNNATCTCGTATGCCGTCTTC

[0129] SEQ ID NO.4:

[0130] ACCACCGAGATCTACACNNNNTGAACCTTACACTCTTTCCCTACACGACGCTCTTCCGATCT GTCTCT

[0131] SEQ ID NO.9:

[0132] ACCACCGAGATCTACACNNNNTGCTAAGTACACTCTTTCCCTACACGACGCTCTTCCGATCT GTCTCT

[0133] (2) The gDNA of HCT116 cells was digested using the methylation-dependent endonuclease MspI. The digestion system is shown in Table 7. The digestion reaction procedure was: digestion at 37℃ for 3 h (this enzyme is a non-heat-inactivated enzyme).

[0134] Table 7

[0135] Element content HCT116gDNA 100ng <![CDATA[10×CutSmart TM Buffer]]> 3μL MspI 0.4μL <![CDATA[ddH2O]]> To 30μL

[0136] (3) The enzyme fragments prepared in step (2) were ligated using TA ligase, and nicking enzyme Nt.BsmAI was added to prevent self-ligation of the double linker; the ligation reaction system is shown in Table 8. The ligation reaction procedure was: overnight at 24℃, followed by reaction at 65℃ for 20 min to inactivate T4 ligase.

[0137] Table 8

[0138]

[0139] (4) PCR amplification

[0140] The PCR reaction system is shown in Table 9; the PCR amplification reaction program is as follows: 95℃ for 2 min, 1 cycle; 95℃ for 10 s, 58℃ for 20 s, 72℃ for 30 s, 10 cycles; 72℃ for 1 min, 1 cycle; store at 4℃.

[0141] Table 5

[0142] Element content 2×taq Master Mix 25μL Primer F 2μL Primer R 2μL Previous step connection product 10μL <![CDATA[ddH2O]]> To 50μL

[0143] (5) Next-generation sequencing

[0144] The PCR amplification product from step (4) was sent to Nanjing Jiangbei New Area Biomedical Public Service Platform Co., Ltd. for next-generation sequencing. The nucleotide sequences of the sequencing primers are shown in SEQ ID NO.7 and SEQ ID NO.8. The sequencing results are shown in Table 10.

[0145] Table 10

[0146] serial number MspI-1 MspI-B2 RawReads 26566818 40143872 RawBases 3825621792 5780717568 RawQ20 (%) 92.92 93.32 RawQ30 (%) 85.23 85.90 RawGC (%) 70.38 70.24 CleanReads 125266 728734 ClanBases 13041735 79010335 CleanQ20 (%) 94.35 94.61 CleanQ30 (%) 86.24 86.55 CleanGC (%) 56.04 57.50 Cleanper (%) 0.34 1.37

[0147] When ligating MspI-1 adapters without the nicking enzyme Nt.BsmAI, the adapter self-ligation rate was approximately 100%, and the pass rate was approximately 0.34%. When ligating MspI-B2 adapters with the nicking enzyme Nt.BsmAI, the self-ligation rate was approximately 98%, and the pass rate was 1.37%. Since the ratio of adapters added to the reaction system was 10 times the ratio of templates, adapter self-ligation was always present in the system; however, with the addition of the nicking enzyme, the pass rate of sequencing data was approximately 4 times that without the nicking enzyme. These results indicate that adding the nicking enzyme during the ligation of adapters to the DNA of the sample to be tested can effectively reduce the adapter self-ligation rate and improve the pass rate of sequencing data.

[0148] In summary, the method of this invention can effectively prevent self-ligation between sequencing adapters, thereby improving the ligation efficiency between sequencing adapters and the test fragments and the pass rate of sequencing data.

[0149] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0150] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A method for constructing a sequencing library, characterized in that, Includes the following steps: Provide the restriction enzyme fragments of the DNA to be tested; The enzyme fragment and sequencing adapter were ligated using a ligase, and a nicking enzyme was added to prepare the adapter product; the nicking enzyme was Nt.BsmAI; and The adapter product was used as a template for PCR amplification to construct the sequencing library; The nucleotide sequence of the sequencing adapter contains the cleavage site of the nicking enzyme, and the first base upstream of the cleavage site of the nicking enzyme is specifically altered. The enzyme-digested fragments of the DNA to be tested are prepared using the method shown in (a) or (b): (a) The DNA to be tested was digested with a methylation-dependent restriction endonuclease to prepare enzyme fragment a; (b) The DNA to be tested was digested with a non-methylation-dependent restriction endonuclease to prepare enzyme fragment b. When the enzyme digestion fragment is enzyme digestion fragment a, the first base upstream of the cleavage site of the nicking enzyme is specifically changed to G, and the nucleotide sequence of the sequencing adapter includes NNNNGGAGAC; when the enzyme digestion fragment is enzyme digestion fragment b, the first base upstream of the cleavage site of the nicking enzyme is specifically changed to A, and the nucleotide sequence of the sequencing adapter includes CGAGAGAC.

2. The method for constructing a sequencing library according to claim 1, characterized in that, The methylation-dependent restriction endonuclease is FspEI, MspJ1, or LpnPI.

3. The method for constructing a sequencing library according to claim 1, characterized in that, The nonmethylation-dependent restriction endonuclease is MspI, AciI, HinP1I, HpyCH4IV, HpaII, ClaI, BsaHI, SalI, AvaI, BsiEI, Hpy99I, PvuI, MluI, EagI, BstNI, or PcilI.

4. The method for constructing a sequencing library according to any one of claims 1 to 3, characterized in that, When the enzyme digestion fragment is enzyme digestion fragment a, the 5' end protruding base sequence of the sequencing adapter is NNNN, where each N is independently selected from any one of A, T, C and G.

5. The method for constructing a sequencing library according to any one of claims 1 to 3, characterized in that, Under the condition that the enzyme digestion fragment is enzyme digestion fragment b, the base sequence protruding from the 5' end of the sequencing adapter is CG.

Images