Application of aspartic protease 1 and its encoding gene in regulating wheat photosynthesis, yield, and protein content

Abstract

This invention discloses the application of aspartic protease 1 and its encoding gene in regulating wheat photosynthesis, yield, and protein content. Analysis of wheat mutants with APP1 gene mutations revealed that, compared to wild-type wheat, the APP1 mutant exhibited enhanced photosynthesis, larger grains, increased grain weight, and higher protein content. Conversely, overexpression of APP-A1 in wild-type wheat accelerated leaf senescence and corrected the mutant phenotype. Furthermore, this invention identified a SNP site in the APP-A1 gene associated with photosynthesis and grain development in natural wheat populations, and natural variations in the APP-A1 gene can promote photosynthesis and grain development. These results demonstrate that APP1 plays a negative regulatory role in wheat photosynthesis, yield, and protein content. This invention is of significant importance for the breeding and screening of wheat varieties with enhanced photosynthesis, high yield, and high protein content.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of aspartic protease 1 (APP1) and its encoding gene in regulating wheat photosynthesis, yield and protein content. Background Technology

[0002] Global warming will bring a series of related problems, such as rising sea levels, more frequent extreme weather events, and a surge in pests and diseases. Photosynthesis, the absorption of solar energy, is the primary driving force supporting plant growth, biomass accumulation, and storage of grains, tubers, etc. Optimizing crop photosynthesis is an effective strategy to increase grain yields to feed the world's population. Scientists have proposed several theoretical goals to achieve higher photosynthetic efficiency: optimizing light capture through manipulation of the leaf canopy, reducing energy consumption in crop chloroplasts through alternative photorespiration pathways, accelerating non-photochemical quenching of photosystem II, and increasing carboxylation capacity through modification of Rubisco enzymes, among others.

[0003] Wheat is a crucial food crop in my country, and high and stable yields are essential for ensuring food security and achieving agricultural modernization. Maintaining green chlorophyll is a beneficial strategy that can preserve the mobilization of nutrients stored in the source-sink relationship, enhance the crop's adaptability to extreme weather conditions, and increase crop yield, especially under adverse conditions. The optimal atmospheric temperatures for wheat during the heading, flowering, and grain-filling stages are 16±2.3℃, 23±1.75℃, and 26±1.53℃, respectively. Temperatures exceeding these optimal levels can damage chloroplast integrity, accelerate leaf senescence, interfere with photosynthesis, and ultimately lead to yield decline. Considering current consumer concerns about genetically modified crops and the negative environment surrounding agricultural biotechnology in Europe, natural methods that extend photosynthesis can increase wheat yield traits and provide more food for the world.

[0004] Plant seeds contain stored metabolites such as carbohydrates, proteins, lipids, and nucleic acids. These metabolites are crucial for rapid cell division and growth during the transition from dormancy to photosynthetic autotrophy when conditions are suitable for germination. Protein is an important component of wheat grains and one of the main sources of plant protein for humans. The protein content of wheat grains is not only an important indicator of nutritional quality, but its level also directly affects the quality of processed food. Therefore, the protein content of wheat grains has a very important impact on wheat quality and human nutritional needs. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to regulate plant yield, photosynthesis, seed size and protein content.

[0006] In a first aspect, the present invention protects novel uses of aspartic protease 1 or related biological materials.

[0007] This invention protects the use of aspartic protease 1 (APP1) or related biological materials in any of the following 1)-6):

[0008] 1) Regulating plant yield;

[0009] 2) Regulating plant seed size;

[0010] 3) Regulate plant photosynthesis;

[0011] 4) Regulate the protein content of plant seeds;

[0012] 5) Cultivate transgenic plants with reduced yield and / or reduced photosynthetic efficiency and / or smaller seeds and / or reduced seed protein content;

[0013] 6) Plant breeding;

[0014] The aspartic protease 1 is APP-A1 protein and / or APP-B1 protein; the APP-A1 protein and the APP-B1 protein are two copies of the APP1 protein in the A and B genomes of tetraploid wheat, respectively.

[0015] The APP-A1 protein is any one of the proteins described below (a1)-(a4):

[0016] (a1) The protein shown in sequence 1 of the sequence listing;

[0017] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0018] (a3) Proteins related to plant yield and / or photosynthesis obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1).

[0019] (a4) is a protein that shares more than 98% identity with (a1) and is associated with plant yield and / or photosynthesis;

[0020] The APP-B1 protein is any one of the proteins described below (b1)-(b4):

[0021] (b1) The protein shown in sequence 4 of the sequence listing;

[0022] (b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (b1);

[0023] (b3) Proteins related to plant yield and / or photosynthesis obtained by substituting and / or deleting and / or adding one or more amino acid residues of (b1);

[0024] (b4) is a protein that shares more than 98% identity with (b1) and is associated with plant yield and / or photosynthesis.

[0025] In the proteins described in (a2) or (b2) above, the tag refers to a polypeptide or protein expressed by fusing it with the target protein using in vitro DNA recombination technology, in order to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0026] In the protein described in (a3) ​​or (b3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0027] In the proteins described in (a4) or (b4) above, the identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0028] The relevant biological material is a nucleic acid molecule encoding the APP-A1 protein or the APP-B1 protein, or an expression cassette, recombinant vector, or recombinant microorganism containing the nucleic acid molecule.

[0029] The nucleic acid molecule encoding the APP-A1 protein is a DNA molecule as described in either (A1) or (A2):

[0030] (A1) The DNA molecule shown in sequence 2 or sequence 3 in the sequence listing;

[0031] (A2) is a DNA molecule that has more than 75% identity with (A1) and encodes the APP-A1 protein;

[0032] The nucleic acid molecule encoding the APP-B1 protein is a DNA molecule as described in either (B1) or (B2):

[0033] (B1) The DNA molecule shown in sequence 5 or sequence 6 of the sequence listing;

[0034] (B2) is a DNA molecule that has more than 75% identity with (B1) and encodes the APP-B1 protein.

[0035] Those skilled in the art can readily mutate the nucleotide sequences encoding the APP-A1 or APP-B1 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity with the APP-A1 or APP-B1 protein nucleotide sequences isolated according to this invention, provided they encode the APP-A1 or APP-B1 protein and have the same function, are derived from and are equivalent to the sequences of this invention.

[0036] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein constituting the amino acid sequence shown in Sequence 1 or Sequence 4 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0037] The expression cassette refers to DNA capable of expressing APP-A1 and / or APP-B1 proteins in host cells. This DNA may include promoters that initiate APP-A1 and / or APP-B1 transcription, as well as terminators that terminate APP-A1 and / or APP-B1 transcription. Furthermore, the expression cassette may also include enhancer sequences.

[0038] The vector may be a plasmid, granule, bacteriophage, or viral vector.

[0039] The microorganism may be yeast, bacteria, algae or fungi; the bacteria may be Agrobacterium.

[0040] In the above applications, the regulation of plant yield is manifested in the regulation of plant seed weight (e.g., 100-seed weight).

[0041] The regulation of plant seed size is manifested in the regulation of plant grain width and / or thickness.

[0042] The regulation of plant photosynthetic efficiency is reflected in the regulation of plant chlorophyll content and / or photosynthetic rate.

[0043] The regulation of plant seed protein content aims to increase the protein content of plant grains.

[0044] In the above applications, the regulation is to reduce, specifically manifested as follows: when the APP-A1 protein content or APP-A1 gene expression level in wheat increases, wheat yield and photosynthetic efficiency decrease, grains become smaller, and grain protein content decreases.

[0045] Secondly, the present invention protects novel uses of substances that inhibit the aforementioned aspartic protease 1.

[0046] This invention protects the use of the substance that inhibits the above-mentioned aspartic protease 1 in any of the following (d1)-(d6):

[0047] (d1) Increase plant yield;

[0048] (d2) Makes plant seeds larger;

[0049] (d3) Promotes plant photosynthesis;

[0050] (d4) Promotes protein accumulation in plant seeds;

[0051] (d5) Breeding transgenic plants with increased yield and / or increased photosynthetic efficiency and / or larger seeds and / or increased seed protein content;

[0052] (d6) Plant breeding.

[0053] In the above applications, increasing plant yield is manifested as increasing the weight of plant seeds (e.g., the weight of 100 seeds).

[0054] The enlargement of plant seeds is manifested in increasing the width and / or thickness of the plant grains.

[0055] The promotion of plant photosynthesis is manifested in increasing the chlorophyll content and / or photosynthetic rate of plants.

[0056] In the above applications, the substance that inhibits the aspartic protease 1 may be a substance that inhibits the activity of the aspartic protease 1, a substance that inhibits the expression of the gene encoding the aspartic protease 1, or a substance that knocks out the gene encoding the aspartic protease 1.

[0057] The substance that inhibits the activity of the aforementioned aspartic protease 1 can be any substance that can cause the loss of the activity of the aforementioned aspartic protease 1 in plants, such as proteins, polypeptides or small molecule compounds (e.g., protein activity inhibitors) that inhibit the synthesis of the aforementioned aspartic protease 1, promote the degradation of the aforementioned aspartic protease 1 or inhibit the function of the aforementioned aspartic protease 1.

[0058] The substance that inhibits the expression of the gene encoding the above-mentioned aspartic protease 1 can be any substance that can prevent the expression of the gene encoding the above-mentioned aspartic protease 1 in plants, such as substances that silence the gene encoding the above-mentioned aspartic protease 1 in plants (such as miRNA, siRNA, dsRNA, shRNA, etc.).

[0059] The knockout means that the host cell carrying the knockout substance does not produce the functional protein product of the gene. The knockout substance can be any substance that prevents the host cell from producing the functional protein product of the gene, such as removing all or part of the coding gene sequence, introducing frameshift mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent the coding gene sequence from being transcribed, or blocking translation by binding to mRNA. Typically, knockout is performed at the genomic DNA level, so that the cell's offspring also permanently carry the knockout. Furthermore, the substance that knocks out the gene encoding the aforementioned aspartic protease 1 can be any substance capable of causing mutations in the gene encoding the aforementioned aspartic protease 1 in plants (the mutations can be deletion mutations and / or insertion mutations and / or base substitutions) thereby rendering it inactive, such as zinc finger protein (ZFN) gene editing systems, TALENs gene editing systems, CRISPR / Cas9 gene editing systems, or EMS mutagens.

[0060] Thirdly, the present invention protects a method for cultivating transgenic plants with reduced yield and / or reduced photosynthetic efficiency and / or smaller seeds and / or reduced seed protein content.

[0061] The method for cultivating transgenic plants with reduced yield and / or reduced photosynthetic efficiency and / or smaller seeds and / or reduced seed protein content, protected by this invention, includes the step of increasing the activity and / or content of the aforementioned aspartic protease 1 in the recipient plant to obtain the transgenic plant; wherein the yield and / or photosynthetic efficiency and / or seed size and / or seed protein content of the transgenic plant are less than those of the recipient plant.

[0062] In the above method, the yield of the transgenic plant being less than that of the recipient plant is specifically manifested in the fact that the weight of 100 seeds of the transgenic plant is less than that of the recipient plant.

[0063] The photosynthetic efficiency of the transgenic plant is lower than that of the recipient plant, specifically manifested in the fact that the chlorophyll content and photosynthetic rate of the transgenic plant are lower than those of the recipient plant.

[0064] The transgenic plant's seeds are smaller than the recipient plant's seeds, specifically in that the width and thickness of the transgenic plant's seeds are smaller than those of the recipient plant.

[0065] In the above method, the method of increasing the activity and / or content of the above-mentioned aspartic protease 1 in the recipient plant may be to overexpress the above-mentioned aspartic protease 1 in the recipient plant.

[0066] Furthermore, the overexpression method involves introducing the encoding gene of aspartic protease 1 into a recipient plant. The encoding gene sequence of aspartic protease 1 is shown in Sequence 3.

[0067] Furthermore, the gene encoding aspartic protease 1 was introduced into recipient plants via the recombinant vector pGWB18-Ubi::APP-A1 to obtain transgenic plants overexpressing aspartic protease 1.

[0068] The method for increasing the activity and / or content of the above-mentioned aspartic protease 1 in the recipient plant may also be to hybridize the aspartic protease 1 mutant with the above-mentioned transgenic plant overexpressing aspartic protease 1, so that the aspartic protease 1 mutant obtains the encoding gene of aspartic protease 1.

[0069] Furthermore, the aspartic protease 1 mutant may specifically be the wheat mutant app-A1.

[0070] Furthermore, the method also includes the step of screening hybrid offspring containing the aspartic protease 1 mutant gene.

[0071] Fourthly, this invention protects a method for cultivating transgenic plants with increased yield and / or increased photosynthetic efficiency and / or larger seeds and / or increased seed protein content.

[0072] The method for cultivating transgenic plants with increased yield and / or increased photosynthetic efficiency and / or larger seeds and / or higher seed protein content, protected by this invention, includes the step of reducing the activity and / or content of the aforementioned aspartic protease 1 in the recipient plant to obtain the transgenic plant; wherein the yield and / or photosynthetic efficiency and / or seed size and / or seed protein content of the transgenic plant are greater than those of the recipient plant.

[0073] In the above method, the yield of the transgenic plant is greater than that of the recipient plant, specifically manifested in the fact that the weight of 100 grains of the transgenic plant is greater than that of the recipient plant.

[0074] The photosynthetic efficiency of the transgenic plant is greater than that of the recipient plant, specifically manifested in the chlorophyll content and photosynthetic rate of the transgenic plant being greater than those of the recipient plant.

[0075] The transgenic plant's seeds are larger than the recipient plant's seeds, specifically in that the width and thickness of the transgenic plant's seeds are greater than those of the recipient plant.

[0076] In the above method, the method for reducing the activity and / or content of the above-mentioned aspartic protease 1 in the recipient plant may be to introduce the above-mentioned substance that inhibits aspartic protease 1 into the recipient plant.

[0077] Furthermore, the substance that inhibits aspartic protease 1 may be an EMS inducer.

[0078] Furthermore, the transgenic plant may specifically be a wheat mutant app-A1, app-B1, or app1.

[0079] The method for reducing the activity and / or content of the above-mentioned aspartic protease 1 in the recipient plant can also be to hybridize the recipient plant with the above-mentioned aspartic protease 1 mutant.

[0080] Furthermore, the recipient plant may be a transgenic plant that overexpresses aspartic protease 1; the aspartic protease 1 mutant may be the wheat mutant app-A1.

[0081] Furthermore, the method also includes the step of screening hybrid offspring containing the aspartic protease 1 mutant gene.

[0082] In any of the methods or applications described above, the plant may be a monocotyledonous plant or a dicotyledonous plant, and the monocotyledonous plant may specifically be a grass plant; the grass plant may specifically be wheat; the wheat may specifically be wild-type wheat Kronos or wheat mutant app-A1 or wheat mutant app-B1 or wheat mutant app1 or the above-mentioned transgenic plants that overexpress aspartic protease 1.

[0083] The wheat mutant app-A1 differs from the wild-type wheat Kronos sequence only in that the APP-A1 gene sequence (Sequence 3) encoding position APP-A1 is mutated from G to A at position 675.

[0084] The wheat mutant app-B1 differs from the wild-type wheat Kronos sequence only in that the APP-B1 gene sequence (sequence 6) encoding the wheat B genome is mutated from G to A at position 836, and an intron sequence is inserted between positions 836 and 837. The inserted intron sequence is as follows: TACTGAACGGTTATCTTGATGTTAAAATCTTAATGCGGTTAAATCTGAATTATCTTACG TGTGTTCACACCTAAGTCATTCTCAGG.

[0085] The wheat mutant app1 differs from the wild-type wheat Kronos sequence only in that: at position 675 of the APP-A1 gene sequence (Sequence 3) on the wheat A genome, G is mutated to A, and at position 836 of the APP-B1 gene sequence (Sequence 6) on the wheat B genome, G is mutated to A, and an intron sequence is inserted between positions 836 and 837 of the APP-B1 gene sequence (Sequence 6) on the wheat B genome. The inserted intron sequence is as follows: TACTGAACGGTTATCTTGATGTTAAAATCTTAATGCGGTTAAATCTGAATTATCTTACG TGTGTTCACACCTAAGTCATTCTCAGG.

[0086] Fifthly, this invention protects novel uses of substances for detecting whether the wheat APP-A1 gene to be tested is a HapI haplotype or a HapII haplotype.

[0087] This invention protects the application of a substance for detecting whether the wheat APP-A1 gene is haplotype HapI or HapII in the identification of wheat yield and / or grain size and / or photosynthetic efficiency.

[0088] The HapI haplotype is the genotype where position 3960 of the APP-A1 gene is A;

[0089] The HapII haplotype is the genotype where the APP-A1 gene has a G at position 3960.

[0090] Sixthly, the present invention protects a method for identifying or assisting in the identification of wheat yield, grain size, or photosynthetic efficiency.

[0091] The method for identifying or assisting in identifying wheat yield, grain size, or photosynthetic efficiency provided by this invention includes the following steps: detecting whether the APP-A1 gene of the wheat to be tested is a HapI haplotype or a HapII haplotype: wheat with the APP-A1 gene being a HapII haplotype has a higher yield, grain size, or photosynthetic efficiency than wheat with the APP-A1 gene being a HapI haplotype.

[0092] Seventhly, the present invention protects a method for screening or assisting in screening wheat varieties with high yield and / or large grains and / or high photosynthetic efficiency.

[0093] The method for screening or assisting in screening wheat varieties with high yield and / or large grains and / or high photosynthetic efficiency protected by this invention includes the step of selecting wheat varieties with the APP-A1 gene as the HapII haplotype.

[0094] In the above methods or applications, the APP-A1 gene being a HapI haplotype or a HapII haplotype means that the APP-A1 gene on both homologous chromosomes of wheat is either a HapI haplotype or a HapII haplotype.

[0095] In the above methods or applications, the wheat with haplotype HapI can specifically be wheat varieties such as Jing 411, Jingdong 6, Zhou 8425B, Zhengmai 9023, Hengguan 35, Xinong 979, Jimai 30, Yanzhan 1, Mexipak 66 (Moba 66) or Yumai 17, as well as the hybrid offspring population (recombinant self-pollinated population) of Zhengmai 9023 and Yangmai 5.

[0096] The wheat with haplotype HapII can specifically be the hybrid offspring population (recombinant self-pollination population) of Yangmai 158, Fan 6, Yannong 19, Pingyuan 50, Yangmai 5, Zhongguochun, Shuilizhan, Zhengmai 366, Jinmai 8 or Jimai 38, as well as Zhengmai 9023 and Yangmai 5.

[0097] This invention first isolated a mutant, app-A1, from a tetraploid wheat EMS mutant library, characterized by enhanced photosynthesis, larger grains, and increased grain weight. A premature termination mutation of aspartic protease 1A (APP-A1), co-segregating with the phenotype, was detected. Furthermore, the splicing mutant app-B1 and the double mutant app1 of aspartic protease 1B (APP-B1), homologous to aspartic protease 1A, were also found to enhance photosynthesis, resulting in larger grains, increased grain weight, and higher protein content. Conversely, overexpression of APP-A1 accelerated leaf senescence and reverted to the app-A1 phenotype. In addition, this invention discovered a SNP site in the APP-A1 gene associated with photosynthesis and grain development in natural wheat populations, and natural variations in the APP-A1 gene can promote photosynthesis and grain development. These results demonstrate that APP1 plays a negative regulatory role in wheat photosynthesis, yield, and protein content. This invention is of great significance for the breeding and screening of wheat varieties with enhanced photosynthesis, high yield, and high protein content. Attached Figure Description

[0098] Figure 1The effects of APP1 loss of function on wheat photosynthesis, yield, and protein content. a. Phenotypes of WT, app-A1, app-B1, and app1. b. Endogenous APP1 protein content in WT, app-A1, app-B1, and app1. c. Total aspartic protease activity in WT, app-A1, app-B1, and app1. N=4. d. Protein content determination in WT, app-A1, app-B1, and app1. ef. Chlorophyll content and photosynthetic rate (net CO2 assimilation rate) in WT, app-A1, app-B1, and app1. g. Grain phenotypes of WT, app-A1, app-B1, and app1. hk. Mean weight (100-grain weight), length, width, and thickness of grains in WT, app-A1, app-B1, and app1. Data are presented as mean ± SD, and p-values ​​are expressed using two-tailed unpaired t-tests. N=4(c); N=10(e,f); N=8(h); N=25(ik).

[0099] Figure 2 To accelerate leaf senescence and revert to the app-A1 phenotype through APP-A1 overexpression. a. Premature senescence phenotype of plants and flag leaves in WT, app-A1, and APP-A1 OE transgenic lines. b. Content of endogenous APP1 protein in WT, app-A1, and APP-A1 OE transgenic lines. c. Identification of APP-A1 OE transgenic lines. de. Chlorophyll content and photosynthetic rate (net CO2 assimilation rate) in WT, app-A1, and APP-A1 OE transgenic lines. f. Grain phenotype of WT, app-A1, and APP-A1 OE transgenic lines. gj. Mean weight (100-grain weight), length, width, and thickness of grains in WT, app-A1, and APP-A1 OE transgenic lines. kl. Senescence phenotype and endogenous APP1 protein content in WT, app-A1, and APP-A1 OE / APP-A1 complementary lines. Comparison of total chlorophyll content and photosynthetic rate (net CO2 assimilation rate) in the mn.WT, app-A1, and APP-A1 OE / APP-A1 complementary lines. o. Grain phenotypes of the o.WT, app-A1, and APP-A1 OE / APP-A1 complementary lines. ps. Mean weight (100-grain weight), length, width, and thickness of grains in the o.WT, app-A1, and APP-A1 OE / APP-A1 complementary lines. Data are presented as mean ± SD, and p-values ​​are expressed using two-tailed unpaired t-tests. N = 10(d, e, m, n); N = 8(g, p); N = 25(hj, qs).

[0100] Figure 3To simulate the natural variation of APP-A1 to enhance CO2 assimilation efficiency and promote grain development in the APP-A1 mutant. a. Predicted protein structures of APP-A1 in haplotypes APP-A1 HapI and APP-A1 HapII. Note: * indicates differentially expressed parts in the predicted structures. be. 100-grain weight, length, width, and thickness of grains in haplotypes APP-A1 HapI and APP-A1 HapII. N = 10. f. Yield of haplotypes APP-A1 HapI and APP-A1 HapII. N = 10. gj. Leaf senescence process, endogenous APP1 protein content, chlorophyll content, and photosynthetic rate (net CO2 assimilation rate) were studied using the parental varieties YM5 (APP-A1 HapI) and ZM9023 (APP-A1 HAPII) as controls. N = 9 (i, j). k. Grain phenotypes of the parents and their segregating populations (recombinant self-pollination populations). 10. 100-kernel weight, length, width, and thickness of grains from the segregating populations (recombinant self-pollinating populations) of haplotypes APP-A1 HapI and APP-A1 HapII. Data are expressed as mean ± SD, and p-values ​​are expressed using two-tailed unpaired t-tests. N = 10(1), N = 25(mo). Detailed Implementation

[0101] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0102] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0103] The tetraploid durum wheat (Kronos) in the following examples is described in the literature "Krasileva, KV, et al. (2017). Uncovering hidden variation in polyploid wheat." Proceedings of the National Academy of Sciences 114(6):E913-E921."

[0104] The following examples of wheat varieties, including Jing 411, Jingdong 6, Zhou 8425B, Zhengmai 9023, Hengguan 35, Xinong 979, Jimai 30, Yanzhan 1, Mexipak 66, Yumai 17, Yangmai 158, Fan 6, Yannong 19, Pingyuan 50, Yangmai 5, Zhongguochun, Shuilizhan, Zhengmai 366, Jinmai 8, and Jimai 38, are all described in the literature “Hao, CY, et al. (2020). Resequencing of 145 Landmark Cultivars Reveals Asymmetric Sub-genome Selection and StrongFounder Genotype Effects on Wheat Breeding in China. Molecular Plant, 2020, 7; 13(12): 1733-1751.”

[0105] Example 1: Cloning of the wheat APP1 gene

[0106] 1. RNA extraction

[0107] RNA was extracted from the leaves of tetraploid durum wheat (Kronos).

[0108] 2. Obtaining cDNA

[0109] Using the RNA obtained in step 1 as a template, cDNA was obtained by reverse transcription.

[0110] 3. PCR amplification

[0111] Using the cDNA obtained in step 2 as a template, PCR amplification was performed using primers APP1-A1-F: 5′-ATGGGAACCCGCGGACTC-3′ and APP1-A1-R: 5′-GGCCGCCTTGGCGAATCC-3′. The amplified products were detected by 1% agarose gel electrophoresis and then sent for sequencing. The sequencing results showed that the PCR amplification yielded an amplified product of 1530 bp, and its nucleotide sequence is shown in Sequence 3 of the sequence listing. The gene shown in Sequence 3 was named the APP-A1 gene. The APP-A1 gene encodes the protein shown in Sequence 1 of the sequence listing, and the amino acid sequence shown in Sequence 1 was named as aspartic protease 1 (APP-A1).

[0112] Using the cDNA obtained in step 2 as a template, PCR amplification was performed using primers APP1-B1-F: 5′-ATGGGAACCCGCGGG-3′ and APP1-B1-R: 5′-GGCCGCCTTGGCGAAG-3′. The amplified products were detected by 1% agarose gel electrophoresis and then sent for sequencing. The sequencing results showed that the PCR amplification yielded an amplified product of 1530 bp, and its nucleotide sequence is shown in sequence 6 of the sequence listing. The gene shown in sequence 6 was named the APP-B1 gene. The APP-B1 gene encodes the protein shown in sequence 4 of the sequence listing, and the amino acid sequence shown in sequence 4 was named as aspartic protease 1 (APP-B1).

[0113] Example 2: Obtaining and Detecting the Attributes of the Wheat APP1 Mutant

[0114] I. Obtaining and Sequence Analysis of the Wheat APP1 Mutant

[0115] 1. Obtaining and sequence analysis of the wheat app1 mutant

[0116] Wheat mutant app-A1: A mutant with stunted green growth and larger grains was screened from an EMS-induced mutant library (described in the literature "Wang, CY, et al. (2020). Isolation of wheat mutants with higher grain phenolics to enhance antioxidant potential. Food Chem 303:125363."). After backcrossing this mutant for 3 generations, transcriptome sequencing was performed on plants with extreme phenotypes, namely stunted green plants and non-stunted green plants. Homozygous SNP missense mutations were analyzed, and it was found that the stunted green plants had a premature termination mutation in the gene encoding aspartic protease 1 in the A genome. This mutant was named app-A1.

[0117] The wheat mutant app-B1 was purchased from the College of Agriculture, Shandong Agricultural University (specific mutation information can be found on the following website: https: / / plants.ensembl.org / , number Kronos3321.chr1B.658529380). After two generations of backcrossing to remove background, homozygous mutant lines were screened and named app-B1.

[0118] Wheat mutant app1: The app-A1 homozygous mutant line and the app-B1 homozygous mutant line were hybridized, and the line with homozygous mutations in both the A and B genomes was identified by PCR and named app1.

[0119] Compared to the wild-type wheat Kronos sequence, the wheat mutant app-A1 differs only in that the APP-A1 gene sequence (Sequence 3) encoding position 675 is mutated from G to A, causing position 225 of the amino acid sequence (Sequence 1) to change from W to premature termination.

[0120] Compared to the wild-type wheat Kronos sequence, the wheat mutant app-B1 differs only in that: at position 836 of the APP-B1 gene sequence (Sequence 6) on the wheat B genome, G is mutated to A, and an intron sequence is inserted between positions 836 and 837. The inserted intron sequence is as follows: TACTGAACGGTTATCTTGATGTTAAAATCTTAATGCGGTTAAATCTGAATTATCTTACG TGTGTTCACACCTAAGTCATTCTCAGG. According to the original reading frame, transcription stops at the stop codon of the intron sequence, causing premature termination of protein translation.

[0121] Compared to the wild-type wheat Kronos sequence, the wheat mutant app1 differs only in that: at position 675 of the APP-A1 gene sequence (Sequence 3) on the wheat A genome, a G mutation is made to A; and at position 836 of the APP-B1 gene sequence (Sequence 6) on the wheat B genome, a G mutation is made to A; and an intron sequence is inserted between positions 836 and 837 of the APP-B1 gene sequence (Sequence 6) on the wheat B genome. The inserted intron sequence is as follows: TACTGAACGGTTATCTTGATGTTAAAATCTTAATGCGGTTAAATCTGAATTATCTTACG TGTGTTCACACCTAAGTCATTCTCAGG.

[0122] 2. Detection of APP1 protein expression level

[0123] The expression levels of APP1 protein in wild-type wheat Kronos and its mutants app-A1, app-B1, and app1 were detected. The specific steps were as follows: A steel ball was placed in a 2 mL centrifuge tube beforehand. A suitable amount of wheat leaves was cut and placed in the centrifuge tube, which was then quickly placed in liquid nitrogen. The sample was then ground using a high-throughput tissue homogenizer at 60 Hz for 60 s, repeated once, until the wheat leaves were ground into powder. An equal volume of plant protein extraction buffer was added, along with a protease inhibitor, and the mixture was incubated on ice for 40 min. Subsequently, the mixture was centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was collected. This process was repeated once. The supernatant contained the total bioactive plant protein. Protein translation level identification was then performed. The results showed that the expression level of endogenous APP1 protein was significantly decreased in the mutants app-A1, app-B1, and app1. Figure 1b).

[0124] II. Phenotypic Analysis of the app1 Mutant

[0125] Wild-type wheat Kronos and wheat mutants app-A1, app-B1, and app1 were used as test materials. During the grain-filling stage, leaf phenotype was observed, aspartic protease activity in leaves was detected, protein content in grains was measured using a near-infrared spectroscopy instrument, total chlorophyll content in leaves was measured using a handheld SPAD chlorophyll meter, photosynthetic rate was measured using a LI6400 photosynthesis system, grain phenotype was observed, and grain weight, length, width, and thickness were measured.

[0126] The detection procedure for aspartic protease activity is as follows: N-Acetyl-Asp-Glu-Val-Asp p-nitroanilide was selected as the substrate for aspartic protease. The substrate solution was prepared using NaOAc at pH 3.5, with a final concentration of 125 mM. In a 96-well microplate, 74 μL of plant protein extraction buffer was added, followed by 18 μL (approximately 25 μg) of plant active protein, and finally 8 μL of the substrate solution. The plate was incubated at 37℃ using a microplate reader with kinetic cycles of 1 min / cycle for 80 min. The product absorption peak was measured at 405 nm.

[0127] The results showed that mutants app-A1, app-B1, and app1 exhibited a delayed greening phenotype during the grain-filling stage. Figure 1 a). The activity of aspartic protease in mutants app-A1, app-B1, and app1 was significantly reduced ( Figure 1 c). Near-infrared spectroscopy was used to measure the protein content in wheat grains. The results showed that compared to wild-type wheat grains, the total protein content in app-A1 wheat grains increased by 0.045%, in app-B1 wheat grains by 0.8795%, and in app1 wheat grains by 0.9918%. Figure 1 d). Measurements using a handheld SPAD chlorophyll meter revealed that the total chlorophyll content of the mutant was significantly higher than that of the WT. Figure 1 e). Using a LI6400 photosynthesis system to measure photosynthetic rates, it was found that the accumulation of the photosystem supercomplex and chlorophyll led to a significant increase in photosynthetic rates (13%–25%) in all mutants. Figure 1 f). In each mutant, prolonged photosynthetic time and increased photosynthetic efficiency increased the amount of source, which in turn increased the amount of sink, thereby increasing the grain size. Figure 1 g). app-B1 and app1 significantly increased particle weight, similar to app-A1 ( Figure 1 h). Regarding kernel length, unlike app-A1, app-B1 produces longer kernels, while app1 further increases ( Figure 1i). Regarding kernel width and thickness, app-A1, app-B1, and app1 all showed significant increases (i). Figure 1 The above data indicate that loss of function of the APP1 homolog also enhances photosynthesis and increases grain weight, supporting the genetic correlation between the APP-A1 mutation and the app-A1 phenotype.

[0128] Example 3: Obtaining and Detecting Traits of APP-A1 Transgenic Wheat

[0129] I. Obtaining A1 Wheat via APP

[0130] 1. Construction of the recombinant vector pGWB18-Ubi::APP-A1

[0131] The APP-A1 cDNA sequence shown in Sequence 3 was ligated into the pDONR207 vector (invitrogen CAT#:12535035) using the Gateway method to obtain the recombinant vector pDONR207-APP-A1, which was then sequenced for verification. Sequencing results showed that the APP-A1 gene had no point mutations.

[0132] The recombinant vector pDONR207-APP-A1, the pGWB18 vector (NCBI: txid419562), and the recombinase (Cat. No. 11789100, ThermoFisher Scientific) were mixed and incubated at 25°C for 1 hour. This allowed the APP-A1 gene, as shown in sequence 3, to be recombined between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector, resulting in the recombinant vector pGWB18-Ubi::APP-A1. The recombinant vector pGWB18-Ubi::APP-A1 expresses aspartic protease 1.

[0133] 2. Obtaining recombinant bacteria

[0134] The recombinant vector pGWB18-Ubi::APP-A1 was transformed into Agrobacterium EHA105 (CAT#:AC1010, Weidi Biotechnology) to obtain the recombinant strain pGWB18-Ubi::APP-A1 / EHA105.

[0135] 3. Obtaining A1 wheat via APP

[0136] Kronos, a tetraploid spring wheat variety with good growth status, was selected as the recipient. Genetic transformation was carried out by embryo removal. After infection and differentiation with Agrobacterium pGWB18-Ubi::APP-A1, the transformed wheat lines were screened to obtain APP-A1 wheat lines.

[0137] 4. PCR identification

[0138] Transgenic wheat lines of APP-A1 were identified using primers APP-A1-OE-F1: 5′-TGGGGTAGTCAGCCAAGAGT-3′ and APP-A1-R1: 5′-GCATCCACACAACAGCCATC-3′. The results showed that the wild type exhibited a single band, while the transgenic wheat line 1... # and 2 # Both are double bands, with the additional band representing the inserted cDNA. Figure 2 c).

[0139] II. Phenotypic Analysis of APP-A1 Wheat

[0140] Wild-type wheat Kronos and the transgenic APP-A1 wheat line APP-A1 OE(1) # and 2 # The test material was used to observe leaf phenotype during the grain filling period, measure the total chlorophyll content in the leaves using a handheld SPAD chlorophyll meter, measure the photosynthetic rate using a LI6400 photosynthesis meter, observe grain phenotype, and measure grain weight, length, width, and thickness.

[0141] Leaf phenotype observations during the grain-filling stage revealed that the APP-A1 OE wheat line, converted to APP-A1, exhibited a premature senescence phenotype. Figure 2 a). In the APP-A1 wheat line APP-A1 OE, the APP1 protein content consistently accumulated at a high level ( Figure 2 b). Due to the negative regulation of senescence by APP-A1, the chlorophyll content of the APP-A1 OE wheat line was lower. Figure 2 d) The photosynthetic rate is 9-20% lower than that of WT, which is significantly reduced. Figure 2 e). Decreased photosynthetic characteristics directly affect the grain size of the APP-A1 transgenic wheat line APP-A1 OE. Due to limited sources, the APP-A1 transgenic wheat line APP-A1 OE produces smaller grains (e). Figure 2 f). The average grain weight of the APP-A1 OE wheat line was lower ( Figure 2 g). The average grain length of the APP-A1 OE wheat line was not different from that of the WT line. Figure 2 h), the average grain width and thickness were significantly reduced ( Figure 2 ij).

[0142] III. Establishment and phenotypic analysis of the reintroduced strains APP-A1 / app-A1

[0143] The APP-A1 OE1 wheat line was converted to APP-A1. # And the APP-A1 wheat line APP-A1 OE 2 # The APP-A1 mutant was crossed with the progeny. In the offspring, a mutation was performed at position 2221 of sequence 2, changing from G to A. PCR amplification using primers APP-A1-1806F: 5′-CACTGGTAGCTGCAAGGACA-3′ and APP-A1-2615R: 5′-ATCACAACATACCGTGGGAC-3′ yielded a progeny of 810 bp. This progeny is the complemented line APP-A1 / app-A1, resulting in the complemented line APP-A1 / app-A1 1. # And the reinjected strain APP-A1 / app-A1 2 # .

[0144] Using wild-type wheat Kronos, app-A1 mutants, and the reinjected line APP-A1 / app-A1 1 # , Replenishment of strain APP-A1 / app-A1 2 # As test materials, leaf phenotype was observed during the grain filling period, total chlorophyll content in leaves was measured using a handheld SPAD chlorophyll meter, photosynthetic rate was measured using a LI6400 photosynthesis meter, grain phenotype was observed, and grain weight, length, width and thickness were measured.

[0145] The results showed that the APP-A1 OE event restored the hysteresis phenotype of the app-A1 mutant. Figure 2 k), which is consistent with the changes in APP1 protein content (k), Figure 2 l). Compared with WT, the increase in APP1 protein content increased chlorophyll content and photosynthetic rate (l). Figure 2 Furthermore, the APP-A1 OE event demonstrated perfect genetic complementation of the app-A1 mutant grain phenotype (mn). Figure 2 o), including grain weight, length, width, and thickness ( Figure 2 (ps). The genetic data above all demonstrate that APP-A1 is negatively correlated with wheat photosynthetic rate and grain weight.

[0146] Example 4: Natural variants similar to app-A1 can promote photosynthesis and grain weight.

[0147] 1. Obtaining APP-A1 HapI and APP-A1 HapII haplotypes

[0148] The haplotypes of APP-A1 were queried using the Wheat Genome Union Database (http: / / wheat.cau.edu.cn / WheatUnion / ). The results showed that the APP-A1 gene in natural varieties contains a single SNP site (position 3960 of sequence 2). Based on the different SNP sites, the APP-A1 gene can be divided into two haplotypes: the genotype with position A at position 3960 of the APP-A1 gene (sequence 2) is defined as haplotype APP-A1 HapI, and the genotype with position G at position 3960 of the APP-A1 gene (sequence 2) is defined as haplotype APP-A1 HapII. The nucleotide sequence of haplotype APP-A1 HapI is shown in sequence 2, and its encoded protein has a serine residue at position 442. The nucleotide sequence of haplotype APP-A1 HapII is obtained by mutating position 3960 of sequence 2 from A to G. This mutation results in a change from serine to glycine at position 442 of the amino acid sequence encoding the protein. Using a protein structure prediction website, protein structure was predicted, and it was found that mutations at amino acid sites altered a helix in the APP1 protein structure. Figure 3 a).

[0149] 2. Correlation analysis between APP-A1 HapI and APP-A1 HapII haplotypes and grain development

[0150] Ten wheat varieties with the APP-A1 gene haplotype APP-A1 HapI were used as test materials: Jing 411, Jingdong 6, Zhou 8425B, Zhengmai 9023, Hengguan 35, Xinong 979, Jimai 30, Yanzhan 1, Mexipak 66 (Moba 66), and Yumai 17. Ten wheat varieties with the APP-A1 gene haplotype APP-A1 HapII were used as test materials: Yangmai 158, Fan 6, Yannong 19, Pingyuan 50, Yangmai 5, Zhongguochun, Shuilizhan, Zhengmai 366, Jinmai 8, and Jimai 38. Each variety was propagated with one grain and planted in a single row under completely randomized field conditions. Grains were harvested at maturity, and grain weight, length, width, and thickness were measured.

[0151] The results showed that compared with wheat varieties with haplotype APP-A1 HapI, wheat varieties with haplotype APP-A1 HapII had significantly increased grain weight, length, width, and thickness. Figure 3 In field trials, wheat varieties with haplotype APP-A1HapII yielded higher yields than those with haplotype APP-A1 HapI. Figure 3 f). The above data indicate a potential positive correlation between haplotype APP-A1 HapII and grain development.

[0152] 3. Genetic analysis of APP-A1 HapI and APP-A1 HapII haplotypes

[0153] Genetic analysis was conducted using wheat varieties with haplotype APP-A1 HapII (Zhengmai 9023, ZM9023) and haplotype APP-A1 HapI (Yangmai 5, YM5) as test materials. Leaf phenotype was observed during the grain-filling stage, total chlorophyll content in leaves was measured using a handheld SPAD chlorophyll meter, photosynthetic rate was measured using a LI6400 photosynthesis system, grain phenotype was observed, and grain weight, length, width, and thickness were measured.

[0154] The results showed that, compared with YM, ZM9023 exhibited a phenotype of overall chlorosis; while the flag leaves of YM5 turned yellow, the flag leaves of ZM9023 remained very green. Figure 3 g). ZM9023 flag leaf accumulates less APP1 protein ( Figure 3 This result is consistent with the reduction in APP1 protein in the mutant. ZM9023 accumulated more chlorophyll (h), which is consistent with the reduction in APP1 protein in the mutant. Figure 3 i), and has a higher photosynthetic rate than YM5 ( Figure 3 j).

[0155] Using ZM9023 and YM5 as parents, recombinant inbred lines populations (RILs) were prepared. Two recombinant inbred lines populations were selected and designated as 1 and 2, respectively. PCR identification was performed using primers APP-A1-3048F: 5′-TTTATCACTGGTTCTCTCTTCTTTGC-3′ and APP-A1-4328R: 5′-GTTTATAGCATGCCGGGGATTTCA-3′. Homozygous lines with haplotype APP-A1 HapII and APP-A1 HapI were obtained from recombinant inbred lines 1 and 2, respectively.

[0156] The results showed that in recombinant self-pollination populations 1 and 2, homozygous lines with haplotype APP-A1 HapII produced larger grains than homozygous lines with haplotype APP-A1 HapI. Figure 3 k) Particle weight increased significantly ( Figure 3 The increase in grain weight mentioned above comes from the increase in grain width and thickness, rather than the increase in grain length. Figure 3 The above trends are similar to those observed in natural populations. Therefore, the haplotype APP-A1 HapII caused by the above SNP mutation mimics the APP1 dysfunction induced by EMS mutagenesis, and the haplotype APP-A1 HapII has great potential in wheat breeding.

Claims

1. Application of reducing wheat aspartic protease 1 activity and / or content in any of the following 1)-4): 1) Increase wheat yield; 2) To make wheat seeds larger; 3) Promotes wheat photosynthesis; 4) High-yield wheat breeding; The aspartic protease 1 is APP-A1 protein and / or APP-B1 protein; The APP-A1 protein is any one of the proteins described in (a1)-(a2) below: (a1) The protein shown in sequence 1 of the sequence listing; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); The APP-B1 protein is any one of the proteins described in (b1)-(b2) below: (b1) The protein shown in sequence 4 of the sequence listing; (b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (b1).

2. Use according to claim 1, characterized in that: The increase in wheat yield is reflected in the increase in wheat grain weight; The process of increasing the size of wheat seeds is manifested in the regulation of wheat grain length and / or width and / or thickness. The promotion of wheat photosynthesis is manifested in the regulation of wheat chlorophyll content and / or photosynthetic rate.

3. A method for breeding transgenic wheat with increased yield and / or increased photosynthetic efficiency and / or larger seeds, comprising the step of reducing the activity and / or content of aspartic protease 1 as described in claim 1 in recipient wheat to obtain transgenic wheat; wherein the yield and / or photosynthetic efficiency and / or seed size of the transgenic wheat is greater than that of the recipient wheat.

4. Application of substances that detect whether the wheat APP-A1 gene is haplotype HapI or HapII in the identification of wheat yield and / or grain size and / or photosynthetic efficiency; The HapI haplotype is the genotype where position 3960 of the APP-A1 gene is A; The HapII haplotype is the genotype where the APP-A1 gene has a G at position 3960; the HapI haplotype or HapII haplotype refers to the APP-A1 gene on both homologous chromosomes of wheat being either the HapI haplotype or the HapII haplotype. The APP-A1 gene sequence is shown in Sequence 2.

5. A method for identifying or assisting in the identification of wheat yield, grain size, or photosynthetic efficiency, comprising the following steps: detecting whether the APP-A1 gene of the wheat to be tested is haplotype HapI or HapII: ​​wheat with the APP-A1 gene haplotype HapII has higher yield, grain size, or photosynthetic efficiency than wheat with the APP-A1 gene haplotype HapI; wherein the HapI haplotype is the genotype where position 3960 of the APP-A1 gene is A; The HapII haplotype is the genotype where position 3960 of the APP-A1 gene is G; the HapI haplotype or HapII haplotype refers to the APP-A1 gene on both homologous chromosomes of wheat being either the HapI haplotype or the HapII haplotype; the APP-A1 gene sequence is shown in Sequence 2.

6. A method for screening or assisting in screening wheat varieties with high yield and / or large grains and / or high photosynthetic efficiency, comprising the step of selecting wheat varieties whose APP-A1 gene is of the HapII haplotype; wherein the HapII haplotype is the genotype of the APP-A1 gene with G at position 3960; wherein the HapII haplotype refers to the APP-A1 gene on both homologous chromosomes of wheat being of the HapII haplotype; wherein the APP-A1 gene sequence is shown in Sequence 2.

Images