Effect of isocitrate lyase gene aceA on l-amino acid synthesis

Abstract

The application discloses an effect of isocitrate lyase gene aceA on L-amino acid synthesis. Specifically disclosed is application of a protein with an amino acid sequence of SEQ ID No. 2 or a substance for regulating activity and / or content of the protein in construction of a genetically engineered L-amino acid producing strain. The application constructs an aceA gene mutant engineering strain with a point mutation (C-T) introduced at the 1111th position of the coding region of the aceA gene of an L-amino acid high-yield strain and a wild-type Escherichia coli W3110, and an engineering strain with the aceA gene knocked out. Experiments show that the aceA gene and a variant aceA Q371* gene are involved in biosynthesis of L-amino acid, and accumulation of L-amino acid is facilitated by knocking out or weakening the aceA gene. The aceA gene and the variant can be used to construct a genetically engineered L-amino acid producing strain, so as to promote yield increase of L-amino acid.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the role of the isocitrate lyase gene aceA in the synthesis of L-amino acids, specifically the role of the isocitrate lyase gene aceA in the synthesis of amino acids such as L-alanine, L-valine, L-arginine, L-tryptophan, and L-threonine. Background Technology

[0002] L-amino acids are already used in animal feed, pharmaceuticals, and cosmetics industries. Microbial fermentation is currently the most widely used method for producing L-amino acids, and the fermentation performance of the amino acid-producing bacteria is a key factor affecting the large-scale industrial application of this method. Currently, a few amino acid varieties have not yet been produced by fermentation due to the lack of high-performance fermentation strains. For amino acid-producing strains that have already achieved fermentation production, their acid production levels and sugar-acid conversion rates still need further improvement to save production costs.

[0003] Superior production strains are essential for improving the yield and quality of amino acids. With the development of recombinant DNA technology and the acquisition of relevant microbial genome information, genetic engineering breeding techniques based on metabolic engineering principles have gradually become mainstream. Targeted modification of microbial metabolic pathways and networks, and artificial alteration of metabolic regulation mechanisms, allows the metabolic flow within microorganisms to proceed in a desired direction, leading to excessive accumulation of amino acids, significantly increased amino acid yield, and reduced costs. This is of great significance for accelerating the industrialization of L-amino acids.

[0004] Isocitrate lyase aceA is a key enzyme in the glyoxylate cycle of oilseed crops, but there is currently no research on the function of aceA in L-amino acid production. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to increase the production of L-amino acids in microorganisms through genetic modification. The technical problem to be solved is not limited to the technical subject matter described herein. Other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0006] To address the aforementioned technical problems, the present invention first provides the application of proteins or substances that regulate the activity and / or content of said proteins, wherein the application may include any of the following:

[0007] A1) Application in constructing genetically engineered bacteria that produce L-amino acids;

[0008] A2) Application in the preparation of L-amino acids;

[0009] A3) Application in regulating the production of microbial L-amino acids;

[0010] The protein is named aceA protein and may include any of the following:

[0011] B1) The amino acid sequence contains the protein shown in SEQ ID No. 2;

[0012] B2) A protein that has more than 90% identity with and has the same function as the protein shown in B1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2.

[0013] B3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2).

[0014] The tags include, but are not limited to: GST (glutathione thiotransferase) tag protein, His tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0015] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein aceA of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein aceA isolated in this invention, as long as they encode and function as protein aceA, are derived from and equivalent to the nucleotide sequence of this invention.

[0016] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0017] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0018] In this document, the "identity of 80% or more" can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The "identity of 85% or more" can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The "identity of 90% or more" can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0019] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein aceA.

[0020] In the above text, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (including regulation of modification, splicing, and / or processing of the transcript of the gene); 3) regulation of RNA transport of the gene (including regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (including regulation of the activity of the protein translated by the gene, such as regulation of protein precursor processing, protein transport, protein degradation, and / or protein folding).

[0021] The substance that regulates gene expression can be any of the biological materials described in E1)-E4) of this document.

[0022] Furthermore, the substance regulating gene expression can be a substance (including nucleic acid molecules or vectors) that inhibits, reduces, or downregulates the expression of the gene encoding the protein aceA. The substance inhibiting, reducing, or downregulating the expression of the gene encoding aceA can be a knockout agent for the gene (aceA gene), such as a CRISPR-Cas9 knockout agent or a homologous recombination knockout agent. The agent inhibiting or reducing gene expression can contain a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0023] The present invention also provides applications of biomaterials related to the protein aceA, the applications of which may include any of the following:

[0024] Application of D1) in constructing genetically engineered bacteria that produce L-amino acids;

[0025] Application of D2 in the preparation of L-amino acids;

[0026] Application of D3 in regulating the production of microbial L-amino acids;

[0027] The biomaterial may be any of the following:

[0028] E1) The nucleic acid molecule encoding the protein aceA;

[0029] E2) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the protein aceA;

[0030] E3) contains an expression cassette containing the nucleic acid molecules described in E1) and / or E2);

[0031] E4) A recombinant vector containing the nucleic acid molecules described in E1) and / or E2), or a recombinant vector containing the expression cassette described in E3);

[0032] E5) Recombinant microorganisms containing the nucleic acid molecules described in E1) and / or E2), or recombinant microorganisms containing the expression cassette described in E3), or recombinant microorganisms containing the recombinant vector described in E4);

[0033] E6) A recombinant host cell containing the nucleic acid molecules described in E1) and / or E2), or a recombinant host cell containing the expression cassette described in E3), or a recombinant host cell containing the recombinant vector described in E4).

[0034] Furthermore, the expression cassette described in E3), the recombinant vector described in E4), the recombinant microorganism described in E5), and the recombinant host cell described in E6 can all express the nucleic acid molecules described in E1) and / or E2).

[0035] In the above applications, the nucleic acid molecule described in E1) may include any of the following:

[0036] F1) The coding sequence is the DNA molecule of SEQ ID No. 1;

[0037] F2) The nucleotide sequence is the DNA molecule of SEQ ID No. 1;

[0038] E2) The nucleic acid molecule may include any of the following:

[0039] H1)sgRNA1, wherein the target sequence of sgRNA1 is SEQ ID No.11 (5'-AGCGGCGGACGCTAACCTGGCGG-3');

[0040] H2)sgRNA2, wherein the target sequence of sgRNA2 is SEQ ID No.12 (5'-CCTGGCGGCCAGCATGTATCCGG-3').

[0041] The DNA molecule shown in SEQ ID No. 1 (which may be called the aceA gene) encodes the protein aceA, whose amino acid sequence is SEQ ID No. 2.

[0042] E1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 1.

[0043] Furthermore, E2 can be a nucleic acid molecule that reduces the expression level of the aceA gene.

[0044] The nucleic acid molecule described in E2) may be sgRNA, microRNA, siRNA, shRNA and / or antisense oligonucleotide.

[0045] Furthermore, the sgRNA, microRNA, siRNA, shRNA, and / or antisense oligonucleotides are used to suppress the expression of the aceA gene.

[0046] The sgRNA1 can be used for gene mutation, specifically for mutating the aceA gene.

[0047] The sgRNA2 can be used for gene knockout, specifically to knock out the aceA gene.

[0048] As is well known to those skilled in the art, in addition to using gene editing technology to suppress aceA gene expression, gene knockdown technology can also be used to inactivate or silence aceA gene expression at the post-transcriptional or translational level. The gene knockdown technology includes, but is not limited to, RNA interference, Morpholino interference, antisense nucleic acid, ribozymes, or dominant-negative repressive mutations. Furthermore, using shRNA or siRNA expressed by viruses (such as lentiviruses or adeno-associated viruses) to suppress aceA gene expression and thus silence the aceA gene is also well known to those skilled in the art.

[0049] The regulation of microbial L-amino acid production described in this article can be achieved by increasing (upregulating) or decreasing (downregulating) the accumulation of L-amino acids in microorganisms (i.e., promoting or inhibiting the biosynthesis of L-amino acids).

[0050] The vectors described herein refer to vectors capable of delivering exogenous DNA or target genes into host cells for amplification and expression. These vectors can be cloning vectors or expression vectors, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, and viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.). In one or more embodiments of this invention, the vector is pET28(a), pGRB vector, and / or pREDCas9 plasmid.

[0051] The microorganisms described in this article may be bacteria, fungi, actinomycetes, protozoa, algae, or viruses. Among them, the bacteria may originate from genera such as *Escherichia* sp., *Erwinia* sp., *Agrobacterium* sp., *Flavobacterium* sp., *Alcaligenes* sp., *Pseudomonas* sp., and *Bacillus* sp., but are not limited to these. For example, the bacteria may be *Escherichia coli*, *Corynebacterium glutamicum*, *Brevibacterium flavum*, *Corynebacterium pekinense*, *Brevibacterium glutamicum*, *Corynebacterium obliterans*, or *Pantoea*, etc. The fungus may be a yeast, and the yeast may come from genera such as *Saccharomyces cerevisiae*, *Kluyveromyces* (e.g., *Kluyveromyces lactis*), *Pichia pastoris* (e.g., *Pichia pastoris*), *Schizosaccharomyces pombe* (e.g., *Schizosaccharomyces pombe*), and *Hansenula* (e.g., *Hansenula polymorpha*), but is not limited thereto. The fungus may also come from genera such as *Fusarium* sp., *Rhizoctonia* sp., *Verticillium* sp., *Penicillium* sp., *Aspergillus* sp., and *Cephalosporium* sp., but is not limited thereto. The actinomycetes may come from, but are not limited to, the genera *Streptomycess*, *Nocardia*, *Micromonospora*, *Streptosporangium*, *Actinoplanes*, and *Thermoactinomyces*.The algae may be from genera such as *Fucus* sp., *Achnanthes* sp., *Amphiprora* sp., *Amphora* sp., *Ankistrodesmus* sp., *Asteromonas* sp., and *Boekelovia* sp., but are not limited thereto. The virus may be rotavirus, herpesvirus, influenza virus, adenovirus, etc., but are not limited thereto. In one or more embodiments of the present invention, the microorganism is *Escherichia coli* DH5α, *Escherichia coli* W3110, and / or *Escherichia coli* CGMCC26289.

[0052] The host cell (also called the recipient cell) described herein may be a plant cell or an animal cell. The term "host cell" can be understood not only to refer to a specific recipient cell, but also to the offspring of such a cell, which may not necessarily be identical to the original parent cell due to natural, accidental, or intentional mutations and / or alterations, but are still included within the scope of the host cell. Suitable host cells are those known in the art, including: plant cells such as Arabidopsis thaliana, tobacco (Nicotiana tabacum), maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), etc., but not limited to these; animal cells such as mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (Vero cells), young hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells or NK cells, etc.), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., African clawed frog (Xenopus laevis) cells or giant salamander (Andrias davidianus) cells), fish cells (e.g., grass carp, carp, rainbow trout or catfish cells), insect cells (e.g., Sf21 cells or Sf-9 cells), etc., but not limited to these.

[0053] The recombinant vectors mentioned in this article refer to recombinant DNA molecules constructed by linking exogenous target genes or nucleic acid molecules with a vector in vitro.

[0054] The recombinant microorganisms (or recombinant host cells) described herein refer to recombinant microorganisms (or recombinant host cells) whose functions have been altered by manipulating and modifying the genes of a target microorganism (or target host cell). Examples include recombinant microorganisms (or recombinant host cells) obtained by introducing exogenous target genes or recombinant vectors into a target microorganism (or target host cell), or recombinant microorganisms (or recombinant host cells) obtained by directly editing the endogenous genes of a target microorganism (or target host cell). The term "recombinant microorganism" (or recombinant host cell) can be understood to refer not only to a specific recombinant microorganism (or recombinant host cell), but also to its offspring. Due to natural, accidental, or intentional mutations and / or alterations, the offspring need not be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms (or recombinant host cells).

[0055] The aforementioned recombinant microorganisms can be used to produce a variety of products, including but not limited to alanine, lysine, glutamic acid, valine, glycine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc.

[0056] E4) The recombinant vector may be pET28(a)-aceA. The recombinant vector pET28(a)-aceA is a recombinant expression vector obtained by cloning the wild-type aceA gene and its promoter into the expression vector pET28(a). The recombinant vector pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0057] E5) The recombinant microorganism described may be DH5α / pET28(a)-aceA. The recombinant bacterium DH5α / pET28(a)-aceA is obtained by introducing the recombinant vector pET28(a)-aceA into *Escherichia coli* DH5α. The recombinant bacterium DH5α / pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0058] The present invention also provides a method for increasing the production of L-amino acids in microorganisms, the method comprising reducing the content and / or activity of the protein aceA in the target microorganism to obtain a microorganism with a higher L-amino acid production than the target microorganism.

[0059] In the above method, reducing the content and / or activity of the protein aceA in the target microorganism may be achieved by reducing the expression level and / or activity of the gene encoding the protein aceA in the target microorganism.

[0060] In the above method, reducing the expression level and / or activity of the gene encoding the protein aceA in the target microorganism can be achieved by using gene mutation, gene knockout, gene editing, or gene attenuation techniques to reduce or inactivate the gene encoding the protein aceA in the genome of the target microorganism.

[0061] In the above method, the reduction or inactivation of the gene encoding the protein aceA in the genome of the target microorganism using gene editing technology is performed using a CRISPR / Cas9 system. The CRISPR / Cas9 system includes a vector expressing sgRNA targeting the gene encoding the protein, and the sgRNA may include any of the following:

[0062] G1) is a sgRNA1 for gene mutation, wherein the target sequence of the sgRNA1 is SEQ ID No. 11;

[0063] G2) is a gene knockout sgRNA2, the target sequence of which is SEQ ID No. 12.

[0064] In the above method, the gene mutation mentioned in G1) can be the mutation of the DNA molecule with the nucleotide sequence of SEQ ID No.1 in the target microorganism into the DNA molecule shown in SEQ ID No.5.

[0065] Specifically, the cytosine (C) at position 1111 of SEQ ID No. 1 is mutated to thymine (T), resulting in SEQ ID No. 5.

[0066] Furthermore, the sgRNA1 is used to introduce a point mutation in the coding region of the aceA gene (SEQ ID No. 1), wherein the point mutation is to mutate cytosine (C) at position 1111 of the nucleotide sequence of the aceA gene (SEQ ID No. 1) to thymine (T) to obtain the DNA molecule shown in SEQ ID No. 5 (mutant aceA gene, named mutant aceA). Q371* Gene).

[0067] The DNA molecule shown in SEQ ID No. 5 encodes the amino acid sequence of the mutant protein (aceA) of SEQ ID No. 6. Q371* The mutated protein (SEQ ID No. 6) has a stop codon at position 371 derived from glutamine (Q) mutation.

[0068] Microorganisms obtained by any of the methods described herein, or any of the recombinant microorganisms described herein, are within the scope of protection of this invention.

[0069] The application of microorganisms obtained by any of the methods described herein, or any of the recombinant microorganisms described herein, in the fermentation production of L-amino acids is also within the scope of protection of this invention.

[0070] This invention also provides a protein named aceA. Q371* The protein may include any of the following:

[0071] The amino acid sequence of M1 contains the protein shown in SEQ ID No. 6;

[0072] M2) is a protein that has more than 80% identity with and has the same function as the protein shown in M1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 6.

[0073] A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of M1 or M2).

[0074] The protein aceA is encoded Q371* Nucleic acid molecules, or those containing the protein aceA encoded by the stated protein. Q371* Nucleic acid expression cassettes, recombinant vectors, recombinant microorganisms, or recombinant host cells are all within the scope of protection of this invention.

[0075] Furthermore, the nucleic acid molecule may include the DNA molecule shown in SEQ ID No. 5.

[0076] The present invention also provides the protein aceA. Q371* Or encodes the protein aceA Q371* Any of the following applications of nucleic acid molecules:

[0077] Application of N1 in the construction of genetically engineered bacteria that produce L-amino acids;

[0078] Application of N2 in the preparation of L-amino acids;

[0079] Application of N3 in regulating the production of microbial L-amino acids.

[0080] The DNA molecule shown in SEQ ID No. 5 (whose name may be aceA) Q371* The thymine (T) at position 1111 of the gene is derived from cytosine (C), which leads to premature termination of translation. The final translation yields the mutant protein aceA with the amino acid sequence SEQ ID No. 6. Q371* .

[0081] The L-amino acids mentioned in this article include L-alanine, L-valine, L-arginine, L-tryptophan, and / or L-threonine.

[0082] Isocitrate lyase (ICL) is an enzyme that cleaves isocitrate into glyoxylate and succinate in the glyoxylate cycle, and the products are then synthesized into malate by malate synthase. This invention provides the application of the *E. coli* isocitrate lyase gene aceA in increasing the production of L-amino acids in microorganisms. First, a random mutant plasmid containing a random point mutation, obtained by error-prone PCR amplification, was constructed. This plasmid was then transformed into *E. coli* W3110 to obtain mutant strains of the aceA gene with different mutations. After fermentation culture, the concentration (content) of L-alanine in the mutant strains was analyzed by HPLC. A YPAla-aceA mutant strain 2 was selected, which exhibited superior L-alanine production capacity compared to the wild-type W3110 strain and other mutant strains. Sequencing results of the aceA gene in the YPAla-aceA mutant strain 2 showed that the cytosine (C) at position 1111 of the aceA gene nucleotide sequence (SEQ ID No. 1) was mutated to thymine (T), and correspondingly, the glutamine (Q) at position 371 of the amino acid sequence of the protein it encodes (SEQ ID No. 2) was mutated to a stop codon (the mutated gene was named aceA). Q371* (Gene). To further study the aceA gene and aceA... Q371* To investigate the effect of genes on L-amino acid production in L-amino acid-producing bacteria, this invention constructed: 1. an engineered strain with a point mutation (CT) introduced at position 1111 of the aceA gene coding region in both high-yielding L-amino acid strains and wild-type Escherichia coli W3110; 2. an engineered strain with the aceA gene knocked out in both high-yielding L-amino acid strains and wild-type Escherichia coli W3110. Fermentation experiments were conducted on the constructed engineered strains. The results showed that the aceA gene and its variant aceA... Q371* The aceA gene is involved in the biosynthesis of L-amino acids. Knocking out or weakening the aceA gene, i.e., inhibiting or reducing its expression, promotes the accumulation of L-amino acids. The aceA gene and its variants (such as aceA...) can be utilized. Q371* Genetically engineered strains that produce L-amino acids can be constructed to increase L-amino acid production.

[0083] Preservation Instructions

[0084] 1. Bacterial strain name: Escherichia coli

[0085] Latin name: Escherichia coli

[0086] Classification and nomenclature: Escherichia coli

[0087] Strain number: YP007-1

[0088] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0089] Abbreviation of depositary institution: CGMCC

[0090] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0091] Deposit date: December 26, 2022

[0092] CGMCC Registration Number: CGMCC No. 26289

[0093] 2. Bacterial strain name: Escherichia coli

[0094] Latin name: Escherichia coli

[0095] Classification and nomenclature: Escherichia coli

[0096] Strain number: YP045

[0097] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0098] Abbreviation of depositary institution: CGMCC

[0099] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0100] Deposit date: June 15, 2021

[0101] CGMCC Registration Number: CGMCC No. 22721

[0102] 3. Bacterial strain name: Escherichia coli

[0103] Latin name: Escherichia coli

[0104] Classification and nomenclature: Escherichia coli

[0105] Strain number: YP004-8

[0106] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0107] Abbreviation of depositary institution: CGMCC

[0108] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0109] Deposit date: July 25, 2022

[0110] CGMCC Registration Number: CGMCC No. 25402

[0111] 4. Bacterial strain name: Escherichia coli

[0112] Latin name: Escherichia coli

[0113] Classification and nomenclature: Escherichia coli

[0114] Strain number: YP006D

[0115] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0116] Abbreviation of depositary institution: CGMCC

[0117] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0118] Deposit date: July 25, 2022

[0119] Registered with the China National Collection Center (CGMCC) No. 25403

[0120] 5. Bacterial strain name: Escherichia coli

[0121] Latin name: Escherichia coli

[0122] Classification and nomenclature: Escherichia coli

[0123] Strain number: YP0158

[0124] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0125] Abbreviation of depositary institution: CGMCC

[0126] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0127] Deposit date: July 25, 2022

[0128] CGMCC Registration Number: CGMCC No. 25404 Detailed Implementation

[0129] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0130] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0131] The Escherichia coli W3110 in the following examples is a strain from the American Type Culture Collection (ATCC), with accession number ATCC27325.

[0132] The pGRB cloning vector and pREDCas9 plasmid used in the following examples are products of AddGene.

[0133] The L-alanine producing bacterium CGMCC26289 in the following examples is Escherichia coli YP007-1CGMCC No.26289, abbreviated as CGMCC26289.

[0134] The L-valine-producing bacterium CGMCC22721 in the following examples is Escherichia coli YP045CGMCC No.22721, abbreviated as CGMCC22721.

[0135] The L-arginine producing bacterium CGMCC25402 in the following examples is Escherichia coli YP004-8CGMCC No.25402, abbreviated as CGMCC25402.

[0136] The L-tryptophan producing bacterium CGMCC25403 in the following examples is Escherichia coli YP006DCGMCC No.25403, abbreviated as CGMCC25403.

[0137] The L-threonine producing bacterium CGMCC25404 in the following examples is Escherichia coli YP0158CGMCC No.25404, abbreviated as CGMCC25404.

[0138] Example 1: Construction of a mutant strain containing the isocitrate lyase gene aceA

[0139] I. Construction of a mutant plasmid containing the isocitrate lyase gene aceA

[0140] For ease of study, the wild-type aceA gene (nucleotide sequence as shown in SEQ ID No. 1) and its promoter were first cloned into the expression vector pET28(a). Using the Escherichia coli W3110 genome sequence published by NCBI as a template, PCR amplification was performed using primers PaceA-PF and PaceA-PR to obtain the wild-type aceA promoter, and PCR amplification was performed using primers aceA-PF and aceA-PR to obtain the wild-type aceA gene. After recovery, the expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoRI / Hind III digestion was ligated with NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into E. coli DH5α competent cells and plated on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C to obtain pET28(a) transformants DH5α / pET28(a)-aceA containing the aceA gene and its promoter (nucleotide sequences of the aceA gene and its promoter are shown in SEQ ID No. 3). The cultured single clones were identified by PCR using primers T7 / T7t and rTaq. PCR amplification of a fragment of size 1889 bp (sequence shown in SEQ ID No. 4) identified the pET28(a) positive transformants DH5α / pET28(a)-aceA containing the aceA gene and its promoter.

[0141] After extraction, the plasmid was named pET28(a)-aceA. The plasmid pET28(a)-aceA (also referred to as the recombinant vector pET28(a)-aceA in this paper) is a recombinant expression vector obtained by cloning the wild-type aceA gene and its promoter into the expression vector pET28(a). The recombinant vector pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No.3.

[0142] The recombinant bacterium DH5α / pET28(a)-aceA is a recombinant bacterium obtained by introducing the recombinant vector pET28(a)-aceA into Escherichia coli DH5α. The recombinant bacterium DH5α / pET28(a)-aceA contains the aceA gene and its promoter shown in SEQ ID No. 3.

[0143] To obtain a mutant encoding the isocitrate lyase gene aceA, a mutant aceA gene plasmid (aceA random mutant plasmid) was prepared using a random mutagenesis kit (Agilent Technologies, USA). Specifically, using plasmid pET28(a)-aceA as a template, PCR amplification was performed with primers PaceA-PF and aceA-PR, yielding a 1602 bp aceA gene fragment containing random point mutations, named DNA fragment 1 (sequence as shown in SEQ ID No. 3, but with random point mutations in the aceA coding region).

[0144] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0145] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0146] The recovered DNA fragment 1 was ligated with the expression vector pET28(a) (purchased from TaKaRa, containing kanamycin resistance) recovered by EcoRI / Hind III digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α competent cells and plated onto 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C. The cultured single clones were identified by PCR using primers T7 / T7t and rTaq. Transformants containing a 1889 bp fragment (sequence as shown in SEQ ID No. 4, but with a random point mutation in the aceA coding region) were identified as pET28(a) positive transformants containing a random aceA mutation. The plasmid was then extracted and became the aceA random mutant plasmid.

[0147] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and ddH2O added to a total volume of 25 μL.

[0148] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0149] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0150] PaceA-PF:5'- TAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCC TCTTCTGTGATAGTCGATCG-3' (the underlined nucleotide sequence is the pET28(a) homologous arm sequence)

[0151] PaceA-PR: 5'-CTCCATAGTTATGTGGTGGTCGTGCAGCTCCTCGTCATG-3',

[0152] aceA-PF: 5'-CCATGACGAGGAGCTGCACGACCACCACATAACTATGGAG-3',

[0153] aceA-PR: 5'- CGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGC TTAGAACTGCGATTCTTCAGTG-3' (the underlined nucleotide sequence is the pET28(a) homologous arm sequence)

[0154] T7:5'-TAATACGACTCACTATAGGG-3',

[0155] T7t: 5'-GCTAGTTATT GCTCAGCGG-3'.

[0156] II. Construction of aceA mutant strain with isocitrate lyase gene

[0157] To determine the L-alanine production performance of the mutant vector constructed in step one, specifically, the aceA random mutant plasmid constructed in step one was transformed into the alanine-producing *E. coli* strain CGMCC26289 (transformation and identification were the same as in step one). Positive transformants were passaged three times on 2-YT agar plates containing kanamycin (50 mg / L), and then inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich culture medium. The flasks were then shake-fermented at 37°C for 24 h until the bacterial cells reached the OD value. 600 When the concentration of IPTG reaches 0.2, a final concentration of 0.1 mM is added to induce overexpression of isocitrate lyase.

[0158] After fermentation, the concentration of L-amino acids was analyzed by high-performance liquid chromatography (HPLC), as shown in Table 1. The strain with superior L-alanine production capacity was selected as the YPAla-aceA mutant.

[0159] Enriched culture medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast extract 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, vitamin H 20 mg / L, vitamin B1 1.5 mg / L, vitamin B3 1.5 mg / L. 12 1.5 g / L, pH adjusted to 7.0 with sodium hydroxide.

[0160] Table 1. Results of L-alanine analysis by high performance liquid chromatography in the YPAla-aceA mutant strain.

[0161]

[0162] As shown in Table 1, the Escherichia coli YPAla-aceA mutant strain disclosed in this invention has the ability to produce L-alanine, among which YPAla-aceA mutant strain 2 has a superior ability to produce L-alanine, which is basically on par with the producing strain CGMCC26289.

[0163] Sequencing of the aceA gene using a plasmid extracted from the YPAla-aceA mutant strain 2 confirmed that the 1111th cytosine (C) position in the aceA mutant nucleotide sequence was mutated to thymine (T), and the 371st glutamine (Q) position in the mutant protein aceA was mutated to a stop codon. This plasmid is pET28(a)-aceA. Q371* (The sequence is shown in SEQ ID No. 3, with a mutation of (T) at position 1408. The DNA sequence shown in SEQ ID No. 1 is the wild-type aceA gene, encoding a protein whose amino acid sequence is SEQ ID No. 2 (the protein is named wild-type aceA protein); the DNA sequence shown in SEQ ID No. 5 is the mutant aceA gene.) Q371* The gene, the mutant aceA Q371* The thymine (T) at position 1111 in the gene sequence (SEQ ID No. 5) is derived from a mutation of cytosine (C), encoding a protein with the amino acid sequence of SEQ ID No. 6 (the name of the mutant protein is mutant aceA). Q371* (protein), the mutant protein aceA Q371* The stop codon at position 371 in the amino acid sequence (SEQ ID No. 6) is derived from a mutation of glutamine (Q).

[0164] Example 2: Construction of an engineered strain containing the isocitrate lyase gene aceA

[0165] Based on the genome sequence of Escherichia coli W3110 published by NCBI, point mutations were performed on the aceA gene of high-yielding L-amino acid strains and wild-type E. coli W3110 using CRISPR / Cas9 gene editing technology. This allowed for further in-depth research on the aceA gene and mutant aceA in high-yielding strains. Q371* The influence of genes on the production of amino acids such as L-alanine, L-valine, L-arginine, L-tryptophan, and L-threonine.

[0166] A point mutation was introduced into the coding region of the aceA gene (SEQ ID No. 1), wherein the point mutation was to mutate cytosine (C) to thymine (T) at position 1111 of the nucleotide sequence of the aceA gene (SEQ ID No. 1) to obtain the DNA molecule shown in SEQ ID No. 5 (mutant aceA gene, named mutant aceA). Q371* Gene).

[0167] Accordingly, the DNA molecule shown in SEQ ID No. 5 encodes the amino acid sequence of the mutant protein (aceA) of SEQ ID No. 6. Q371* The mutated protein (SEQ ID No. 6) has a stop codon at position 371 derived from glutamine (Q) mutation.

[0168] I. Construction of sgRNA

[0169] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA (sgRNA1) target sequences were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector terminal sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0170] The target sequence of sgRNA1 is: 5'-AGCGGCGGACGCTAACCTGGCGG-3' (SEQ ID No. 11); sgRNA1 is used to mutate the 1111th base C of the aceA gene to the base T, resulting in the mutant gene (aceA). Q371* Genes) and mutant proteins (aceA) Q371* protein).

[0171] Amplifying DNA fragments containing the sgRNA1 target sequence requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-1F 10 μL, sgRNA-1R 10 μL; PCR reaction program: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment (DNA fragment containing the sgRNA1 target sequence) is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0172] The pGRB plasmid was digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10×Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the pGRB plasmid was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10×Buffer, 1000-2000 ng linearized pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linearized pGRB plasmid was recovered using a DNA purification kit. Recombination of the DNA fragment containing the sgRNA1 target sequence and the linearized pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). Recombinant system: 2.5 μL NEB assembly enzyme, 2 μL linearized pGRB plasmid, and 0.5 μL DNA fragment containing the sgRNA1 target sequence. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The constructed plasmid was named pGRB-sgRNA-1.

[0173] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bold bases are the sgRNA1 target sequences:

[0174] sgRNA-1F:

[0175] sgRNA-1R:

[0176] sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3',

[0177] sgRNA-PR: 5'-ATGAGAAAGCGCCACGCT-3'.

[0178] II. Mutant aceA Q371* DNA amplification

[0179] Using W3110 genomic DNA as a template, PCR amplification was performed with primers P1 / P2, P3 / P4, and KAPA HiFi HotStart, respectively, yielding two aceA lines with mutant bases of 641 bp and 628 bp, respectively. Q371* DNA fragment (aceA) Q371* Up and aceA Q371* (Down). After the PCR reaction, aceA was recovered by agarose gel electrophoresis using a column-based DNA gel recovery kit. Q371* Up and aceA Q371* Down. Using the two recovered DNA fragments as templates, overlap PCR amplification was performed with primers P1 / P4 to obtain the point-mutated integration homologous arm DNA fragment Up-aceA. Q371* -Down(SEQ ID No.7)1241bp.

[0180] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0181] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0182] Primer design is as follows (synthesized by Invitrogen Shanghai). The bases in lowercase bold indicate mutation positions:

[0183] P1: 5'-TTGGCG GTGTCCTGAATGCC-3',

[0184] P2:

[0185] P3:

[0186] P4: 5'-GTAAAATGCCGCGTCCGTAC-3',

[0187] III. Preparation and Transformation of Competent Cells

[0188] The pREDCas9 plasmid (containing a spectinomycin resistance gene) was transformed into L-alanine-producing bacteria CGMCC26289, L-valine-producing bacteria CGMCC22721, L-arginine-producing bacteria CGMCC25402, L-tryptophan-producing bacteria CGMCC25403, L-threonine-producing bacteria CGMCC25404, and wild-type *E. coli* W3110 competent cells, respectively. The cells were then plated onto 2-YT agar plates containing spectinomycin (100 mg / L) and incubated at 32°C. Single colonies resistant to spectinomycin (100 mg / L) were selected and identified by rTaq PCR using primers pRedCas9-PF / pRedCas9-PR. A 943 bp (SEQ ID) gene was obtained. The colonies in No. 8 were L-alanine-producing bacteria CGMCC26289-Cas9, L-valine-producing bacteria CGMCC22721-Cas9, L-arginine-producing bacteria CGMCC25402-Cas9, L-tryptophan-producing bacteria CGMCC25403-Cas9, L-threonine-producing bacteria CGMCC25404-Cas9, and wild-type Escherichia coli W3110-Cas9, all containing the pREDCas9 plasmid.

[0189] Prepare competent cells of L-alanine-producing bacteria CGMCC26289-Cas9, L-valine-producing bacteria CGMCC22721-Cas9, L-arginine-producing bacteria CGMCC25402-Cas9, L-tryptophan-producing bacteria CGMCC25403-Cas9, L-threonine-producing bacteria CGMCC25404-Cas9, and wild-type Escherichia coli W3110-Cas9. When the bacterial cells grow to OD... 600 =0.1 Add IPTG to a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration was 0.6, bacterial cells were collected to prepare competent cells, which were then transformed with pGRB-sgRNA-1 plasmid and the point-mutated recombinant DNA fragment Up-aceA. Q371* -Down, spread onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and incubate at 32°C. Transformants were identified by PCR using primers P5 / P6 and rTaq. The resulting 280 bp (SEQ ID No. 9) PCR product was denatured at 95°C for 10 min, followed by an ice bath for 5 min, and then subjected to SSCP (Single-Strand Conformation Polymorphism) electrophoresis (using Up-acetylene). Q371*-Down amplified PCR fragment is the positive control, W3110 amplified PCR fragment is the negative control, and water is the blank control. Due to the different fragment structures, the electrophoretic positions are different. Therefore, strains whose PCR fragment electrophoretic positions are inconsistent with the negative control fragment positions but consistent with the positive control fragment positions are strains with successful allelic substitution.

[0190] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0191] P5: 5'-GGCAGAAAAACCTCGACGAC-3',

[0192] P6: 5'-CCCTGAATAATAGTCGTCAC-3',

[0193] pRedCas9-PF: 5'-GCAGTGGCGGTTTTCATG-3',

[0194] pRedCas9-PR: 5'-CCTTGGTGATCTCGCCTTTC-3'.

[0195] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0196] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0197] Preparation and electrophoresis conditions for SSCP electrophoresis: 8 mL of 40% acrylamide, 4 mL of glycerol, 2 mL of 10×TBE, 40 μL of TEMED, 600 μL of 10% APS, and 26 mL of ddH2O; place the electrophoresis tank in ice and electrophore in 1×TBE buffer at 120V for 10 h.

[0198] Transformants that successfully underwent point mutation were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose to eliminate the pGRB-sgRNA-1 plasmid. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT were selected. The point mutation sequence was amplified again by primer P5 / P6 PCR and sequenced for identification. The sequencing results were compared with the W3110 genome sequence to confirm that the mutation at position 1111 of the aceA gene, from C to T, was the aceA mutant. Q371* Positive transformant. The aceA gene mutant... Q371* The L-alanine-producing strain was named YPAla-aceA001, and the mutant aceA gene was used. Q371* The L-valine-producing strain was named YPV-aceA001, and the mutant aceA gene was used. Q371* The L-arginine-producing strain was named YPR-aceA001, and the mutant aceA gene was used. Q371* The L-tryptophan-producing strain was named YPTrp-aceA001, and the mutant aceA gene was used. Q371* The L-threonine-producing strain was named YPThr-aceA001, and the mutant aceA gene was used. Q371* The Escherichia coli W3110 was named W3110-aceA001.

[0199] Example 3: Construction of an engineered strain with the isocitrate lyase gene aceA missing from its genome.

[0200] Based on the genome sequence of Escherichia coli W3110 published by NCBI, the aceA gene of L-alanine-producing strains CGMCC26289, L-valine-producing strain CGMCC22721, L-arginine-producing strain CGMCC25402, L-tryptophan-producing strain CGMCC25403, and L-threonine-producing strain CGMCC25404 (sequencing confirmed that these amino acid-producing strains retain the wild-type aceA gene on their chromosomes) and wild-type Escherichia coli W3110 was knocked out using CRISPR / Cas9 gene editing technology. This was to further investigate the impact of the Escherichia coli aceA gene on the synthesis of amino acids such as L-alanine, L-valine, L-arginine, L-tryptophan, and L-threonine.

[0201] I. Construction of sgRNA

[0202] Based on the Escherichia coli W3110 genome sequence published by NCBI, sgRNA target sequences (sgRNA2) were designed using CRISPRRGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting a suitable sgRNA target sequence, linearized pGRB cloning vector homologous arm sequences were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0203] The target sequence of sgRNA2 is: 5'-CCTGGCGGCCAGCATGTATCCGG-3' (SEQ ID No. 12); sgRNA2 is used to knock out the aceA gene.

[0204] Amplifying DNA fragments containing the sgRNA2 target sequence requires no template; only a PCR annealing process is needed. The system and procedure are as follows: PCR reaction system: sgRNA-3F 10 μL, sgRNA-3R 10 μL; PCR reaction program: denaturation at 95℃ for 5 min, annealing at 50℃ for 1 min. After annealing, the target fragment (DNA fragment containing the sgRNA2 target sequence) is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100 ng / μL.

[0205] The pGRB plasmid was digested with Spe I and dephosphorylated to prevent self-ligation. The digestion system consisted of 5 μL 10×Buffer, 2.5 μL Spe I, 3000-5000 ng pGRB plasmid DNA, and ddH2O to a final volume of 50 μL. After digestion at 37°C for 3 h, the pGRB plasmid was recovered by agarose gel electrophoresis and then dephosphorylated. The dephosphorylation system consisted of 5 μL 10×Buffer, 1000-2000 ng linearized pGRB plasmid DNA, 2.5 μL CIAP, and ddH2O to a final volume of 50 μL. After treatment at 37°C for 1 h, the linearized pGRB plasmid was recovered using a DNA purification kit. Recombination of the DNA fragment containing the sgRNA2 target sequence and the linearized pGRB plasmid was then performed using a Gibson Assembly kit (New England Biotechnology). Recombinant system: 2.5 μL NEB assembly enzyme, 2 μL linearized pGRB plasmid, and 0.5 μL DNA fragment containing the sgRNA2 target sequence. After assembly at 50℃ for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and identified by sequencing using sgRNA-PF / sgRNA-PR primers. The constructed plasmid was named pGRB-sgRNA-2.

[0206] The primers used in this experiment were designed as follows (synthesized by Invitrogen Shanghai). Underlined bases are the homologous arm sequences of the pGRB cloning vector, and bases in red are the sgRNA2 target sequences:

[0207] sgRNA-2F:

[0208] sgRNA-2R:

[0209] sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3',

[0210] sgRNA-PR: 5'-ATGAGAAAGCGCCACGCT-3'.

[0211] II. PCR amplification of DNA recombination fragments missing from the genome

[0212] Based on the genome sequence of Escherichia coli W3110 published by NCBI, two pairs of primers were designed and synthesized to amplify the upstream and downstream homologous arm sequences. The aceA gene of L-alanine-producing bacteria CGMCC26289, L-valine-producing bacteria CGMCC22721, L-arginine-producing bacteria CGMCC25402, L-tryptophan-producing bacteria CGMCC25403, L-threonine-producing bacteria CGMCC25404, and wild-type Escherichia coli W3110 was knocked out by CRISPR / Cas9 gene editing.

[0213] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0214] P7: 5'-GATGAAGAGCACAATAACCAGG-3',

[0215] P8: 5'-CAGTCAGCAACGGTTGTTGTTGCGTGCAGATGCTCCATAGTTATG-3',

[0216] P9: 5'-CATAACTATGGAGCATCTGCACGCAACAACAACCGTTGCTGACTG-3',

[0217] P10: 5'-CGCATCAGTAGAGATTCCCAGC-3'.

[0218] Using W3110 genomic DNA as a template, PCR amplification was performed with primers P7 / P8, P9 / P10, and KAPA HiFi HotStart to obtain upper and lower homologous arm fragments of 643 bp and 668 bp, respectively. After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA was then amplified by overlap PCR with primers P7 / P10 to obtain a 1266 bp recombinant DNA fragment ΔaceA-Up-Dwon (SEQ ID No. 10) that lacks the aceA gene in the genome.

[0219] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0220] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 56℃ annealing for 15 s; 72℃ extension for 60 s; 30 cycles), 72℃ over-extension for 5 min.

[0221] III. Preparation and Transformation of Competent Cells

[0222] Competent cells of L-alanine-producing bacteria CGMCC26289-Cas9, L-valine-producing bacteria CGMCC22721-Cas9, L-arginine-producing bacteria CGMCC25402-Cas9, L-tryptophan-producing bacteria CGMCC25403-Cas9, L-threonine-producing bacteria CGMCC25404-Cas9, and wild-type Escherichia coli W3110-Cas9 were prepared. When the bacterial cells grew to OD... 600 =0.1 Add IPTG to a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. When OD 600 When the concentration of bacteria reached 0.6, competent cells were collected and transformed into pGRB-sgRNA-2 plasmid and the recombinant DNA fragment ΔaceA-Up-Dwon (with the aceA gene deleted), respectively. These cells were then plated onto 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and incubated at 32°C. Single colonies were identified by PCR using primers P7 / P10 with rTaq. Transformants containing a 1266 bp fragment (SEQ ID No. 10) were considered positive, while those containing a 2571 bp fragment were considered the original bacteria.

[0223] Positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose to eliminate the pGRB-sgRNA-2 plasmid. Colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on antibiotic-free 2-YT were selected. PCR was performed again using primers P7 / P10 with rTaq. Transformants containing a size of 1266 bp (SEQ ID No. 10) were identified as positive transformants.

[0224] The positive transformant lacking the aceA gene in the genome of L-alanine-producing bacterium CGMCC26289 was named YPAla-aceA002; the positive transformant lacking the aceA gene in the genome of L-valine-producing bacterium CGMCC22721 was named YPV-aceA002; the positive transformant lacking the aceA gene in the genome of L-arginine-producing bacterium CGMCC25402 was named YPR-aceA002; the positive transformant lacking the aceA gene in the genome of L-tryptophan-producing bacterium CGMCC25403 was named YPTrp-aceA002; the positive transformant lacking the aceA gene in the genome of L-threonine-producing bacterium CGMCC25404 was named YPThr-aceA002; and the positive transformant lacking the aceA gene in the genome of wild-type Escherichia coli W3110 was named W3110-aceA002.

[0225] PCR amplification system: 12.5 μL of 2×Premix r Taq, 1 μL of each primer (10 pM), and 25 μL of ddH2O.

[0226] PCR amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s; 56℃ annealing for 30 s; 72℃ extension for 90 s (30 cycles), 72℃ over-extension for 10 min.

[0227] Example 4: Fermentation Experiment

[0228] I. Alanine Fermentation Experiment

[0229] Escherichia coli W3110, L-alanine-producing strain CGMCC26289, and engineered aceA strains YPAla-aceA001, W3110-aceA001, YPAla-aceA002, and W3110-aceA002 were inoculated into 5L BLBIO-5GC-4-H fermenters (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-alanine fermentation medium and conditions. Each strain was repeated three times. After fermentation, the L-alanine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 2.

[0230] L-alanine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast extract 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, and the pH is adjusted to 7.0 by ammonia.

[0231] L-alanine fermentation culture conditions:

[0232] Calibrate DO 100%: Temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0MPa, calibrate after 5min;

[0233] Inoculation dose: 10%;

[0234] Initial conditions: pH 7.0, culture temperature 37℃, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0235] Full process control: 1. When dissolved oxygen < 30%, increase the rotation speed by 500 rpm → 600 rpm → air volume by 1 L / min → 700 rpm → 800 rpm in sequence; 2. Increase the tank pressure by 0.01 MPa after 8 hours of fermentation; increase the tank pressure by 0.02 MPa → 0.03 MPa → 0.04 MPa → 0.05 MPa after 12 hours;

[0236] Residual sugar control: 0.1%-0.5% before F12h; after F12h, control residual sugar to 0.1%-0.3% in conjunction with DO requirements;

[0237] Feeding materials: 25% ammonia water, 55% concentrated sugar, 10% foaming agent;

[0238] Fermentation cycle: about 30 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 20%-30%.

[0239] Table 2. L-alanine production

[0240]

[0241] As the fermentation results above show, for both the high-yield L-alanine producing strain CGMCC26289 and wild-type Escherichia coli W3110, replacing the glutamine at position 371 of the aceA gene with a stop codon or completely knocking out the aceA gene helps to increase L-alanine production.

[0242] II. L-valine fermentation experiment

[0243] Escherichia coli W3110, L-valine-producing strain CGMCC22721, and engineered aceA strains YPV-aceA001, W3110-aceA001, YPV-aceA002, and W3110-aceA002 were inoculated into 5L BLBIO-5GC-4-H fermenters (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-valine fermentation medium and conditions. Each strain was repeated three times. After fermentation, the L-valine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 3.

[0244] L-valine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: yeast extract 4 g / L, corn steep liquor powder 2 g / L, peptone 4 g / L, methionine 2 g / L, KH₂PO₄·3H₂O 7 g / L, MgSO₄·7H₂O 2 g / L, CoCl₂ 20 mg / L, (NH₄)₂SO₄ 3 g / L, citric acid 2 g / L, FeSO₄·7H₂O 50 mg / L, MnSO₄·7H₂O 30 mg / L, VH 20 mg / L, VB₁ 1.5 mg / L, VB₃ 1.5 mg / L. 12 1.5 g / L, defoamer 0.3 mL / L, (NH4)2SO4 3 g / L, pH 7.0.

[0245] L-valine fermentation culture conditions: Dissolved oxygen electrode calibration method: Zero point is calibrated in saturated sodium sulfite solution, and 100 point is calibrated in air;

[0246] L-valine fermentation involves a two-stage aerobic-aerobic fermentation process. Cells are first cultured under aerobic conditions, with airflow, rotation speed, and sugar supplementation rate adjusted in the early stages to maintain dissolved oxygen at approximately 25%. Once the OD (oxidative stress) is reached... 600 When the value reaches 50-60, the rotation speed is reduced to 400 rpm and the air volume is reduced to 2L / min; and the aerobic fermentation is switched to the anaerobic fermentation.

[0247] Calibrate DO 100%: Temperature 33℃, air volume 1L / min, speed 400rpm, tank pressure 0.01Mpa, calibrate after 5min;

[0248] Inoculation rate: 3.5%;

[0249] Fermentation cycle: approximately 18-20 hours.

[0250] Table 3. L-valine production

[0251]

[0252]

[0253] As the fermentation results above show, for both the high-yielding L-valine strain CGMCC22721 and the wild-type Escherichia coli W3110, replacing the glutamine at position 371 of the aceA gene with a stop codon or completely knocking out the aceA gene helps to increase L-valine production.

[0254] III. L-Arginine Fermentation Experiment

[0255] Escherichia coli W3110, L-arginine-producing strain CGMCC25402, and engineered aceA strains YPR-aceA001, W3110-aceA001, YPR-aceA002, and W3110-aceA002 were inoculated into 5L BLBIO-5GC-4-H fermenters (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-arginine fermentation medium and conditions. Each strain was repeated three times. After fermentation, the L-arginine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 4.

[0256] L-Arginine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 8 g / L, FM902 yeast extract 3 g / L, K2HPO4·3H2O 6 g / L, MgSO4·7H2O 1 g / L, FeSO4·7H2O 0.05 g / L, betaine 0.5 g / L, VB 12 0.005 g / L, defoamer 0.3 mL / L, ammonium sulfate 3 g / L, pH 7.2.

[0257] L-arginine fermentation culture conditions: Corrected DO 100%: temperature 35℃, pH 7.2, rotation speed 100rpm, air volume 6L / min, tank pressure 0.00Mpa;

[0258] Inoculation dose: 10%;

[0259] Initial conditions: temperature 35℃, pH 7.2, tank pressure 0.01 MPa, air volume 1.5 L / min, rotation speed 350 rpm;

[0260] Full-process control: Control DO at 20%-30%; when dissolved oxygen ≤25%, increase the rotation speed by 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0261] Residual sugar control: Residual sugar content is controlled at 0.05%-0.1% throughout the entire process;

[0262] Feeding materials: 25% ammonia water, 80% concentrated sugar, 10% foaming agent;

[0263] Fermentation cycle: about 50 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 20%-30%.

[0264] Table 4. L-arginine production

[0265]

[0266] As shown in the fermentation results above, for both the high-L-arginine-producing strain CGMCC25402 and the wild-type Escherichia coli W3110, replacing the glutamine at position 371 of the aceA gene with a stop codon or completely knocking out the aceA gene helps to increase L-arginine production.

[0267] IV. L-Tryptophan Fermentation Experiment

[0268] Escherichia coli W3110, L-tryptophan-producing strain CGMCC25403, and engineered aceA strains YPTrp-aceA001, W3110-aceA001, YPTrp-aceA002, and W3110-aceA002 were inoculated into 5L BLBIO-5GC-4-H fermenters (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-tryptophan fermentation medium and conditions. Each strain was repeated three times. After fermentation, the L-tryptophan content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 5.

[0269] L-Tryptophan fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 7g / L, FM902 yeast extract 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, defoamer 0.2mL / L, and pH adjusted to 7.0 by ammonia.

[0270] L-Tryptophan culture conditions:

[0271] Calibrate DO 100%: Temperature 35℃, Rotation speed 800rpm, Air volume 5L / min, Tank pressure 0.00Mpa;

[0272] Inoculation dose: 10%;

[0273] Initial conditions: temperature 35℃, pH 7.0, air volume 1.0L / min, rotation speed 350rpm;

[0274] Full process control: When dissolved oxygen is ≤20% before the base sugar is depleted, increase the speed sequentially to 400rpm and then to 450rpm; when the base sugar is depleted, replenish sugar and control dissolved oxygen to 15%-30%; pH 7.0 before 24h and 6.7 after 24h.

[0275] Residual sugar control: 0.1%-0.5% before F12h; after F12h, control residual sugar to 0.1%-0.3% in conjunction with DO requirements;

[0276] Feeding materials: 25% ammonia water, 55% concentrated sugar, 10% foaming agent;

[0277] Fermentation cycle: about 34 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 15%-30%.

[0278] Table 5. L-Tryptophan Production

[0279]

[0280] As shown in the fermentation results above, for both the high-L-tryptophan-producing strain CGMCC25403 and the wild-type Escherichia coli W3110, replacing the glutamine at position 371 of the aceA gene with a stop codon or completely knocking out the aceA gene helps to increase L-tryptophan production.

[0281] V. L-Threonine Fermentation Experiment

[0282] Escherichia coli W3110, L-threonine strain CGMCC25404, and engineered aceA strains YPThr-aceA001, W3110-aceA001, YPThr-aceA002, and W3110-aceA002 were inoculated into 5L BLBIO-5GC-4-H fermenters (Shanghai Bailun Biotechnology Co., Ltd.) and fermented under L-threonine fermentation medium and conditions. Each strain was repeated three times. After fermentation, the L-threonine content was determined by high-performance liquid chromatography (HPLC), and the results were the average of the three replicates, as shown in Table 6.

[0283] L-Threonine fermentation medium: The solvent is water, and the solutes and their concentrations are as follows: glucose 13g / L, (NH4)2SO4 1g / L, H3PO4 0.5g / L, KCl 0.8g / L, MgSO4·7H2O 0.8g / L, FeSO4·7H2O 0.01g / L, MnSO4·H2O 0.01g / L, FM902 yeast extract 1.5g / L, corn steep liquor 5g / L, molasses 17g / L, and the pH is adjusted to 7.0 by ammonia.

[0284] L-threonine fermentation culture conditions:

[0285] Calibrate DO 100%: Temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0MPa, calibrate after 5min;

[0286] Inoculation dose: 10%;

[0287] Initial conditions: pH 7.0, culture temperature 37℃, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0288] Full process control: 1. When dissolved oxygen < 30%, increase the rotation speed by 500 rpm → 600 rpm → air volume by 1 L / min → 700 rpm → 800 rpm in sequence; 2. Increase the tank pressure by 0.01 MPa after 8 hours of fermentation; increase the tank pressure by 0.02 MPa → 0.03 MPa → 0.04 MPa → 0.05 MPa after 12 hours;

[0289] Residual sugar control: 0.1%-0.5% before F12h; after F12h, control residual sugar to 0.1%-0.3% in conjunction with DO requirements;

[0290] Feeding materials: 25% ammonia water, 55% concentrated sugar, 10% foaming agent;

[0291] Fermentation cycle: about 30 hours. The process is controlled by adjusting the air volume based on dissolved oxygen of 20%-30%.

[0292] Table 6. L-Threonine Production

[0293]

[0294] The fermentation results show that, for both the high-yielding L-threonine strain CGMCC25404 and the wild-type Escherichia coli W3110, replacing the glutamine at position 371 of the aceA gene with a stop codon or completely knocking out the aceA gene helps to increase L-threonine production.

[0295] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

[0296] Some sequences in this article are shown below:

[0297] SEQ ID No. 1: Wild-type aceA gene ORF (CDS) nucleotide sequence (1305 bp)

[0298]

[0299]

[0300] SEQ ID No. 2: Wild-type protein aceA amino acid sequence (434aa)

[0301]

[0302] SEQ ID No. 5: Mutant aceA Q371* Gene ORF (CDS) nucleotide sequence (1305 bp)

[0303]

[0304] SEQ ID No. 6: Mutant protein aceA Q371* Amino acid sequence (370aa)

[0305]

Claims

1. The application of knocking out the gene encoding protein aceA in Escherichia coli to increase the production of L-amino acids in Escherichia coli, wherein the amino acid sequence of protein aceA is shown in SEQ ID No. 2, and the L-amino acids are L-alanine, L-valine, L-arginine and / or L-tryptophan.

2. The application according to claim 1, characterized in that, The knockout is performed using a CRISPR / Cas9 system, which includes an sgRNA for knocking out the gene encoding the protein aceA, and the target sequence of the sgRNA is SEQ ID No.

12.

3. The application of biomaterials in increasing the yield of L-amino acids in *Escherichia coli*, wherein the biomaterial is any one of the following: E1) An expression cassette containing the sgRNA described in claim 2; E2) A recombinant vector containing the sgRNA of claim 2, or a recombinant vector containing the expression cassette of E1; E3) A recombinant host cell containing the sgRNA of claim 2, or a recombinant host cell containing the expression cassette of E1), or a recombinant host cell containing the recombinant vector of E2; The application is achieved by knocking out the gene encoding the protein aceA in Escherichia coli; the L-amino acids are L-alanine, L-valine, L-arginine and / or L-tryptophan; and the recombinant host cell is Escherichia coli.

4. A method for increasing the yield of L-amino acids in Escherichia coli, characterized in that, The method includes knocking out the gene encoding the protein aceA of claim 1 in the target Escherichia coli to obtain a recombinant Escherichia coli with a higher yield of L-amino acids than the target Escherichia coli, wherein the L-amino acids are L-alanine, L-valine, L-arginine and / or L-tryptophan.

5. The method according to claim 4, characterized in that, The knockout is performed using a CRISPR / Cas9 system, which includes a vector expressing sgRNA that targets the gene encoding the protein aceA, and the target sequence of the sgRNA is SEQ ID No. 12.

Images