A specific recognition RNA-m 1 Chain-like deoxyribonuclease probes at A methylation sites and their applications

By designing a chain-like deoxyribonuclease probe that specifically recognizes RNA-m1A methylation sites and combining it with the Mn2+ cofactor, the problem of detecting RNA-m1A methylation modification has been solved, enabling highly sensitive and rapid biosensing and disease diagnosis applications.

CN116515821BActive Publication Date: 2026-06-26DALIAN UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
DALIAN UNIV OF TECH
Filing Date
2022-12-07
Publication Date
2026-06-26

Smart Images

  • Figure CN116515821B_ABST
    Figure CN116515821B_ABST
Patent Text Reader

Abstract

The application discloses a specific RNA-m 1 The application discloses a chain deoxyribozyme probe for specifically recognizing RNA-m 1 The application discloses a chain deoxyribozyme probe for specifically recognizing RNA-m 1 The application discloses a chain deoxyribozyme probe for specifically recognizing RNA-m
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of deoxyribonuclease probe technology, specifically relating to a probe that specifically recognizes RNA-m 1 Chain-like deoxyribonuclease probes with A methylation sites and their applications. Background Technology

[0002] Functional nucleic acids refer to nucleic acid molecular fragments with specific structures and functions obtained through in vitro screening techniques, namely Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology. These mainly include aptamers with specific target binding capabilities, DNAzymes with catalytic activity, and aptamers with both target binding and catalytic functions. Because the biological recognition functions of functional nucleic acids are very similar to those of antibodies, but they possess many advantages such as a broad target range, high stability, and ease of chemical modification and synthesis, they are often used as recognition units for functional nucleic acid probes. Among them, the DNAzyme initially described by Joyce and Breaker in 1994 is an RNA-cleaving DNAzyme that can induce the breakage of RNA phosphodiester bonds. Since then, an increasing number of DNAzyme probes have been applied in fields such as biosensing and detection.

[0003] Post-translational modifications of nucleotides are crucial for the functional diversity of RNA; more than 170 types of nucleotide modifications are currently known. Among them, RNA-m 1 A-methylation is a process catalyzed by methyltransferases at the nitrogen atom of adenine at position 1 to form a methyl group. Because this occurs at the Watson-Crick interface, it affects normal hydrogen bonding, thus easily leading to premature termination of reverse transcription and base mismatches. Meanwhile, m 1 Due to its positively charged nature, RNA can influence protein-RNA interactions and secondary structure. Studies have shown that RNA-m... 1 RNA methylation modification is closely related to the occurrence, development, invasion, and metastasis of tumors, and is expected to serve as a promising new molecular indicator for precision diagnosis and treatment of tumors. However, current detection and quantification methods for these modifications still have certain limitations. Therefore, developing a simple, rapid, and highly sensitive biochemical method to determine RNA-methylation is crucial. 1 The methylation state of A presents certain challenges.

[0004] Previously, researchers had obtained RNA-m antibodies through in vitro screening. 6 A. RNA-m 3Deoxyribozymes that respond to C-type RNA have been applied in the field of biosensing. Therefore, there is an urgent need to develop deoxyribozymes that recognize RNA-m 1 A-methylated deoxyribozymes are used to enable immediate, rapid, and sensitive detection in biosensing and disease diagnosis. Summary of the Invention

[0005] To achieve RNA-m 1 The present invention aims to achieve immediate, rapid, and sensitive detection of methylation modifications by obtaining characteristically recognizable RNA-m through a designed in vitro screening protocol. 1 A chain-like deoxyribonuclease probe.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a deoxyribozyme probe, wherein the sequence of the deoxyribozyme probe is any one of the following sequences (1) to (5):

[0008] (1)5'-CTATGAACTGACTRTGACCTCACTACCAAGGATATCAGACCACAACGG TTTCCCGGGTGCGGGGTGGTTGCATAAAACTGTCATTCAATGTCATAGCATAACCCT TGF-3';

[0009] (2)5'-CTATGAACTGACTRTGACCTCACTACCAAGGATATCAGACCACAACGG TTTCCCCAGTTGAGGTTGCATTAATCTGTCATTGTCTACGTTGTTATAGCATAACCCCT TGF-3';

[0010] (3)5'-CTGACTRTGACCTCACTATCAGACCACAACGGTTTCCCGGGTGCGGGG TGGTTGCATAAAACTGTCATTCAATGTCATAGCATF-3';

[0011] (4)5'-CTGACTRTGACCTCACTATCAGACCACAACGGTTTCCCCAGTTGAGGTTGCATTAATCTGTCAT TGTCTACGTTF-3';

[0012] Among them, sequence (1), sequence (2), sequence (3) or sequence (4) constitute a cis-structured deoxyribozyme;

[0013] (5) The sequences shown in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:19 are mixed with the substrate chain sequence to form a trans-structured deoxyribozyme;

[0014] The substrate chain sequence is: 5'-CTATGAACTGACTRTGACCTCACTACCAAGGAT-3' or 5'-CTGACTRTGACCTCACT-3'; where R represents RNA base A and F represents fluorescent group.

[0015] Based on the above technical solution, further, SEQ ID NO:16, SEQ ID NO:17 and the substrate chain with the sequence 5'-CTATGAACTGACTRTGACCTCACTACCAAGGAT-3' constitute a trans-structured deoxyribozyme.

[0016] Based on the above technical solution, further, SEQ ID NO:18, SEQ ID NO:19 and the substrate chain with the sequence 5'-CTGACTRTGACCTCACT-3' constitute a trans-structured deoxyribozyme.

[0017] Based on the above technical solution, the fluorescent group is further defined as FAM.

[0018] Another aspect of the present invention provides a method for recognizing RNA-m 1 A methylation-modified kit, including the aforementioned deoxyribozyme probe.

[0019] Based on the above technical solution, the kit further includes a cofactor, wherein the cofactor is Mn. 2+ .

[0020] This invention also provides the application of the aforementioned deoxyribonuclease probe or the aforementioned kit in biosensing for the specific recognition of RNA-m 1 A. Methylation modification.

[0021] Based on the above technical solution, furthermore, the deoxyribonuclease probe specifically recognizes RNA-m 1 The conditions for A-methylation modification are: pH 7.2–7.5, room temperature, Mn 2+ As a cofactor.

[0022] Based on the above technical solution, further, Mn 2+ The final concentration is 5-20 mM.

[0023] The advantages of this invention over existing technologies are as follows:

[0024] (1) The present invention has obtained multiple chain-like deoxyribozyme probes, and the deoxyribozyme probe signal increases with time.

[0025] (2) The deoxyribozyme probe provided by the present invention has good stability, high sensitivity and good specificity, and can play a significant advantage in biosensing applications. Attached Figure Description

[0026] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0027] Figure 1 This is a schematic diagram of the chain deoxyribonuclease screening process.

[0028] Figure 2 This is a statistical chart of the cut rate for each round of screening.

[0029] Figure 3 This is a kinetic characterization of deoxyribonucleases L2-1(a) and L2-2(b).

[0030] Figure 4 It is deoxyribonuclease L2-1-m 1 Characterization experiments of A(a) and L2-1-A(b) at different pH values.

[0031] Figure 5 It is deoxyribonuclease L2-1-m 1 Metal ion selectivity experiments of A(a) and L2-1-A(b).

[0032] Figure 6 The control group (a) and experimental group (b) of deoxyribonuclease L2-1 at different reaction temperatures are characterized.

[0033] Figure 7 This is a sequence optimization and deletion experiment of deoxyribonuclease L2-1.

[0034] Figure 8 It is deoxyribonuclease RNA-m 1 Experiment to optimize the ratio of A1 to substrate chain.

[0035] Figure 9 It is deoxyribonuclease RNA-m 1 A1(a) and RNA-m 1 The dynamic characterization of A 2(b). Detailed Implementation

[0036] The embodiments of the technical solution of the present invention will be described in detail below. These embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore merely examples and should not be used to limit the scope of protection of the present invention.

[0037] The examples include DNA library construction, reverse screening, forward screening, PCR amplification, etc. The nucleic acid names and sequences involved in the examples are shown in Table 1.

[0038] Table 1. Nucleic Acid Names, Sequences, and Uses

[0039]

[0040]

[0041]

[0042]

[0043] Example 1

[0044] Construction of DNA Reverse Library

[0045] The synthesized library strand L2 (SEQ ID NO:5) was mixed with PNK enzyme (T4 polynucleotide kinase) and incubated at 37°C for 40–60 min (library strand L2 phosphorylation). Then, an equimolar amount of the reverse substrate strand (SEQ ID NO:21) and 1.2 times the amount of the linker strand (SEQ ID NO:6) and T4 ligase were added, mixed thoroughly, and reacted at room temperature for 2.5–3 h (library ligation reverse substrate). After the reaction, 2.5 volumes of 100% cold ethanol, 0.1 volumes of 3 mol / L sodium acetate, and 2 μL of 1 μg / μL glycogen were added, and the mixture was frozen at -20°C for 30 min for DNA precipitation. The precipitated mixture was centrifuged at low temperature and high speed (4°C, 14000 rpm, 20 min), the supernatant was removed, and the solid product was obtained after vacuum drying for 5 min. The DNA was reconstituted in 20 μL of ultrapure water and purified by 10% denaturing polyacrylamide gel electrophoresis (dPAGE). The location of the target band was determined using a gel imaging system, and the gel was excised and recovered. Elution Buffer (5M NaCl, 1M Tris (pH 7.5), 0.5M EDTA (pH 8.0)) was added to the recovered target band for DNA elution. The elution buffer was precipitated with cold ethanol, vacuum dried, and reconstituted in ultrapure water to obtain the library required for screening. The reverse-selected library sequence is shown in SEQ ID NO:1.

[0046] Table 2. Components of L2 phosphorylation reaction in library chains

[0047] reagents Volume (μL) Library chain L2 (100μM) 5 ATP (100mM) 2 10×PNK buffer 5 PNK (10 U / μL) 2 water Complete to 50

[0048] Table 3. Components of the Connecting Reaction

[0049] reagents Volume (μL) Substrate chain FQ33-A (100 μM) 5 Connector chain (100μM) 6 Phosphorylated library chain L2 50 T4 ligase (10 U / μL) 3 10×T4 ligase buffer 10 water Complete to 100

[0050] Example 2 In vitro screening

[0051] In vitro screening involves steps including reverse screening, enzyme digestion reaction, forward ligation into a library, forward screening, and PCR amplification.

[0052] Clones were sequenced after 16 rounds of screening. The specific screening steps included:

[0053] 1. Reverse Filtering

[0054] The purified chain library (SEQ ID NO:1) from Example 1 was dissolved in 20 μL of ultrapure water. (The remaining text appears to be incomplete and contains Mn.) 2+ The reaction takes place in a reaction buffer solution.

[0055] Table 4. Components of the Reverse Sieving Reaction

[0056] reagents Volume (μL) Chain Library 40 2× reaction buffer solution 50 <![CDATA[Mn 2+ (100mM)]]> 10 water Complete to 100

[0057] Before the reaction, the dissolved library was heated at 90°C for 2 minutes and then cooled to room temperature. Then, 2× reaction buffer solution and Mn were added. 2+ Mix with water and react for 24 hours.

[0058] The 2× reaction buffer solution consists of: HEPES: 50 mM (pH 7.5), NaCl: 150 mM, KCl: 50 mM, MgCl2: 15 mM, and Tween 20: 0.02% (volume fraction).

[0059] The product after the reaction was separated and purified by 10% denaturing polyacrylamide gel electrophoresis, and an uncut linear library was obtained by cold ethanol precipitation.

[0060] 2. Enzyme digestion reaction

[0061] The uncut chain library (SEQ ID NO:1) from the reverse screening was dissolved in 20 μL of ultrapure water. Then EcoR V, 10× restriction endonuclease reaction buffer, and water were added, and the reaction was carried out for 3 hours.

[0062] Table 5. Components of Enzyme Digestion Reaction

[0063] reagents Volume (μL) Chain Library 20 10× reaction buffer solution 10 EcoR V 4 water Complete to 50

[0064] 3. DNA forward library preparation system:

[0065] 1) L2 phosphorylation of the library chain

[0066] The specific process is the same as in Example 1 and Table 2.

[0067] 2) Library connection to forward substrate

[0068] The specific process is the same as in Example 1, except that a forward substrate chain (SEQ ID NO:20) is used, and the reaction components are connected as shown in Table 6 to obtain a connected forward chain library (SEQ ID NO:2).

[0069] Table 6. Components of the Connection Reaction

[0070] reagents Volume (μL) <![CDATA[Substrate chain FQ33-m 1 A(100 μM)]]> 5 Connector chain (100μM) 6 Phosphorylated library chain L2 50 T4 ligase (10 U / μL) 3 10×T4 ligase buffer 10 water Complete to 100

[0071] 4. Positive screening

[0072] The ligated forward-linked library (SEQ ID NO:2) was dissolved in 20 μL of ultrapure water. In a solution containing Mn... 2+ The reaction takes place in a reaction buffer solution.

[0073] Table 7. Components of Positive Sieve Reaction

[0074] reagents Volume (μL) Chain Library 40 2× reaction buffer solution 50 <![CDATA[Mn 2+ (100mM)]]> 10 water Complete to 100

[0075] Before the reaction, the dissolved library was heated at 90°C for 2 minutes and then cooled to room temperature. Then, 2× reaction buffer solution and Mn were added. 2+ Mix with water and react for 12 hours.

[0076] The 2× reaction buffer solution consists of: HEPES: 50 mM (pH 7.5), NaCl: 150 mM, KCl: 50 mM, MgCl2: 15 mM, and Tween 20: 0.02% (volume fraction).

[0077] The reaction product was separated and purified by 10% denaturing polyacrylamide gel electrophoresis, and the cleaved linear library was obtained by cold ethanol precipitation.

[0078] 5. PCR amplification

[0079] Using DNA sequences capable of cleavage recovered through forward screening as templates, the target sequences were amplified in large quantities via two-step PCR using upstream primer FP and downstream primers RP1 and RP2. The PCR products were purified by 10% dPAGE. Due to the steric modification of downstream primer RP2, PCR amplification yielded sense strands (76 nt and antisense strands (97 nt)) of different lengths. The sense strands were recovered by gel excision and their content was determined. The sequence of upstream primer FP is shown in SEQ ID NO:7, and the sequences of downstream primers RP1 and RP2 are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively.

[0080] PCR amplification conditions

[0081] Table 8. PCR Amplification Conditions

[0082] name Temperature (°C) Time (s) Hold 95 60 transsexual 94 60 annealing 52 45 extend 72 30

[0083] PCR reaction system:

[0084] 1) PCR1

[0085] Table 9. PCR1 Reaction Conditions

[0086] reagents Volume (μL) library 1 Upstream primer FP (100 μM) 0.5 Downstream primer RP1 (100 μM) 0.5 10×PCR buffer 5 dNTPs (2.5mM) 1 Taq enzyme (5 U / μL) 1 water Complete to 50

[0087] 2) PCR2

[0088] Table 10. PCR2 reaction conditions

[0089]

[0090]

[0091] 6. Reverse join to create a database

[0092] The positive strand (enzyme strand, PCR2 product, SEQ ID NO:5) amplified by PCR was mixed with PNK enzyme (T4 polynucleotide kinase) and incubated at 37°C for 40-60 min. Then, an equimolar amount of reverse substrate strand (SEQ ID NO:21), 1.2 times the amount of ligation strand (SEQ ID NO:6), and T4 ligase were added, mixed thoroughly, and reacted at room temperature for 2.5-3 h. After separation and purification, the DNA sequence for the next round of reverse screening was obtained.

[0093] The cut percentage (Clv%) is calculated using the following formula to characterize the enrichment level of the DNA library after each round of screening. The results are as follows: Figure 2 As shown in the figure, after multiple rounds of screening, the cutting percentage of the forward screening showed a significant increasing trend over time, with the cutting rate of the chain library in the 16th round of forward screening being approximately 4.3%. DNA library enrichment was completed.

[0094]

[0095] Where Clv% represents the cutting percentage, Clv is the amount of cut strips in the dPAGE image, and unClv is the amount of uncut strips in the dPAGE image.

[0096] High-throughput sequencing was used to select the top ten sequences for experimental verification. Deoxyribonuclease sequences matching the target requirements were identified. 1 A1 (SEQ ID NO:16) and RNA-m 1A2 (SEQ ID NO:17), after being linked with the reverse substrate chain FQ33-A, corresponds to sequences L2-1-A (SEQ ID NO:1) and L2-2-A (SEQ ID NO:14), respectively, which are linked with the forward substrate chain FQ33-m 1 After A establishes the connection, the corresponding sequences are L2-1-m. 1 A(SEQ ID NO:2) and L2-2-m 1 A(SEQ ID NO:15).

[0097] Example 3: Characterization of Deoxyribozyme Performance

[0098] 1. Characterization of cis-cutting rate

[0099] With chain deoxyribonuclease L2-1-A (SEQ ID NO:1) and L2-1-m 1 Taking A (SEQ ID NO:2) as an example, in the presence of Mn 2 + Incubate in a reaction buffer solution (final concentration: 10 mM). Separate samples at different reaction times using a 10% dPAGE gel and calculate the cutoff rate, such as... Figure 3 As shown in figure a. The gel electrophoresis image reveals the sequence L2-1-m. 1 The cleavage rate of A was much higher than that of L2-1-A, indicating that the RNA-m obtained through in vitro screening... 1 The A1 (SEQ ID NO:16) sequence is site-specific.

[0100] Chain deoxyribonucleases L2-2-A (SEQ ID NO:14) and L2-2-m 1 A (SEQ ID NO:15), in the presence of Mn 2+ Incubate in a reaction buffer solution (final concentration: 10 mM). Separate samples at different reaction times using a 10% dPAGE gel and calculate the cutoff rate, such as... Figure 3 As shown in b. The gel electrophoresis image reveals the sequence L2-2-m. 1 The cleavage rate of A was much higher than that of L2-2-A, indicating that the RNA-m obtained through in vitro screening... 1 The A2 (SEQ ID NO:17) sequence is site-specific, but its effectiveness is slightly lower than that of RNA-m 1 A1.

[0101] 2. pH characterization

[0102] With chain deoxyribonuclease L2-1-A (SEQ ID NO:1) and L2-1-m 1Taking A (SEQ ID NO:2) as an example, under the condition of maintaining a consistent metal ion concentration, six reaction buffers with different pH gradients (pH 3-8) were prepared, and 10 μL of Mn was added to each reaction buffer. 2+ Incubate at (100mM) for 1 hour, then separate by 10% dPAGE gel. Results are as follows: Figure 4 As shown in the image. Gel electrophoresis reveals that at pH 7.5, L2-1-A and L2-1-m... 1 L2-1-A showed distinct substrate cleavage bands, while almost no signal was observed at pH 3.5, pH 4.5, pH 5.5, and pH 6.5. At pH 8.5, L2-1-A and L2-1-m showed distinct cleavage bands. 1 The A-cleavage is strong. This indicates that the chain-like deoxyribonuclease has high activity at pH 7.5 and is effective against m 1 Substrate A has a strong response.

[0103] 3. Selective characterization of metal ions

[0104] With chain deoxyribonuclease L2-1-A (SEQ ID NO:1) and L2-1-m 1 Taking A (SEQ ID NO:2) as an example, after incubation for 1 hour in a buffer solution containing different divalent metal ions, it was separated by a 10% dPAGE gel, as shown below. Figure 5 As shown in the image, gel electrophoresis reveals that this deoxyribozyme is only reactive to Mn. 2+ It exhibits a strong response but shows almost no response to other divalent metal ions, indicating that the action of deoxyribozymes requires Mn. 2+ It is carried out as a cofactor.

[0105] 4. Characterization of reaction temperature

[0106] With chain deoxyribonuclease L2-1-A (SEQ ID NO:1) and L2-1-m 1 Taking A (SEQ ID NO:2) as an example, it contains Mn 2+ After incubation at different temperatures for 1 hour in a buffer solution (final concentration: 10 mM), the samples were separated by 10% dPAGE gel (control group: Mn-free). 2+ (buffer solutions). For example... Figure 6 As shown in figure a: at different temperatures, the control group showed almost no lysis bands; through... Figure 6 Gel electrophoresis of b revealed that this deoxyribonuclease, at 25°C (room temperature), has the effect of [the following on m]. 1 Substrate A has a strong response signal.

[0107] 5. Sequence truncation optimization experiment

[0108] The obtained sequence L2-1-A was simulated using software to obtain its secondary structure, and a sequence deletion experiment was conducted to delete some loops and stems, resulting in the sequence L2-T1-A. L2-T1-A was then compared with L2-T1-m. 1 A simultaneously conducted kinetic experiments, respectively in environments containing Mn 2+ After incubation for different times in a reaction buffer solution (final concentration: 10 mM), the samples were separated by 10% dPAGE gel. Figure 7 As shown. Calculating the cutting rate, we find that L2-T1-m 1 The cleavage rate of A (SEQ ID NO:11) is higher than that of the original sequence L2-1-m. 1 A is higher.

[0109] 6. Trans-action experiment of deoxyribozymes

[0110] Examples 1-5 in Example 3 are all cis-action experiments after deoxyribozyme is ligated to substrate. For example, enzyme chain L2-1-A (SEQ ID NO:1) is a sequence RNA-m 1 A1 (SEQ ID NO:16) and substrate chain L2-FQ33-A (SEQ ID NO:12) were ligated using T4 ligase. The optimized enzyme strand sequence was then obtained as RNA-m. 1 A1-T1 (SEQ ID NO:18) was mixed with the optimized substrate chain FQ17 (SEQ ID NO:22 and SEQ ID NO:23) in different molar ratios, in a mixture containing Mn 2+ Incubate in reaction buffer (final concentration: 10 mM) for 30 min, then separate by 10% dPAGE gel, as follows: Figure 8 As shown in the figure. Calculation of the cleavage rate revealed that the cleavage signal was most pronounced and reached its optimal ratio when the molar ratio of enzyme chain to substrate chain was 1:5.

[0111] 7. Characterization of reverse cutting rate

[0112] The enzyme strand sequence RNA-m obtained by sequence optimization 1 A 1-T1 (SEQ ID NO:18) and the optimized substrate chain FQ17 (SEQ ID NO:22 and SEQ ID NO:23) were mixed in a molar ratio of 1:10, and then in a solution containing Mn 2+ Incubate in a reaction buffer solution (final concentration: 10 mM). Separate samples at different reaction times using a 10% dPAGE gel and calculate the cutoff rate, such as... Figure 9 As shown in figure a. Gel electrophoresis reveals the enzyme chain sequence RNA-m. 1 The cleavage rate of A1-T1 in the trans reaction is much higher than that of the original sequence RNA-m 1A1 cutting rate.

[0113] Sequence RNA-m 1 A1-T2 (SEQ ID NO:19) and the optimized substrate chain FQ17 (SEQ ID NO:22 and SEQ ID NO:23) were mixed at a molar ratio of 1:10 in a solution containing Mn. 2+ Incubate in a reaction buffer solution (final concentration: 10 mM). Separate samples at different reaction times using a 10% dPAGE gel and calculate the cutoff rate, such as... Figure 9 As shown in b.

[0114] The above experiments show that the chain deoxyribonucleases L2-1 and L2-2, RNA-m 1 A1 and RNA-m 1 A2 has similar properties.

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A deoxyribozyme probe, characterized in that, The sequence of the deoxyribozyme probe is any one of the following sequences (1) to (6): (1) 5'-CTATGAACTGACTRTGACCTCACTACCAAGGATATCAGACCACAACGG TTTCCCGGGTGCGGGGTGGTTGCATAAAACTGTCATTCAATGTCATAGCATAACCCCTTGF-3'; (2) 5'-CTATGAACTGACTRTGACCTCACTACCAAGGATATCAGACCACAACGG TTTCCCCAGTTGAGGTTGCATTAATCTGTCATTGTCTACGTTGTTATAGCATAACCCCTTGF-3'; (3) 5'-CTGACTRTGACCTCACTATCAGACCACAACGGTTTCCCGGGTGCGGGG TGGTTGCATAAAACTGTCATTCAATGTCATAGCATF-3'; (4) 5'-CTGACTRTGACCTCACTATCAGACCACAACGGTTTCCCCAGTTGAGGT TGCATTAATCTGTCATTGTCTACGTTF-3'; Among them, sequence (1), sequence (2), sequence (3) or sequence (4) constitutes a cis-structured deoxyribozyme; (5) SEQ ID NO:16 or SEQ ID NO:17 forms a trans-structured deoxyribozyme with the substrate chain of sequence 5'-CTATGAACTGACTRTGACCTCACTACCAAGGAT-3'; (6) SEQ ID NO:18 or SEQ ID NO:19 forms a trans-structured deoxyribozyme with the substrate chain of sequence 5'-CTGACTRTGACCTCACT-3'; Where R represents RNA base A and F represents fluorescent group.

2. The deoxyribozyme probe according to claim 1, characterized in that, The fluorescent group is FAM.

3. A method for recognizing RNA-m 1 A kit for A methylation modification sites, characterized in that... Includes the deoxyribozyme probe as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit includes a cofactor, namely Mn. 2+ .

5. The application of the deoxyribonuclease probe according to claim 1 or 2 or the kit according to claim 3 or 4 in the preparation of biosensors, characterized in that, The aforementioned biosensor is used to specifically recognize RNA-m 1 A. Methylation modification.

6. The application according to claim 5, characterized in that, The deoxyribonuclease probe specifically recognizes RNA-m 1 The conditions for A-methylation modification are: pH 7.2–7.5, room temperature, Mn 2+ As a cofactor.

7. The application according to claim 6, characterized in that, Mn 2+ The final concentration is 5-20 mM.