Molecular marker co-segregated with cucumber sulfur tolerance gene St and application thereof

By developing the molecular marker InDel-St for the cucumber sulfur tolerance gene St, the problem of varying tolerance to sulfur fumigation in cucumbers was solved, enabling rapid screening of cucumber seedlings, improving breeding efficiency, and promoting the application of sulfur fumigation in greenhouse cultivation.

CN116536443BActive Publication Date: 2026-03-20SHANXI AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-03
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

In existing technologies, cucumbers exhibit significant differences in their tolerance to sulfur fumigation, which limits the widespread application of sulfur fumigation sterilization in greenhouse cucumber production. There is also a lack of clearly defined sulfur tolerance regulatory genes and molecular markers that can be directly applied to marker-assisted breeding.

Method used

A molecular marker InDel-St, co-isolated with the cucumber sulfur tolerance gene St, was developed. The cucumber genome was detected by PCR amplification, and the presence of sulfur tolerance in cucumbers was identified by nucleotide sequence fragments InDel-St-F and InDel-St-R, which were simplified to characteristic band determination at 280bp or 305bp.

Benefits of technology

This method enables rapid, simple, and efficient screening of sulfur tolerance traits in cucumber seedlings, shortens the breeding cycle, improves cucumber breeding efficiency, and lays the foundation for the application of sulfur fumigation in facility cultivation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116536443B_ABST
    Figure CN116536443B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology and particularly relates to an InDel molecular marker co-segregated with a cucumber sulfur-tolerant gene St and application. When the cucumber sulfur-tolerant gene St is located by using the molecular marker InDel-St, a 280bp characteristic band which is tightly linked can be PCR amplified in the cucumber sulfur-tolerant material, and a 305bp characteristic band which is tightly linked can be PCR amplified in the cucumber sulfur-sensitive material. By using the result, a foundation can be laid for molecular marker assisted breeding of the cucumber sulfur-tolerant trait, the molecular breeding process of the cucumber sulfur-tolerant trait is accelerated, the selection efficiency of breeding is improved, and a foundation is laid for the application of sulfur fumigation in the facility cultivation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular breeding, and particularly relates to a molecular marker co-segregated with a cucumber sulfur-tolerant gene St and application thereof. BACKGROUND

[0002] Cucumber (Cucumis sativus L.) is one of the most important vegetables in the world. Facility cultivation is the main way of cucumber production, and its cultivation environment has the characteristics of weak light, high humidity, high temperature and slow airflow, which often causes the breeding and transmission of multiple fungal diseases such as downy mildew, powdery mildew, angular spot and gray mold, resulting in yield reduction or even absolute yield reduction of facility cucumber. Chemical means is a common measure for preventing and treating facility cucumber diseases, which is easy to cause cucumber pesticide residues or even serious over-standard, reduce the market competitiveness of cucumber, increase the production cost of vegetable farmers, cause environmental pollution and threaten people's healthy life.

[0003] Sulfur ( 32 SO) is an important fungicide in organic agricultural production. Using a sulfur vapor instrument to fumigate sulfur is one of the common sterilization methods in facility horticulture production at home and abroad, which can effectively prevent the transmission of multiple fungal diseases in facilities. In 1922, Barker and Wallace found that sulfur vapor formed by heating sulfur at high temperature (190℃) does Brownian motion in the air, penetrates into fungi and interferes with mitochondrial respiration, thereby inhibiting conidial germination. Compared with the common chemical agent control, sulfur fumigation has the advantages of comprehensive and efficient sterilization, labor saving, prevention of pesticide residues, etc. In 2010, Liu Meilin et al. reported that exogenous sulfur fumigation caused leaf damage of some cucumber germplasm and varieties, appearing yellow-brown leaf spots, leaf edges curling inward, leaf appearing scorched, and losing function. Due to the significant difference in sulfur fumigation tolerance of different cucumber varieties, the application of sulfur fumigation in facility cucumber production is limited.

[0004] At present, the research on the genetic mechanism of plant sulfur tolerance traits mainly focuses on melon. In 2004, Perchepied et al. pointed out that the sulfur response of melon is quantitative inheritance. Among 236 melon materials from all over the world, 47% of the materials grew normally under sulfur fumigation, and a major and two minor sulfur-tolerant QTLs were successfully located by using a recombinant inbred line (RIL) population. In 2014, Daley et al. located two sulfur-tolerant QTLs on linkage group 1 and 12 by using a RIL population constructed by the sulfur-tolerant parent Ananas Yok'neum (AY) and the sensitive parent MR-1. On this basis, in 2020, Branham et al. also located a major and two minor QTLs related to sulfur tolerance by using the MR-1 x AY RIL population, and further located eight candidate genes in the major QTL interval of chromosome 1 by using KASP markers, which is within the interval located by Perchepied et al. in 2004. So far, no specific sulfur-tolerant regulatory gene and molecular marker directly applicable to molecular marker-assisted breeding for this trait have been reported.

[0005] In summary, the development of a molecular marker co-segregated with the cucumber sulfur-tolerant gene St, the use of molecular markers for genotype identification and selection at the seedling stage, and the provision of related technical support for the integration and promotion of sulfur fumigation technology in later facilities can reduce the use of high-residue and high-toxicity pesticides in facility vegetables, which is of great significance for the safe production and sustainable development of facility vegetables. SUMMARY

[0006] One of the purposes of the present application is to provide a molecular marker co-segregated with the cucumber sulfur-tolerant gene St.

[0007] The second purpose of the present application is to provide the application of the above-mentioned molecular marker in cucumber molecular breeding.

[0008] Another purpose of the present application is to provide a method for determining the sulfur tolerance of cucumber varieties.

[0009] To achieve the above-mentioned purposes, the present application provides the following technical solutions:

[0010] A molecular marker co-segregated with the cucumber sulfur-tolerant gene St, named InDel-St, is composed of a nucleotide sequence fragment represented by SEQ ID NO. 1 and a nucleotide sequence fragment represented by SEQ ID NO. 2, wherein the nucleotide sequence fragment represented by SEQ ID NO. 1 is co-segregated with the sulfur-tolerant gene, and the nucleotide sequence fragment represented by SEQ ID NO. 2 is co-segregated with the sulfur-sensitive gene.

[0011] The above molecular marker co-segregated with the cucumber sulfur-tolerant gene can be an Indel marker, located at 22,288,241-22,288,545 base positions on chromosome 7 of Gy14V2.0 genome, and amplified by a pair of PCR primers. The primers are synthesized by Beijing Qikete Biotech Co., Ltd. The sequences of the upstream and downstream primers of the primer pair for amplifying the molecular marker are as follows:

[0012] InDel-St-F: 5'-ATGGGAGTTGAGCATAATCGTT-3' (SEQ ID NO. 3);

[0013] InDel-St-R: 5'-CAGAACGACCACTCAATCTCAT-3' (SEQ ID NO. 4).

[0014] The application further discloses application of the above molecular marker co-segregated with the cucumber sulfur-tolerant gene St in cucumber molecular breeding. The molecular marker co-segregates with the cucumber sulfur-tolerant gene St, and can be used to identify or assist in identifying whether the cucumber has the sulfur-tolerant trait at the molecular level, that is, whether the cucumber material is sulfur-tolerant can be determined at the budding stage or seedling stage by using the molecular marker to further amplify the product fragment size, so that the breeding process is accelerated. Those skilled in the art can understand that, for example, whether the cucumber sulfur-tolerant variety is determined by detecting whether the molecular marker of the application exists. Specifically, the primer pair of the molecular marker of the application can be used, and the detection can also be performed by a sequencing method.

[0015] The application further discloses a determination method for the cucumber sulfur-tolerant trait / variety, characterized in that the determination method comprises the following steps:

[0016] (1) extracting cucumber genomic DNA to be tested;

[0017] (2) using the primer pair of the molecular marker of claim 2 to perform PCR amplification on the genomic DNA extracted in step (1) as a template, and performing electrophoresis detection and / or sequencing on the PCR amplification product;

[0018] (3) determining according to the electrophoresis band and / or sequencing result of step (2), and the specific standard is:

[0019] If the PCR amplification product is a characteristic band with a length of 280 bp as shown in SEQ ID NO. 1, the cucumber material to be tested is a sulfur-tolerant trait / variety, and if the PCR amplification product is a characteristic band with a length of 305 bp as shown in SEQ ID NO. 2, the cucumber material to be tested is a sulfur-sensitive trait / variety.

[0020] In addition, the kit containing the primer pair can be used to identify the sulfur tolerance trait of cucumber material, and in specific application, a reagent containing the above-mentioned molecular marker primer pair can be selected to form a kit.

[0021] Furthermore, the reagent for detecting the presence of the Indel marker is applied in the positioning of the cucumber sulfur tolerance gene St, and the molecular marker of the application can be used for the positioning of the cucumber sulfur tolerance gene St, and the above-mentioned applications can be performed according to the conventional method.

[0022] The application also protects the vector containing the above-mentioned molecular marker. The recombinant vector can be an expression vector or a cloning vector into which the molecular marker of the application is inserted. After obtaining the above-mentioned recombinant vector, the skilled in the art can transform the recombinant vector into a suitable cell according to different needs to obtain a recombinant cell containing the recombinant vector. Therefore, the application also protects the recombinant cell containing the above-mentioned recombinant vector.

[0023] Advantages of the application:

[0024] The molecular marker InDel-St has high stability and can be simply, quickly and high-throughput applied to the screening of cucumber sulfur tolerance germplasm and sulfur-sensitive germplasm all over the world.

[0025] The application first carries out related research on the cucumber sulfur tolerance trait. By using linkage analysis, whole genome association analysis, interval electronic pool and other methods, the cucumber sulfur tolerance trait is finely positioned for the first time, and the cucumber sulfur tolerance gene is positioned in the 15.2Kb interval at the end of chromosome 7. By using the interval electronic pool, a molecular marker InDel-St co-segregated with the cucumber sulfur tolerance gene is finally associated, and the selection efficiency of the molecular marker is 100% in 9 sulfur-tolerant materials and 9 sulfur-sensitive materials of cucumber inbred lines. The development of the marker is helpful for the final cloning of the cucumber sulfur tolerance gene St and the establishment of a molecular marker-assisted breeding system.

[0026] The traditional germplasm identification method is to select according to the leaf phenotype of cucumber under sulfur fumigation, which has the disadvantages of long time consumption and high cost, which increases the period and difficulty of cucumber sulfur tolerance breeding. The molecular marker provided by the application is co-segregated with the cucumber sulfur tolerance trait, and different genetic background of cucumber can be used for sulfur tolerance germplasm screening, which greatly improves the cucumber breeding efficiency and shortens the breeding period of sulfur tolerance germplasm, and lays a foundation for the application of sulfur fumigation in facility cultivation. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 The leaf phenotype of cucumber under sulfur fumigation; wherein A is the cucumber sulfur-tolerant germplasm '9930', and B is the cucumber sulfur-sensitive germplasm 'Gy14'.

[0028] Figure 2The square dotted box represents the initial positioning interval of the main QTL site of cucumber sulfur tolerance.

[0029] Figure 3 The schematic diagram of the fine mapping process of cucumber sulfur tolerance gene St, wherein St represents the sulfur tolerance gene.

[0030] Figure 4 The electrophoresis map of PCR amplification product of molecular marker InDel-St. T represents 9 sulfur-tolerant materials in the electronic pool interval, which are T-1, T-2, T-3, T-4, T-5, T-6, T-7, T-8 and T-9, and the results show that a 280bp band is amplified in the cucumber sulfur-tolerant materials; S represents 9 sulfur-sensitive materials in the electronic pool interval, which are S-1, S-2, S-3, S-4, S-5, S-6, S-7, S-8 and S-9, and the results show that a 305bp band is amplified in the cucumber sulfur-sensitive materials; M is a 1500bp marker. DETAILED DESCRIPTION

[0031] The principles and features of the present application are described below in conjunction with the accompanying drawings, and the examples are only used to explain the present application and are not used to limit the scope of the present application.

[0032] Unless specifically indicated otherwise, the technical means used in the examples are conventional means known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used are commercially available.

[0033] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as familiar to those skilled in the art. In addition, any method and material similar or equivalent to those described can be applied in the present application. The preferred implementation methods and materials described herein are only used for demonstration.

[0034] Biological materials:

[0035] ‘Gy14’ is a typical North American processing cucumber, which is sensitive to sulfur fumigation; ‘9930’ is a typical North China dense-spine cucumber, which is extremely tolerant to sulfur fumigation. Both of them have public genome databases.

[0036] During the experiment, the cucumber materials were planted in the sunlight greenhouse, the day temperature was 23-32℃, the night temperature was 18-20℃, the light period was 12-14h, and the air relative humidity was 50-80%. In the experiment, sulfur (sulfur content ≥ 99.9%) was heated in the evaporator (sulfur consumption = 0.5g / h), and 2 sulfur fumigation devices were hung at the top of each greenhouse (2.5m x 2.5m x 2.5m). After the cucumber seeds were germinated, they were planted in the plug tray, and normal cucumber cultivation and management methods were used during the period. When the first true leaf fully expanded, sulfur fumigation treatment was performed, and the sulfur-tolerant phenotype of the leaf was recorded after 7 days of sulfur fumigation.

[0037] In the experiment, all primer synthesis and gene sequencing were completed by Beijing Qikexi Biological Technology Co., Ltd.

[0038] Experimental reagents:

[0039] CTAB method was used to extract sample DNA, and CTAB and EDTA-Na2 were purchased from Biotopped, and Tfis was purchased from Beijing Solaybao Technology Co., Ltd. 2x Taq PCR MasterMix was used for PCR amplification, which was purchased from Beijing Zhongke Ruaitai Biological Technology Co., Ltd. The related reagents required for polyacrylamide gel (PAGE) electrophoresis, such as acrylamide and polyacrylamide, were purchased from Aladdin.

[0040] Experimental equipment:

[0041] In this experiment, LongGene A300 fast gradient PCR instrument was used for fragment amplification; the electrophoresis instrument used was Junyi JY600E general electrophoresis instrument; and the electrophoresis tank was Junyi JY-SCZF high-throughput double vertical electrophoresis tank.

[0042] Obtaining of InDel molecular marker co-segregated with cucumber sulfur-tolerant gene in Example 1

[0043] For the analysis of cucumber sulfur-tolerant gene, including cucumber sulfur-tolerant phenotype identification, linkage analysis, whole genome association analysis and interval electronic pool analysis, the cucumber sulfur-tolerant trait was finely mapped for the first time, and the cucumber sulfur-tolerant gene was located in the 15.2Kb interval at the end of chromosome 7. Using interval electronic pool, a molecular marker InDel-St co-segregated with cucumber sulfur-tolerant gene was finally associated, and the related experimental process is briefly introduced as follows.

[0044] (1) Cucumber sulfur-tolerant phenotype identification

[0045] All cucumber materials were fumigated with sulfur for 7 days, and then the sulfur-tolerant phenotype was classified. The sulfur-tolerant phenotype of cucumber was classified according to the leaf damage area, and the classification range was 0-9: 0 = no sulfur-sensitivity symptoms or leaf necrosis area < 10%; 1 = leaf necrosis area 10%-20%; 2 = leaf necrosis area 20%-30%; and so on, each increase of 1 level, the leaf necrosis area increased by 10%, therefore, 9 = leaf necrosis area > 90%. The sulfur-tolerant phenotype of 146 cucumber inbred lines and 126 RILs populations were investigated according to the above standard. At least 3 single plants of each line were collected, and the sulfur-tolerant classification of the first true leaf from top to bottom was counted. The average value of 3 single plants was recorded as the actual classification of the line.

[0046] (2) Linkage analysis of cucumber sulfur-tolerant traits

[0047] Using sulfur-tolerant cucumber '9930' as the female parent and sulfur-sensitive cucumber 'Gy14' as the male parent, F7 or F8 RIL populations were constructed by single-seed descent method. In spring and winter of 2019, the sulfur-tolerant phenotype of 126 RILs was counted and the sulfur-tolerant gene was initially located by R / qtl package. The results showed that there was a significant single peak at the end of chromosome 7 in the genetic map of 458 SNPs; further analysis by 2454 SNPs genetic map of chromosome 7 showed that the sulfur-tolerant QTL was located in the interval of 21.63 Mb-22.70 Mb (Gy14 V2.0 genome data).

[0048] According to the physical location of the candidate interval, 498 RILs were scanned and recombinant single plants were retained using flanking markers to identify the phenotype. By screening the polymorphic markers in the SSR marker library, and developing new Indel, CAPs and dCAPS markers to screen recombinant single plants, the positioning interval was narrowed down. The results showed that the sulfur-tolerant gene was located in the interval of 22, 226, 049 bp-22, 411, 379 bp about 185 Kb ( Figure 2 ).

[0049] (3) Genome-wide association analysis of cucumber sulfur-tolerant traits

[0050] The natural population of 146 cucumber core germplasm was treated with sulfur fumigation and the phenotype was counted. The whole genome association analysis was carried out using R / rrBLUP package combined with genotype data. The results showed that the peak shape was obvious at the end of chromosome 7; further analysis showed that when FDR = 0.05, LOD = 5.75, there were 29 SNP loci with LOD > 5.75, one located on chromosome 3, and the other 28 located on chromosome 7 in the interval of 22, 290, 196 bp-22, 305, 392 bp about 15 Kb ( Figure 3 ).

[0051] (4) Interval electronic pool analysis of cucumber sulfur-tolerant traits

[0052] The 500 Kb sequence extending on both sides of the above candidate interval was selected as the pool analysis interval. All Indel and SNP were aligned to Gy14 V2.0 genome data by BWA, and electronic pool analysis was performed by combining the phenotypic and genotypic data of 9 high-sensitivity and 9 high-resistance materials. The results showed that 25 bp and 4 bp InDel at 22,288,294 bp and 22,289,424 bp were associated with sulfur tolerance traits, respectively. Through genome data and clone sequence analysis, it was found that the 25 bp InDel was related to cucumber sulfur tolerance traits. Figure 3 ) The above InDel is located in a gene encoding an exogenous lectin receptor-like serine / threonine-protein kinase (LecRK).

[0053] (5) Population cosegregation verification

[0054] In order to verify the linkage relationship between InDel marker InDel-St and cucumber sulfur tolerance traits, the above interval electronic pool was used to select 9 high-sensitivity and 9 high-resistance materials for population cosegregation verification of the marker. The results showed that the high-resistance materials had a consistent band type, the high-sensitivity materials had a consistent band type( Figure 4 ), and the marker cosegregated with cucumber sulfur tolerance traits.

[0055] Example 2: Use of the above molecular marker to identify whether cucumber is a sulfur-tolerant variety

[0056] (1) Extraction of cucumber leaf DNA

[0057] CTAB method was used to extract DNA from cucumber leaves, and the nucleic acid concentration and purity of the DNA sample were determined. The concentration of the DNA working solution should not be less than 50 ng / μl, and the purity OD260 / 280 value should be between 1.8-2.0. Specifically:

[0058] Take 0.2-0.3g of fresh leaf material into a 2ml centrifuge tube and add two steel balls. Freeze the sample in liquid nitrogen and grind it in a tissue homogenizer at 30 rpm. Add 800μl of 2×CTAB and incubate at 65℃ for 2h. Add 800μl of 24:1 chloroform-isoamyl alcohol, gently invert to mix, let stand for 15min, centrifuge at 12000rpm / min for 15min at 4℃, transfer the supernatant to a new 2ml centrifuge tube, add 1200μl of pre-chilled anhydrous ethanol at -20℃, incubate at -20℃ for 20min, centrifuge for 15min, and discard the supernatant. Wash with 500μl of 75% ethanol, centrifuge to discard the supernatant, and air dry. Add 100μl of TE buffer and 2‰ RNase, and incubate at 4℃ for 4h to dissolve. Determine DNA concentration and purity using a NanoDrop Spectrometer. Detect DNA integrity using 1% agarose gel electrophoresis. The DNA concentration was diluted to 50 ng / μl and stored at -20℃ for later use.

[0059] (2) PCR amplification of DNA from cucumber samples

[0060] Primer selection:

[0061] InDel-St-F: 5'-ATGGGAGTTGAGCATAATCGTT-3' (as shown in SEQ ID NO.3)

[0062] InDel-St-R: 5'-CAGAACGACCACTCAATCTCAT-3' (as shown in SEQ ID NO.4)

[0063] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and then diluted to 5 μM for later use.

[0064] PCR amplification system: 2×Taq Master Mix 3.0 μl, ddH2O 3.0 μl, DNA 2.0 μl (50 ng / μl), InDel-St-F 1 μl (5 μM), InDel-St-R 1 μl (5 μM). The PCR reaction program used was Touchdown PCR: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 45 s; 68-58℃ annealing for 1 min, 72℃ extension for 1 min, 6 cycles, decreasing by 2℃ per cycle; 94℃ denaturation for 30 s, 58-50℃ annealing for 1 min, 72℃ extension for 1 min, 9 cycles, decreasing by 1℃ per cycle; 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 1 min, 20 cycles; 72℃ final extension for 5 min, stored at 4℃ (Tables 1 & 2).

[0065] The reagents were added in the order listed, and the PCR reaction system is shown in Table 1.

[0066] Table 1 PCR reaction system

[0067]

[0068] PCR reaction program uses Touchdown. The reaction program is shown in Table 2.

[0069] Table 2 PCR reaction program

[0070]

[0071] (3) Polyacrylamide gel electrophoresis detection

[0072] Eleven percent non-denaturing polyacrylamide gel electrophoresis was used to detect the PCR amplification products of 18 materials, the electrophoresis buffer was 0.5xTBE, 250V constant voltage electrophoresis for 1.5h, silver staining color development. The band type of sulfur-tolerant material is marked as T, and the band type of sulfur-sensitive material is marked as S, specifically:

[0073] InDel-St amplified sequence in sulfur-tolerant parent, consisting of 280 nucleotides, specifically: CAGAACGACCACTCAATCTCATAGGATATGTAAGTGTAGAAAGGTCGTTGTTTTTGTCTGTGAAGTTAAGTTATAATGATTTTAAACAAIATCTATAIGGTTATIGTATTTTCAGGCATGGGAATTATGGGTGAATGGGAGAGGAGAAGAGCTCATTGATTCAGGTTTGTGCAACTCTGATCAGAAACCAAAAGCTTTAAGATGTATCCATGTCAGTCTTTTATGCCGACGATGTTGGATATTTATTTCATGATCAGCAACGATTATGCTCAACTCCCAT (SEQ ID NO. 1).

[0074] The InDel-St amplified sequence in the sulfur-sensitive parent consists of 305 nucleotides, specifically: CAGAACGACCACTCAATCTCATAGGATATGTAAGTGTAGAAAGGTCGTTGTTTTTGTCTGTGAAGTTAAGTTATAATGATTTTAAACAATATCTATATGGTTATTGTATTTTCAGGCATGGGAATTATGGGTGAATGGGAGAGGAGAAGAGCTCATTGATTCAGGTTTGTGCAACTCTGATCAGAAACCAAAAGCTTTAAGATGTATCCATGTCAGTCTTTTATGCGTCCAACAAATCCCAGCGGATAGGCCGACGATGTTGGATATTTATTTCATGATCAG0CAACGATTATGCTCAACTCCCAT (SEQ ID NO. 2).

[0075] Therefore, for the molecular marker InDel-St, if the characteristic band of the PCR product is 280 bp (the sequence is shown in SEQ ID 1), the material to be tested is a sulfur-tolerant cucumber variety; if the characteristic band of the PCR product is 305 bp (the sequence is shown in SEQ ID 2), the variety is a sulfur-sensitive cucumber material. By analyzing the amplified characteristic band, it can be determined whether the material is a sulfur-tolerant material.

[0076] In summary, the molecular marker screened by the present application can be applied to the auxiliary screening of cucumber seedling sulfur tolerance traits, lays a foundation for molecular marker assisted breeding of sulfur tolerance traits, and accelerates the molecular breeding process of cucumber sulfur tolerance traits.

[0077] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Amplification of sulfur-tolerant genes in cucumbers St The application of co-separated Indel-labeled primer pairs in identifying whether cucumbers possess sulfur-resistant traits, characterized in that... The upstream primer sequence of the primer pair of the molecular marker is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4; If the PCR amplification product is a characteristic band of 280 bp as shown in SEQ ID NO.1, then the cucumber material to be tested has sulfur resistance; if the PCR amplification product is a characteristic band of 305 bp as shown in SEQ ID NO.2, then the cucumber material to be tested has sulfur sensitivity.

2. A method for determining the sulfur tolerance trait / variety of cucumber, characterized in that, The determination method includes the following steps: (1) Extract genomic DNA from cucumbers to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the Indel-labeled primer pair described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: If the PCR amplification product is a characteristic band of 280 bp as shown in SEQ ID NO.1, then the cucumber material to be tested is a sulfur-resistant trait / variety. If the PCR amplification product is a characteristic band of 305 bp as shown in SEQ ID NO.2, then the cucumber material to be tested is a sulfur-sensitive trait / variety.

Citation Information

Patent Citations

  • Indel marker linked with cucumber long hypocotyledonary axis gene lh1, primer for screening cucumber long hypocotyledonary axis gene lh1, kit for identifying cucumber germplasm resources with cucumber long hypocotyledonary axis gene lh1, and application of Indel marker

    CN112094940A

  • Marker for selection of powdery mildew resistance cucumber and selection method using the same marker

    KR102380677B1