Application of naphthyridinone derivatives

Abstract

The present invention provides an application of a naphthyridone derivative, specifically an application of the naphthyridone derivative in the preparation of a drug for preventing and treating non-alcoholic fatty liver fibrosis. The drug prepared from the naphthyridone derivative can effectively improve the degree of liver fibrosis caused by a high-fat diet, and can prevent and treat non-alcoholic fatty liver fibrosis.

Description

Technical field:

[0001] The invention relates to an application of a naphthyridinone derivative, namely, an application of the naphthyridinone derivative in preparing a medicine for preventing and treating non-alcoholic fatty liver fibrosis. Background technology:

[0002] Nonalcoholic fatty liver disease (NAFLD), also known as metabolic associated fatty liver disease (MAFLD), refers to a clinical pathological syndrome characterized by fatty degeneration and excessive fat deposition in hepatocytes without alcohol or other clear factors (World J Gastroenterol, 2014, 20(27): 9026-9037). In the absence of intervention, the course of the disease can be divided into a series of diseases including simple fatty liver, nonalcoholic fatty liver disease, liver fibrosis, liver cirrhosis and hepatocellular carcinoma. Liver fibrosis is the necessary stage for the disease to develop into cirrhosis, and is the main prognostic indicator of the disease and the most important predictor of mortality. The pathological characteristics of liver fibrosis are excessive deposition of extracellular matrix (ECM) in the liver. Activation of hepatic stellate cells (HSC) is recognized as the core event of liver fibrosis. Activated HSCs proliferate in large numbers and transform into myofibroblasts, secreting excessive collagen (the main component of ECM) which is deposited in the intercellular spaces of the liver, destroying the liver structure and impairing liver function (Gut, 2015, 64(5):830-841). Therefore, inhibiting HSC activation and collagen deposition is crucial in preventing and treating the occurrence and development of liver fibrosis.

[0003] NAFLD has become a global public health problem, affecting 24% of the world's total population. Its incidence rate among obese people is as high as 75%, making it the world's number one liver disease (Hepatol Res, 2015, 45(7):728-738). Advanced liver fibrosis and cirrhosis that develop from it have been confirmed to be the main causes of end-stage liver failure (Nat Rev Gastroenterol Hepatol, 2019 Mar; 16(3):145-159). According to surveys, the prevalence of NAFLD in adults in my country has reached 32.3%, and the disease has replaced hepatitis B and become the number one chronic liver disease in my country (Hepatol, 2019, 70(4):1119-1133). However, to date, there is no recognized effective drug for the treatment of NAFLD. Summary of the invention:

[0004] The purpose of the present invention is to provide a naphthyridinone derivative for use in preparing a medicament for preventing and treating fibrosis of non-alcoholic fatty liver disease.

[0005] The technical solution adopted by the present invention is:

[0006] The present invention provides a naphthyridinone derivative shown in formula I or a pharmaceutically acceptable salt, stereoisomer, solvate thereof for use in preparing a drug for preventing and treating non-alcoholic fatty liver disease fibrosis, especially a drug for preventing and treating non-alcoholic fatty liver disease fibrosis by inhibiting the expression of Acta2 and Col1a1.

[0007]

[0008] Furthermore, the naphthyridinone derivatives shown in formula I are used in the preparation of drugs for preventing and treating non-alcoholic fatty liver disease fibrosis.

[0009] Furthermore, the drug for preventing and treating non-alcoholic fatty liver disease fibrosis is composed of the naphthyridinone derivative represented by Formula I or its pharmaceutically acceptable salt, stereoisomer, solvate and a pharmaceutically acceptable carrier.

[0010] The pharmaceutically acceptable carrier refers to a conventional drug carrier in the pharmaceutical field, including conventional diluents in the pharmaceutical field such as water, fillers such as starch, binders such as cellulose derivatives, gelatin, wetting agents such as glycerol, disintegrants such as agar, calcium carbonate, absorption promoters such as quaternary ammonium compounds, surfactants such as hexadecanol, adsorption carriers such as kaolin, soap clay, lubricants such as talc, thickeners such as sodium carboxymethyl cellulose, etc. The pharmaceutically acceptable carrier is one or more of diluents, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers, and lubricants. Flavoring agents, sweeteners, etc. may also be added if necessary.

[0011] The pharmaceutical preparation is suitable for administration by any appropriate route, such as oral (including buccal or sublingual administration), rectal administration, nasal administration, topical administration (including buccal, sublingual or transdermal administration) or parenteral administration (including subcutaneous injection, intramuscular injection, intravenous injection or intradermal injection). These preparations can be prepared by any method known in the field of pharmacy. For example, by mixing the active ingredient with a carrier or excipient.

[0012] In one embodiment of the present invention, the drug for preventing and treating non-alcoholic fatty liver disease fibrosis consists of a naphthyridinone derivative represented by Formula I and an aqueous solution of 5 mg / mL sodium carboxymethyl cellulose.

[0013] In one embodiment of the present invention, the administered dose is 30 mg / kg (body weight) based on the mass of the active substance.

[0014] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0015] In the present invention, from the 9th week of NALFD mouse modeling, the naphthyridinone derivatives shown in formula I were intervened for 16 weeks at a concentration of 30 mg / kg / d. Compared with the mice in the disease group, the collagen deposition in the liver tissue of the intervention group mice was significantly reduced; the expression levels of the nucleic acid and protein of the HSC activation marker gene Acta2 were significantly reduced; and the expression of the nucleic acid and protein of the collagen Col1a1 was significantly reduced. Therefore, the naphthyridinone derivatives shown in formula I can effectively improve the liver tissue fibrosis of NAFLD mice. Therefore, the naphthyridinone derivatives shown in formula I can effectively reduce the degree of liver fibrosis caused by a high-fat diet, and can prevent and treat non-alcoholic fatty liver fibrosis. Description of the drawings:

[0016] Figure 1 Masson staining pathology of mice in each group. (The bar represents 100 μm).

[0017] Figure 2 The effect of naphthyridinone derivatives shown in formula I on the expression of Acta2 nucleic acid in mouse liver (in the bar graph, there are significant differences between bars with different characters, P<0.05).

[0018] Figure 3 The effect of naphthyridinone derivatives shown in formula I on the expression of Col1a1 nucleic acid in mouse liver (in the bar graph, there are significant differences between bars with different characters, P<0.05).

[0019] Figure 4 The effect of naphthyridinone derivatives shown in formula I on the expression of Acta2 protein in mouse liver. Figure A is the result of Western blot detection of protein expression, and Figure B is the statistical result of relative integrated grayscale (in the bar graph, there are significant differences between bars with different characters, P<0.05).

[0020] Figure 5 The effect of naphthyridinone derivatives shown in formula I on the expression of Col1a1 protein in mouse liver. Figure A is the result of protein expression detected by immunohistochemistry, and Figure B is the statistical result of relative integrated grayscale (the scale bar represents 100 μm; in the bar graph, there are significant differences between bars with different characters, P<0.05). Specific implementation method:

[0021] The present invention is further described in detail with reference to the following drawings and embodiments, but the protection content of the present invention is not limited thereto.

[0022] 1. Materials:

[0023] 1.1 Experimental Animals:

[0024] C57BL / 6J strain SPF grade, 6-8 weeks old male mice were purchased from Zhejiang Weitonglihua Experimental Animal Technology Co., Ltd., production license number: SCXK(Zhe)2019-0001, and were raised in the Animal Experiment Research Center of Zhejiang Chinese Medical University.

[0025] 1.2 Feed:

[0026] Normal feed was provided by the Animal Experiment Research Center of Zhejiang Chinese Medical University, and high-fat feed was purchased from Nantong Trofi Feed Technology Co., Ltd. The energy supply ratio of ordinary feed was: 21.6% protein, 12.3% fat, 66.1% carbohydrates; the energy supply ratio of high-fat feed was: 21.6% protein, 36.1% fat, 42.3% carbohydrates.

[0027] 1.3 Reagents:

[0028] CMC-Na was purchased from Selleckchem with the product number S6803. The naphthyridinone derivative represented by formula I was purchased from APExBIO with the product number B2301.

[0029] 1.4qRT-PCR related reagents and primers:

[0030] RNA extraction kit TaKaRaMiniBEST Universal RNAExtraction Kit was purchased from TaKara, catalog number 9767. Reverse transcription reagent premix Evo M-MLV RT Premix for qPCR was purchased from Hunan Aikerui Bioengineering Co., Ltd., catalog number: AG11706. SYBR Green Pro Taq HS premix qPCR kit GreenPremix Pro Taq HS qPCR Kit was purchased from Hunan Aikerui Bioengineering Co., Ltd., catalog number: AG11701. The instrument was CFX-384 Bio-Rad.

[0031] Primer information is as follows:

[0032] Gene name Primer sequence (forward) Primer sequence (reverse) Acta2 GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA Col1a1 GCTCCTCTTAGGGGCCACT CCACGTCTCACCATTGGGG β-Actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT

[0033] 1.5 Western blot and immunohistochemistry antibodies:

[0034] Acta2 antibody was purchased from Abcam, catalog number ab32575. Col1a1 antibody was purchased from Cell Signaling Technology, catalog number 72026S. Gapdh antibody was purchased from Lianke Biotechnology Co., Ltd., catalog number Mab5465-100. Goat anti-Rabbit IgG was purchased from Lianke Biotechnology Co., Ltd., catalog number GAR0072.

[0035] 2. Experimental methods:

[0036] 2.1 Construction of disease model: After 1 week of adaptive feeding, the mice were randomly divided into 3 groups: normal group (6 mice), disease group (6 mice), and naphthyridinone derivative intervention group (6 mice). The normal group was fed with ordinary feed, and the other two groups were fed with high-fat feed for a total of 24 weeks.

[0037] 2.2 Experimental administration: Starting from the 9th week of high-fat diet, the naphthyridinone derivative group of Formula I was gavaged with 30 mg / kg (mouse body weight) of naphthyridinone derivative of Formula I (dissolved in 5 mg / mL CMC-Na aqueous solution) every day, and the mice in the normal group and disease group were gavaged with an equal volume of solvent 5 mg / mL CMC-Na (sodium carboxymethyl cellulose) aqueous solution every day until the end of the 24th week.

[0038] 2.3 Specimen collection: All mice were processed at the end of the 24th week. Mice in each group were fasted but not watered for 12 hours the night before processing. Blood was drawn under anesthesia, and liver specimens were collected. Some were fixed in fixative and then embedded in paraffin for pathological observation and immunohistochemistry, and the remaining liver tissue was used for molecular detection.

[0039] 3. Detection indicators:

[0040] 3.1 Liver histopathology experiment

[0041] Masson staining: After dewaxing and hydration, the paraffin sections of mouse liver tissue were stained to show the collagen deposition in the tissue. The staining was observed under a microscope and scanned with a digital pathology section scanner (AxioScan.Z1). The specific experimental method is a prior art and will not be described in detail here. The results are shown in Figure 1 .

[0042] 3.2 Detection of liver fibrosis indicators

[0043] RNA was extracted from mouse liver tissue, and the expression of Acta2 and Col1a1 gene nucleic acid in liver tissue was detected by qRT-PCR. The specific experimental method is prior art and will not be described in detail here. Figure 2 , 3 .

[0044] Mouse liver tissue protein was extracted and the expression of Acta2 protein in liver tissue was detected by Western blot. The specific experimental method is prior art and will not be described in detail here. The analysis results are shown in Figure 4 .

[0045] The expression of Col1a1 protein in mouse liver tissue was detected by immunohistochemistry, the staining was observed under a microscope, and the samples were scanned with a digital pathology section scanner (AxioScan.Z1). The specific experimental method is prior art and will not be described in detail here. The results are analyzed and shown in the table below. Figure 5 .

[0046] 3.3 Statistical methods

[0047] SPSS22.0 software package was used for statistical analysis. All quantitative data were expressed as mean ± standard deviation (Mean ± SD). One-way analysis of variance was used, and each group was compared pairwise. If the variance was homogeneous, the LSD test was used, and if the variance was unequal, the Dunnett's T3 test was used. P < 0.05 was considered statistically significant.

[0048] 4. Experimental results:

[0049] Figure 1 The effect of naphthyridinone derivatives of formula I of the present invention on collagen deposition in mouse liver tissue. The results of Masson staining showed that the liver tissue structure of mice in the normal group was normal, with only a small amount of blue collagen deposition in the interstitial cells; the liver tissue structure of mice in the disease group was severely damaged, with a large amount of blue collagen deposition in the interstitial cells; and the liver collagen deposition of mice in the naphthyridinone derivative intervention group of formula I was significantly reduced.

[0050] Figure 2 The results show that compared with the normal group, the Acta2 expression level in the disease group was significantly increased; compared with the disease group, the Acta2 expression level in the naphthyridinone derivative intervention group of formula I was significantly decreased.

[0051] Figure 3 The results show that compared with the normal group, the expression of Col1a1 in the disease group was significantly increased; compared with the disease group, the expression of Col1a1 in the intervention group of the naphthyridinone derivative of formula I was significantly decreased.

[0052] Figure 4The results show that compared with the normal group, the expression of Acta2 protein in the disease group was significantly increased; compared with the disease group, the expression of Acta2 protein in the naphthyridinone derivatives of formula I intervention group was significantly decreased. Figure A shows the Western blot detection of each group, and Figure B shows the relative expression results of the integrated gray value statistics.

[0053] Figure 5 The effect of naphthyridinone derivatives of formula I of the present invention on the expression level of Col1a1 protein in mouse liver tissue. The results showed that compared with the normal group, the Col1a1 collagen deposition in the extracellular matrix of liver tissue of mice in the disease group was significantly increased; compared with the disease group, the Col1a1 collagen deposition in the extracellular matrix of tissues intervened by naphthyridinone derivatives of formula I was significantly reduced. Figure A shows the immunohistochemical detection of each group, and Figure B shows the relative expression results of the integrated gray value statistics.

Claims

1. Use of a naphthyridinone derivative represented by formula I or a pharmaceutically acceptable salt thereof in the preparation of a drug for preventing and treating fibrosis of non-alcoholic fatty liver disease I。 2. The use according to claim 1, Features: The drug for preventing and treating non-alcoholic fatty liver disease fibrosis consists of the naphthyridinone derivative represented by formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

3. The use according to claim 2, Features: The pharmaceutically acceptable carrier is one or more of a diluent, a filler, a binder, a wetting agent, a disintegrant, an absorption accelerator, a surfactant, an adsorption carrier, and a lubricant.

4. The use according to claim 3, Features: The diluent is water.

5. The use according to claim 1, Features: The drug for preventing and treating non-alcoholic fatty liver disease fibrosis consists of a naphthyridinone derivative shown in formula I and a 5 mg / mL aqueous solution of sodium carboxymethyl cellulose.

Images