A drug for targeted treatment of inflammatory diseases

Abstract

The present invention discloses a drug for targeted treatment of inflammatory diseases, belonging to the field of pharmaceuticals. The present invention uses a tetrahedral framework nucleic acid modified with a DNA aptamer targeting TNF-α as a carrier to load methotrexate to form a complex. The complex of the present invention has a high encapsulation rate of MTX, improving the bioavailability of MTX. In an LPS-induced macrophage inflammation model, the complex of the present invention can significantly reduce the ROS and NO levels of macrophages, protect cell viability, promote the polarization of M1 macrophages to M2 macrophages, and reduce the expression and secretion of inflammatory factors (including IL-1β, IL-6 and TNF-α). In a collagen-induced rheumatoid arthritis rat model, the complex of the present invention can significantly improve the joint swelling and inflammation of rheumatoid arthritis rats, target inflamed joint tissues, relieve cartilage loss, and alleviate rheumatoid arthritis. The complex of the present invention is simple to synthesize, has a stable structure, has excellent biosafety and absorption efficiency, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceuticals, and particularly relates to a drug for targeted treatment of inflammatory diseases and a preparation method thereof. Background Art

[0002] Rheumatoid arthritis is a disease mainly characterized by inflammatory synovitis, which is characterized by polyarticular, symmetrical, and invasive joint inflammation of small joints of the hands and feet, often accompanied by extra-articular organ involvement and positive serum rheumatoid factor, which can lead to joint deformity and loss of function, and ultimately lead to severe disability, systemic complications and even death. The pathological progression of RA is closely related to immune system disorders, which cause extensive infiltration of macrophages and neutrophils and promote the rapid proliferation of fibroblast-like synoviocytes (FLS). Among them, activated macrophages, as the most prominent cells, play a key role in the progression of RA inflammatory joints. M2 macrophages can repair damaged tissues by secreting anti-inflammatory cytokines. M1 macrophages damage tissues by secreting a large number of inflammatory factors, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), and reactive oxygen species (ROS) in RA lesions. It has been found that TNF-α plays an important role in the formation and progression of RA inflammation by inducing the secretion of other pro-inflammatory cytokines.

[0003] In 1951, Gubner first successfully applied methotrexate (abbreviated as MTX) to treat patients with RA and psoriasis, achieving good curative effects. Currently, MTX has been widely used in various inflammatory diseases, such as rheumatoid arthritis, juvenile idiopathic arthritis, dermatomyositis, vasculitis, ankylosing spondylitis, systemic lupus erythematosus, etc. When MTX is used to treat RA, it is mostly administered orally. However, as a chronic immune disease, RA requires long-term medication, and many patients have to discontinue the drug due to the severe side effects of MTX. To solve this problem, MTX for intra-articular injection has been developed since the 1970s. It has a rapid onset and can exert a good local effect. However, its clearance rate from the joint cavity is fast, and it is prone to leakage and cause systemic absorption, so its wider application is limited; in addition, long-term and frequent injection administration also reduces the compliance of patients and may even cause joint infection. With the increasing in-depth research on biodegradable polymer particle dispersion systems, the preparation of microspheres and nanoparticles for intra-articular injection with polymer materials as carriers has become a research hotspot for intra-articular sustained-release preparations. Moliduer et al. (Chinese Journal of New Drugs, 2007, 16(15): 1187) prepared a sustained-release methotrexate microsphere for intra-articular injection with poly(lactic-co-glycolic acid) (abbreviated as PLGA) as the carrier, which prolonged the sustained-release time of MTX and increased the retention time of the drug in the joint. However, PLGA will produce acidic products after complete degradation in vivo, and even cause an acute inflammatory reaction in the initial stage of injection. Therefore, it is necessary to develop a drug delivery system with higher biocompatibility for MTX.

[0004] Tetrahedral framework nucleic acids (tFNA) is a tetrahedral structure formed by 4 single-stranded DNAs through denaturation and renaturation, and then base complementary pairing between strands. It is easy to synthesize and has high biocompatibility, and is usually used as a carrier for certain drugs. However, the traditional tetrahedral framework nucleic acids loaded with MTX have limited therapeutic effects on rheumatoid arthritis and are difficult to efficiently target inflamed joint tissues.

[0005] In summary, there is an urgent need to develop a drug with high biocompatibility, strong targeting effect, and excellent therapeutic effect on inflammatory diseases. Summary of the Invention

[0006] The problem to be solved by the present invention is to provide a new drug for targeted treatment of inflammatory diseases (especially rheumatoid arthritis) and its preparation method.

[0007] The present invention provides a complex, which is prepared from tetrahedral framework nucleic acids modified with a DNA aptamer targeting TNF-α and an anti-inflammatory drug, and the molar ratio of the tetrahedral framework nucleic acids modified with the DNA aptamer targeting TNF-α to the anti-inflammatory drug is 1:(50 - 500).

[0008] Furthermore, the molar ratio of the TNF-α-targeting DNA aptamer-modified tetrahedral framework nucleic acid to the anti-inflammatory drug is 1:100.

[0009] Furthermore, the sequence of the TNF-α-targeting DNA aptamer is as shown in SEQ ID NO.5;

[0010] and / or, the anti-inflammatory drug is methotrexate.

[0011] GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC (SEQ ID NO.5).

[0012] Furthermore, the TNF-α-targeting DNA aptamer-modified tetrahedral framework nucleic acid is composed of 4 single-stranded DNAs with sequences as shown in SEQ ID NOs.1-4 through base complementary pairing.

[0013] Furthermore, the preparation method of the TNF-α-targeting DNA aptamer-modified tetrahedral framework nucleic acid is: dissolving 4 single-stranded DNAs in a buffer, mixing well, heating to 93-98 °C and maintaining for 5-15 minutes, and then cooling to 2-6 °C and maintaining for 15-25 minutes to obtain it.

[0014] The present invention also provides a preparation method of the above complex, and the preparation method is: mixing the TNF-α-targeting DNA aptamer-modified tetrahedral framework nucleic acid and the anti-inflammatory drug and incubating to obtain it.

[0015] Furthermore, the temperature of the incubation is 4-30 °C, preferably room temperature; the incubation time is 0.5-15 hours, preferably 6 hours; during incubation, the concentration of the anti-inflammatory drug is 2.5-100 μM, preferably 10-20 μM.

[0016] The present invention also provides the use of the above complex in the preparation of a drug for preventing and / or treating inflammatory diseases.

[0017] Furthermore, the inflammatory disease is rheumatoid arthritis, juvenile idiopathic arthritis, dermatomyositis, vasculitis or ankylosing spondylitis, preferably rheumatoid arthritis.

[0018] Furthermore, the drug can reduce the ROS level of macrophages, reduce the NO level of macrophages, promote the polarization of macrophages from the M1 type to the M2 type, reduce the expression and secretion of inflammatory factors, relieve joint swelling and inflammation, and / or relieve bone loss.

[0019] The present invention also provides a drug for preventing and / or treating inflammatory diseases, which is a preparation prepared from the above-mentioned complex as an active ingredient and pharmaceutically acceptable excipients.

[0020] The present invention uses a tetrahedral framework nucleic acid modified with a DNA aptamer targeting TNF-α (abbreviated as Tapt) as a carrier to load methotrexate to form a complex MTX@Tapt-tFNA. The complex MTX@Tapt-tFNA of the present invention has a high encapsulation rate for MTX and improves the bioavailability of MTX.

[0021] In the LPS-induced macrophage inflammation model, the complex of the present invention can significantly reduce the ROS and NO levels of macrophages, protect cell viability, promote the polarization of M1 macrophages to M2 macrophages, and reduce the expression and secretion of inflammatory factors (including IL-1β, IL-6, and TNF-α). Notably, the effect of the complex in reducing the ROS level in the inflammation model has a synergistic effect.

[0022] In the collagen-induced rheumatoid arthritis rat model, the complex MTX@Tapt-tFNA of the present invention can effectively deliver and accumulate MTX to the inflamed joints, and significantly reduce joint inflammation, bone resorption, and cartilage damage without increasing toxic side effects. The complex can significantly improve joint swelling and inflammation in rheumatoid arthritis rats, target inflamed joint tissues, relieve cartilage loss, and alleviate rheumatoid arthritis.

[0023] The complex MTX@Tapt-tFNA of the present invention is not only simple to synthesize and has a stable structure, but also has excellent biological safety and absorption efficiency, and has broad application prospects.

[0024] Obviously, based on the above content of the present invention, according to the common general technical knowledge and conventional means in the art, without departing from the above basic technical idea of the present invention, various other forms of modifications, substitutions, or changes can be made.

[0025] The following is a further detailed description of the above content of the present invention through specific embodiments in the form of examples. However, this should not be understood as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention belong to the scope of the present invention. Brief Description of the Drawings

[0026] Figure 1 : Schematic diagram of the synthesis and identification of the MTX@Tapt-tFNA complex. A, Schematic diagram of synthesis; B, PAGE gel results; C, Transmission electron microscopy images; D, Particle sizes of tFNAs (left curve) and MTT (right curve); E, Zeta potential test results.

[0027] Figure 2 : Cellular uptake detection results of tFNAs and Tapt-tFNA.

[0028] Figure 3 : Detection results of ROS (A), NO (B) and CCK-8 (C). Data are expressed as mean ± SD (n = 4). Student's t-test was used for statistical analysis. Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0029] Figure 4 : Detection results of inflammatory factors. A, Immunofluorescence of IL-1β / TNF-α / IL-6; B, Secretion level of TNF-α; C, Secretion level of IL-6; D, Western blot (hereinafter referred to as WB) detection bands of IL-6 and TNF-α; E, Quantitative bar graph of WB detection band signals of TNF-α; F, WB detection bands of IL-6; Data are expressed as mean ± SD (n = 4). Student's t-test was used for statistical analysis. Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0030] Figure 5 : Immunofluorescence images of Arginase and Inos.

[0031] Figure 6 : Fluorescence distribution of tFNA and Tapt-tFNA in inflamed and non-inflamed joints.

[0032] Figure 7 : In vivo experimental results of rheumatoid arthritis. A, Gross image of rats; B, HE staining of ankle joints; C, Immunofluorescence of IL-6 in synovial tissue; D, Immunofluorescence of TNF-α in synovial tissue. Specific implementation manners

[0033] Example 1 Synthesis of MTX@Tapt-tFNA complex

[0034] 1. Synthesis of Tapt-modified tFNA (Tapt-tFNA)

[0035] Dissolve four DNA single strands (S1, S2, S3, S4) in TM buffer (10 mM Tris-HCl, 50 mM MgCl2, pH = 8.0), control the final concentration of the four DNA single strands to be 1000 nM, mix well and then quickly heat to 95 °C for 10 minutes, and then quickly cool to 4 °C and maintain for 20 minutes to obtain Tapt-modified tetrahedral framework nucleic acid: Tapt-tFNA.

[0036] The sequences (5′→3′) of the four DNA single strands are as follows:

[0037] S1:

[0038] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA(SEQ ID NO.1).

[0039] S2:

[0040] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG-TTTTT-GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC(SEQ ID NO.2).

[0041] S3:

[0042] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID NO.3).

[0043] S4:

[0044] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG(SEQ ID NO.4).

[0045] 2. Synthesis of MTX@Tapt-tFNA complex

[0046] Add MTX (control the final concentration of MTX to be 20 μM) to 200 nM Tapt-tFNA buffer, and shake evenly at room temperature for 6 h to obtain MTX@Tapt-tFNA complex. The synthesis schematic diagram is as Figure 1 shown in A.

[0047] The PAGE gel results show that the size of the tetrahedral framework nucleic acid is about 180 bp, while the size of Tapt-tFNA is about 220 bp, indicating that Tapt-tFNAs have been successfully synthesized ( Figure 1 B). The dynamic light scattering results show that the size of the tetrahedral framework nucleic acid is about 15 nm, which is consistent with the theoretical value ( Figure 1 D, 1E).

[0048] Example 2 Synthesis of MTX@Tapt-tFNA complex

[0049] 1. Synthesis of Tapt-modified tFNA (Tapt-tFNA)

[0050] Same as step 1 of Example 1.

[0051] 2. Synthesis of MTX@Tapt-tFNA complex

[0052] Add MTX to the Tapt-tFNA buffer at 100 nM (control the final concentration of MTX to be 10 μM), and shake evenly at room temperature for 6 h to obtain the MTX@Tapt-tFNA complex.

[0053] The beneficial effects of the present invention are demonstrated by the following experimental examples.

[0054] Experimental Example 1. Proportion screening experiment of MTX and Tapt-tFNA

[0055] 1. Experimental method

[0056] Refer to the method of Example 1 to prepare the complex of MTX and Tapt-tFNA, with the difference being only that the concentration of Tapt-tFNA in step 2 is controlled to be 200 nM, and the concentrations of MTX are 10 μM, 20 μM, 40 μM, 80 μM, and 100 μM respectively, to obtain the complexes after co-incubation of MTX and Tapt-tFNA with different molar ratios.

[0057] Test the encapsulation efficiency of the above different complexes respectively.

[0058] 2. Experimental results

[0059] The results show that when the concentration of Tapt-tFNA is 200 nM and the concentration of MTX is 20 μM, the encapsulation efficiency of the obtained complex is the highest (up to 73.8 ± 1.48%, n = 3), improving the bioavailability of MTX.

[0060] Experimental Example 2. In vitro anti-inflammatory effect test

[0061] 1. Experimental method

[0062] 1.1 Construction of macrophage inflammation model

[0063] RAW264.7 cells in the logarithmic growth phase were divided into 6 groups: (1) Control: RAW264.7 cells were cultured in a conventional culture environment; (2) LPS: RAW264.7 cells were incubated with 1 μg / mL LPS (lipopolysaccharide) for 24 hours; (3) LPS + tFNA: RAW264.7 cells were cultured with tFNA (100 nM) and LPS (1 μg / mL) for 24 h; (4) LPS + Tapt-tFNA: RAW264.7 cells were cultured with Tapt-tFNA (100 nM) and LPS (1 μg / mL) for 24 h; (5) LPS + MTX: RAW264.7 cells were cultured with MTX (10 μM) and LPS (1 μg / mL) for 24 h; (6) LPS + MTT: RAW264.7 cells were cultured with MTX@Tapt-tFNA (MTX@Tapt-tFNA was prepared in Example 2, where MTX: 10 μM, Tapt-tFNA: 100 nM) and LPS (1 μg / mL) for 24 h.

[0064] Tapt-tFNA is abbreviated as T-tFNA or TT, and MTX@Tapt-tFNA is abbreviated as MTT.

[0065] 1.2 CCK8 cytotoxicity assay

[0066] RAW264.7 cells were cultured in groups in 96-well plates (5×10 3 / well), and grouped and treated according to the method in 1.1. Then, the culture medium was removed, and the cells were rinsed once with PBS. Then, serum-free DMEM medium and 10% (v / v) CCK-8 solution were added. After incubation at 37 °C for 2 hours, the OD value of the sample was measured at a wavelength of 450 nm.

[0067] When performing the CCK8 cytotoxicity assay, treatment groups with different MTX concentrations were set as controls. When the MTX concentration was set at 2.5 μM, MTX in MTX@Tapt-tFNA: 2.5 μM, Tapt-tFNA: 25 nM; when the MTX concentration was set at 5 μM, MTX in MTX@Tapt-tFNA: 5 μM, Tapt-tFNA: 50 nM; when the MTX concentration was set at 20 μM, MTX in MTX@Tapt-tFNA: 20 μM, Tapt-tFNA: 200 nM.

[0068] 1.3 Cellular uptake of tFNA and Tapt-tFNA

[0069] RAW264.7 cells were seeded in 6-well plates (2×10 5 / well) and 12-well plates (2×10 5Cultured in the (well) for 24 h, and then replaced the medium containing 10% (v / v) FBS with high-density DMEM containing 1% (v / v) FBS for starvation culture. Then incubated with 100 nM Cy5-tFNA or 100 nM Cy5-Tapt-tFNA for 4 h, rinsed the 6-well plate with PBS, and collected the flow-through tubes. Further flow cytometry analysis was used to obtain the cell entry results of the flow cytometer (FC500 Beckman, IL, USA). The cells in the 12-well plate were washed 3 times with PBS and fixed with cold paraformaldehyde for 15 minutes. After washing again, stained with DAPI for 10 minutes. Finally, observed the cell slides under an ultra-high-resolution two-photon laser confocal microscope (N-SIM, Nikon, Tokyo, Japan).

[0070] 1.4 ELISA experiment

[0071] The contents of TNF-α and IL-6 in the cell supernatant were detected using an ELISA kit. Specifically: The RAW264.7 cells in the 6-well plate (2×10 5 / well) were divided into 6 groups: (1) Control, (2) LPS, (3) LPS + tFNA, (4) LPS + Tapt-tFNA, (5) LPS + MTX, and (6) LPS + MTT. After treatment respectively, the supernatant was collected. After the pre-experiment of enzyme-linked immunosorbent assay (ELISA), the samples were diluted 10-fold. First, the standard products were diluted according to a certain concentration gradient. Then, after washing the plate 6 times, the samples and the diluted standard products were added to the well plate. Sealed with a sealing film, incubated at 37 °C for 1 h, and after washing, 50 μl of enzyme-labeled reagent was added and cultured for 30 minutes. Finally, washed again, and the developer and TMB stop solution were added respectively, with an interval of 10 - 30 minutes. The results were obtained within 15 minutes.

[0072] 1.5 ROS determination

[0073] The intracellular ROS level was determined using the DCFH-DA method. Specifically: The RAW264.7 cells were seeded in a 12-well plate (2×10 5 / well) and cultured overnight. After cell starvation, treated according to the previous group for 24 h, washed three times with serum-free high DMEM, and cultured with high-concentration DEME containing DCFH-DA (1:1000) at 37 °C for 20 minutes, then rinsed 3 times to remove the residual DCFH-DA. Next, stained with serum-free high-density DMEM containing Hoechst (1:1000) for 10 minutes. Subsequently, the fluorescence images of ROS were obtained under the microscope.

[0074] 1.6 NO determination

[0075] Excessive nitric oxide (NO) produced by iNOS in macrophages can lead to tissue damage and exacerbation of inflammation. Therefore, the NO level was measured using a total nitric oxide detection kit to analyze the inflammatory response. After collecting the cell supernatant, it was detected using a total nitric oxide detection kit. Specifically, after centrifuging the collected supernatant, 50 μl of the supernatant was added to the prepared 96-well plate according to the corresponding groups, and then 50 μl of Griess reagent I and 50 μl of Griess reagent II were added successively at room temperature. Finally, the absorbance was measured at 540 nm.

[0076] When measuring NO, treatment groups with different MTX concentrations were additionally set as controls. When the MTX concentration was set to 2.5 μM, MTX in MTX@Tapt-tFNA: 2.5 μM, Tapt-tFNA: 25 nM; when the MTX concentration was set to 5 μM, MTX in MTX@Tapt-tFNA: 5 μM, Tapt-tFNA: 50 nM.

[0077] 1.7 Western blotting

[0078] Total proteins were extracted by cell lysis method, mixed with 5×loading buffer, and heated for 10 min (100 °C). After treatment of each group of samples by 12% sodium dodecyl sulfate PAGE, they were transferred to polyvinylidene fluoride membranes. These membranes were soaked in 5% skim milk at 37 °C for 1 h and immersed in the primary antibody at 4 °C overnight. They were washed 3 times with TBST (0.1% Tween-20, 10 mM Tris-base and 100 mM NaCl; pH 7.5), incubated with the secondary antibody (1:2000; using Abcam) for 1 h, and then the bands were visualized using a Gel-Blot imaging system and quantified using ImageJ software.

[0079] 2. Experimental results

[0080] 2.1 Cellular uptake of tFNA and Tapt-tFNA

[0081] From Figure 2 the results, it can be seen that Tapt does not affect the cellular uptake of tFNA by macrophages.

[0082] 2.2 CCK-8, ROS, NO results

[0083] ROS (reactive oxygen species) is a byproduct of biological aerobic metabolism. Under the stimulation of certain factors, ROS will increase sharply, and then cause an inflammatory response through cellular oxidative stress. As Figure 3As shown in Figure A, LPS induced inflammation in macrophages of the control group, generating a large amount of ROS; the ROS level in the tFNA treatment group decreased slightly, while the ROS levels in the Tapt-tFNA, MTX, and MTX@Tapt-tFNA treatment groups decreased significantly.

[0084] Further, according to Figure 3 the fluorescence image in Figure A, the relative ratios of the fluorescence intensities of the ROS levels in each treatment group were statistically analyzed. Each treatment group was statistically analyzed 3 times, and the average value was taken. The results are shown in Table 1. Further, according to Table 1, the reduction ratios of the ROS levels in each treatment group compared with the LPS group were calculated, and the results are shown in Table 2. It can be seen that compared with the cell inflammation model group, the degree of reduction of the ROS level in the MTX@Tapt-tFNA group was significantly higher than the sum of the Tapt-tFNA group and the MTX group, indicating that Tapt-tFNA and MTX in the MTX@Tapt-tFNA complex had a synergistic effect on antioxidant activity.

[0085] Table 1. Average values of the relative ratios of the average fluorescence intensities of the ROS levels in each treatment group

[0086]

[0087] Table 2. Reduction ratios of the ROS levels in each treatment group compared with the LPS group

[0088]

[0089] Under normal conditions, endothelium-derived NO has the effect of inhibiting the inflammatory response. Under pathological conditions, a large amount of NO synthesized by inducible NO synthase has cytotoxic effects and exacerbates the inflammatory response. The macrophage inflammation model in this experimental example belongs to the pathological condition, and the NO level in the model group (LPS treatment group) was much higher than that in the control group. Figure 3 Figure B reflects the detection results of the NO level. It can be seen that the NO level in the MTX@Tapt-tFNA treatment group was lower than that in the Tapt-tFNA, MTX, and tFNA treatment groups.

[0090] From Figure 3 Figure B, it can also be seen that for the MTX@Tapt-tFNA treatment groups with different MTX concentrations, when the MTX concentration was 10 μM, the NO level was the lowest.

[0091] Figure 3 Figure C shows the CCK-8 results. It can be seen that the MTX@Tapt-tFNA treatment group was basically non-toxic to cells, and the cell viability of the MTX treatment group decreased at the same concentration, fully demonstrating the biosafety of MTX@Tapt-tFNA.

[0092] The above results indicate that MTX@Tapt-tFNA can reduce the levels of ROS and NO, two substances that mediate inflammatory responses, protect cell viability, and has significant anti-inflammatory activity. In particular, the effect of MTX@Tapt-tFNA in reducing ROS has a synergistic effect.

[0093] 2.3 Effects of tFNA on inflammatory factors

[0094] TNF-α, IL-1β, and IL-6 are inflammatory factors produced by macrophages and play important roles in the joint damage process of gouty arthritis. The levels of TNF-α, IL-1β, and IL-6 in the serum of patients are positively correlated with the pain of the patients. And some studies have suggested that inhibiting the level of IL-1β helps to improve inflammation.

[0095] Figure 4 A is the analysis result of immunofluorescence of TNF-α, IL-1β, and IL-6. It can be seen that the individual treatments of Tapt-tFNA, MTX, and tFNA have no significant effects on TNF-α, IL-1β, and IL-6, but the pretreatment with MTX@Tapt-tFNA can have significant effects on the levels of TNF-α and IL-6. Figure 4 B, 4C are the ELISA assay results of TNF-α and IL-6 secreted into the cell supernatant. It can be seen that the individual treatments of Tapt-tFNA, MTX, and tFNA have no significant effects on TNF-α and IL-6, but the pretreatment with MTX@Tapt-tFNA can significantly reduce the levels of TNF-α and IL-6 in the cell supernatant. Figure 4 D, 4E, 4F are the WB band display and its quantitative analysis results of TNF-α and IL-6 in the total cell protein. It can also be seen that the pretreatment with MTX@Tapt-tFNA can significantly reduce the protein expression levels of TNF-α and IL-6.

[0096] In addition, from Figure 4 it can also be seen that compared with the model group, although the levels of inflammatory factors in the individual treatment groups of Tapt-tFNA, MTX, and tFNA are decreased, the degree of decrease is not significant. While the levels of inflammatory factors in the MTX@Tapt-tFNA treatment group are significantly decreased.

[0097] The above results indicate that the pretreatment with MTX@Tapt-tFNA can significantly reduce the release and expression of inflammatory factors and has significant anti-inflammatory effects.

[0098] The in vitro experimental results indicate that MTX@Tapt-tFNA can significantly reduce the levels of ROS and NO in macrophages, protect cell viability, and promote the polarization of M1 macrophages to M2 macrophages ( Figure 5) Reduce the expression and secretion of inflammatory factors (IL-1β, IL-6, and TNF-α). Notably, MTX@Tapt-tFNA has a synergistic effect in reducing the ROS level in the inflammatory model.

[0099] Experimental Example 3: In vivo anti-inflammatory effect test

[0100] 1. Experimental method

[0101] Establish a rheumatoid arthritis animal model: All animal care and experiments were conducted in accordance with the requirements of the National Law on the Use of Laboratory Animals (China) and approved by the Institutional Animal Care and Ethics Committee of Sichuan University.

[0102] Induce a rat collagen-induced arthritis (CIA) model using bovine type II collagen (CII) (Chondrex, Inc.): Emulsify CII with an equal volume of incomplete Freund's adjuvant (Chondrex, Inc). Intradermally inject 0.2 mL of the emulsion containing 400 μg CII into the tail root of male 5- to 6-week-old Wistar rats (Sichuan, Dashuo). On the 7th day after the primary immunization, boost the rats intradermally with 200 μg CII. Closely monitor the severity and progression of the arthritis disease in the rats through ankle circumference, clinical arthritis score, and body weight.

[0103] Nineteen days after the first immunization with CII, the rats were randomly divided into the following groups, with 10 rats in each group: The first group (group a), normal control group injected with normal saline; the second group (group b), CIA control group injected with saline; the third group (group c), arthritic rats injected with tFNA (0.8 nmol / kg) via the tail vein; the fourth group (group d), arthritic rats injected with Tapt-tFNA (0.8 nmol / kg) via the tail vein; the fifth group (group e), arthritic rats injected with MTX (80 nmol / kg) via the tail vein; the sixth group (group f), arthritic rats injected with MTX@Tapt-tFNA (MTX: 80 nmol / / kg, Tapt-tFNAs: 0.8 nmol / kg) via the tail vein. The treatment started on the 19th day and continued until the 31st day after the primary immunization. On the 31st day after arthritis induction, the rats were euthanized by inhaling excessive CO2, and the main organs were excised and fixed in 10% formalin for histopathological examination. The ankle joint diameters of each group were measured with a vernier caliper before surgery and 24 hours after surgery, and finally, pathological sections were obtained through tissue fixation, decalcification, embedding, sectioning, and HE staining.

[0104] Tapt-tFNA is abbreviated as T-tFNA or TT, and MTX@Tapt-tFNA is abbreviated as MTT.

[0105] 2. Experimental results

[0106] AsFigure 6 As shown, in this experiment, the targeting of Tapt-tFNA in the CIA model was verified by an in vivo fluorescence imaging system (IVIS). Cy5-labeled Tapt-tFNA (Cy5-Tapt-tFNA) and Cy5-labeled tFNA (Cy5-tFNA) were administered via the tail vein to CIA and normal rats. After 30 min, the rat organs (heart, liver, spleen, lung, kidney) and joints were isolated, and their fluorescence distributions were observed. In healthy rats, the fluorescence distributions of Cy5-Tapt-tFNA and Cy5-tFNA were in the liver and kidney. However, in CIA rats, the fluorescence of Cy5-Tapt-tFNA and Cy5-tFNA was distributed not only in the liver and kidney but also in the inflamed joints, and moreover, the fluorescence distribution of Cy5-Tapt-tFNA in the joints was significantly higher than that of Cy5-tFNA. Cy5-Tapt-tFNA could be distributed in inflamed joints rather than healthy joints, which fully demonstrated its targeting to inflamed joints.

[0107] As Figure 7 Figure A is the gross image of the rat. Injecting MTX@Tapt-tFNA could relieve the joint swelling of the rat to the greatest extent. Figure B is the HE staining result of the ankle joint. The CIA group showed a large amount of synovial tissue hyperplasia, destruction of articular cartilage, and increased angiogenesis; other groups except the MTX@Tapt-tFNA group also had more or less related pathological manifestations; while the MTX@Tapt-tFNA group did not show the above pathological manifestations.

[0108] In addition, as Figure 7 Shown in Figures C and 7D, immunofluorescence treatment was performed on the joint synovial tissue, and the results were consistent with the in vitro results, that is, compared with the model group, although the levels of inflammatory factors in the groups treated with Tapt-tFNA, MTX, and tFNA alone decreased, the decrease was not significant, while the level of inflammatory factors in the MTX@Tapt-tFNA treatment group decreased significantly.

[0109] The in vivo experimental results showed that MTX@Tapt-tFNA could effectively deliver and accumulate MTX to inflamed joints, greatly reducing joint inflammation, bone resorption, and cartilage damage without increasing toxic side effects. This complex could significantly improve the joint swelling and inflammation of rats with rheumatoid arthritis, target inflamed joint tissues, relieve bone and cartilage loss, and alleviate rheumatoid arthritis.

[0110] In summary, the present invention provides a drug for targeted treatment of inflammatory diseases. The present invention uses a tetrahedral framework nucleic acid modified with a DNA aptamer targeting TNF-α as a carrier, and loads methotrexate to form a complex. The complex of the present invention has a high encapsulation rate for MTX, improving the bioavailability of MTX. In the LPS-induced macrophage inflammation model, the complex of the present invention can significantly reduce the ROS and NO levels of macrophages, protect cell viability, promote the polarization of M1 macrophages to M2 macrophages, and reduce the expression and secretion of inflammatory factors (including IL-1β, IL-6 and TNF-α). In the collagen-induced rheumatoid arthritis rat model, the complex of the present invention can significantly improve the joint swelling and inflammation of rheumatoid arthritis rats, target inflamed joint tissues, relieve cartilage loss, and alleviate rheumatoid arthritis. The complex of the present invention is simple to synthesize, has a stable structure, has excellent biosafety and absorption efficiency, and has broad application prospects. SEQUENCE LISTING <110> Sichuan University <120> A Drug for Targeted Treatment of Inflammatory Diseases <130> GYKH1118-2022P0114982CC <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 63 <212> DNA <213> Artificial Sequence <400> 1 atttatcacc cgccatagta gacgtatcac caggcagttg agacgaacat tcctaagtct 60 gaa 63 <210> 2 <211> 109 <212> DNA <213> Artificial Sequence <400> 2 acatgcgagg gtccaatacc gacgattaca gcttgctaca cgattcagac ttaggaatgt 60 tcgtttttgc gccactacag gggagctgcc attcgaatag gtgggccgc 109 <210> 3 <211> 63 <212> DNA <213> Artificial sequence <400> 3 actactatgg cgggtgataa aacgtgtagc aagctgtaat cgacgggaag agcatgccca 60 tcc 63 <210> 4 <211> 63 <212> DNA <213> Artificial sequence <400> 4 acggtattgg accctcgcat gactcaactg cctggtgata cgaggatggg catgctcttc 60 ccg 63 <210> 5 <211> 41 <212> DNA <213> Artificial sequence <400> 5 gcgccactac aggggagctg ccattcgaat aggtgggccg c 41

Claims

1. Use of a complex in the preparation of a medicament for preventing and / or treating rheumatoid arthritis, characterized in that: The complex is prepared from tetrahedral framework nucleic acid modified with a DNA aptamer targeting TNF-α and methotrexate, and the molar ratio of the tetrahedral framework nucleic acid modified with the DNA aptamer targeting TNF-α to methotrexate is 1:100; The tetrahedral framework nucleic acid modified with the DNA aptamer targeting TNF-α is composed of 4 single-stranded DNAs with sequences shown in SEQ ID NO.1-4 through base complementary pairing.

2. The use according to claim 1, characterized in that: The preparation method of the tetrahedral framework nucleic acid modified with the DNA aptamer targeting TNF-α is as follows: dissolve 4 single-stranded DNAs in a buffer solution, mix well, heat to 93-98 °C and maintain for 5-15 minutes, and then cool to 2-6 °C and maintain for 15-25 minutes to obtain it.

3. The use according to any one of claims 1-2, characterized in that: The preparation method is as follows: mix the tetrahedral framework nucleic acid modified with the DNA aptamer targeting TNF-α and methotrexate and incubate to obtain it.

4. The use according to claim 3, characterized in that: The incubation temperature is 4-30 °C; the incubation time is 0.5-15 hours; during incubation, the concentration of methotrexate is 2.5-100 μM.

5. The use according to claim 4, characterized in that: The incubation temperature is room temperature; the incubation time is 6 hours; during incubation, the concentration of methotrexate is 10-20 μM.

Images