A carbofuran aptamer electrochemical sensor based on three-dimensional hierarchical porous carbon material sensitization effect and application method thereof

Abstract

The application discloses a carbaryl aptamer electrochemical sensor based on a three-dimensional hierarchical porous carbon material sensitization effect and an application method thereof, and a preparation method of the carbaryl aptamer electrochemical sensor comprises the following steps: (1) preparing a three-dimensional hierarchical porous carbon material; (2) preparing AuNPs@HPC; (3) preparing an AuNPs@HPC / Chit dispersion solution; (4) preparing a Tris-HC buffer solution; (5) preparing 1mMol / L 6-thiol-1-hexanol; (6) preparing a 5.0mMol / L [Fe(CN)6] 3‑ / 4‑ / 0.1Mol / L KCl solution; (7) preparing a carbaryl nucleic acid aptamer solution; and (8) preparing a carbaryl aptamer electrochemical sensor. The application further provides an application method of the carbaryl aptamer electrochemical sensor. The application establishes an ultra-sensitive and high-selectivity carbaryl aptamer electrochemical sensor, the electrochemical sensor is used for detecting carbaryl, and compared with the same method reported in the literature, the electrochemical sensor shows more excellent analysis performance, and common coexisting pesticides have no obvious interference on detection.

Description

Technical Field

[0001] This invention relates to the field of electrochemical analysis and detection technology, and in particular to a carbofuran aptamer electrochemical sensor based on the sensitizing effect of three-dimensional hierarchical porous carbon materials and its application method. Background Technology

[0002] Carbofuran (2,3-dihydro-2,2-dimethyl-7-benzofuranyl-n-methylcarbamate; abbreviated as CBF), with the molecular formula C 12 H 15 NO3, or nitrogen oxides (CBF), is one of the most toxic N-methylcarbamate pesticides, widely used to control pests and diseases in various grains, vegetables, fruits, and cash crops. It is difficult to degrade in acidic soils, polluting soil and water, especially in vegetables and grains, leading to pesticide residues that directly threaten public health and the environment. Its toxicity includes inhibition of cholinesterase, severe inhalation convulsions, and neuromuscular disorders. Given its wide applicability and high toxicity, many countries have established strict regulations on CBF residues in agricultural products. my country has also set strict limits on its content in agricultural products. For example, the maximum residue limit for CBF in brown rice, sugar beets, root vegetables, cottonseed, and sunflower seeds is 0.1 mg / kg; in wheat, early grains, miscellaneous grains, rapeseed, and mammals, it is 0.05–0.1 mg / kg; and in vegetables, fruits, sugarcane, medicinal plants, edible fungi, and tea, it is 0.02 mg / kg. Therefore, the regulation of CBF requires sensitive and accurate analytical techniques.

[0003] Currently, there are various methods and techniques for detecting CBF (concentrated fibroblastic oxidase). Traditional methods, such as gas chromatography, high-performance liquid chromatography, and chromatography-mass spectrometry, while offering high selectivity and accuracy, still suffer from drawbacks such as complex sample pretreatment, high cost, expensive equipment, the need for specialized personnel, long detection times, and unsuitability for on-site testing. Therefore, they are not suitable for the rapid detection needs of agricultural products. Aptamers are artificial single-stranded DNA or RNA sequences screened in vitro using SELEX (ligand index enrichment system evolution). They can bind to a wide range of targets and exhibit extremely high specificity and stability. In recent years, aptamer-based sensors have attracted widespread attention and achieved good analytical results in pesticide residue detection.

[0004] The key step in constructing aptamer sensors is the fixation of the aptamer on the electrode surface, as it directly affects the main performance characteristics of the aptamer sensor, such as stability, sensitivity, and selectivity. Three-dimensional hierarchical porous carbon (HPC) has advantages such as large specific surface area, simultaneous presence of macropores / mesopores / micropores, well-developed pore network structure, good conductivity, and good chemical / thermal stability, making it an ideal material for constructing aptamer sensors. However, there are still few reports on aptamer electrochemical sensors using HPC as an electrochemical interface support material.

[0005] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a carbofuran aptamer electrochemical sensor based on the sensitizing effect of three-dimensional hierarchical porous carbon materials and its application method.

[0007] To achieve the above objectives, the technical solution provided by the present invention is as follows:

[0008] A carbofuran aptamer electrochemical sensor based on the sensitizing effect of three-dimensional hierarchical porous carbon materials is prepared by the following steps:

[0009] (1) Preparation of three-dimensional hierarchical porous carbon material: Sodium alginate was carbonized at high temperature under nitrogen atmosphere to obtain carbon material. Then, the carbon material was immersed in HCl solution under magnetic stirring to remove inorganic impurities. It was then washed with deionized water until neutral, filtered and collected as black solid, and dried to obtain three-dimensional hierarchical porous carbon material. The three-dimensional hierarchical porous carbon material is denoted as HPC.

[0010] (2) Preparation of AuNPs / HPC: Chloroauric acid was dissolved in deionized water to obtain solution A. Polyvinyl phenylene glycol was added to the HPC aqueous suspension, and the solution was ultrasonically treated to obtain solution B. Solution A was slowly added to solution B, and the mixture was stirred until homogeneous to obtain AuNPs / HPC. 3+ / HPC mixture; then add ascorbic acid solution, react at room temperature for 0.5-2h, after the reaction is complete, filter, wash the product, and dry to obtain AuNPs@HPC nanomaterials;

[0011] (3) Preparation of AuNPs@HPC / Chit dispersion: Chitosan was dissolved in acetic acid solution to obtain chitosan solution. The AuNPs@HPC nanomaterials prepared in step (2) were uniformly dispersed in chitosan solution to obtain AuNPs@HPC / Chit dispersion.

[0012] (4) Preparation of Tris-HC buffer: Dissolve 1.21g of tris(hydroxymethyl)aminomethane in 800mL of water, adjust the pH to 8.5 with HCl, and bring the volume to 1000mL to obtain a Tris-HC buffer with a concentration of 10mMol / L.

[0013] (5) Preparation of 1 mmol / L 6-mercapto-1-hexanol: Take 1.0 g / mL of 6-mercapto-1-hexanol, dissolve it in ethanol first, and then adjust the volume to 1 mmol / L with Tris-HCl buffer.

[0014] (6) 5.0 mmol / L [Fe(CN)6] 3- / 4- Preparation of 0.1 mmol / L KCl solution: Weigh 0.07455 g KCl, 0.01646 g potassium ferricyanide, and 0.01842 g potassium ferrocyanide, dissolve in deionized water, and then bring the volume to 10 mL to obtain 5.0 mmol / L [Fe(CN)6]. 3- / 4- / 0.1Mol / L KCl solution;

[0015] (7) Preparation of carbofuran nucleic acid aptamer solution:

[0016] The sequence number of the carbofuran aptamer is: 5′-CACCTGGGGGAGTATTGCGGAGGAAAGAGAACACTGGGGCAGATATGGGCCAGCA GGTC-(CH2)6-SH-3′; the carbofuran aptamer powder was prepared into a 5.0 μmol / L carbofuran aptamer solution using Tris-HCl buffer.

[0017] (8) Preparation of carbofuran aptamer electrochemical sensor: Polish, clean and dry the glassy carbon electrode (GCE). Take 5 μL of the AuNPs@HPC / Chit dispersion prepared in step (3) and drop it onto the glassy carbon electrode to obtain the modified electrode, which is denoted as AuNPs@HPC / Chit / GCE. Then add 6 μL of 5.0 μmol / L carbofuran nucleic acid aptamer solution to the surface of AuNPs@HPC / Chit / GCE and incubate at 20-40℃ for 60-100 min. Then wash the surface of the modified electrode with Tris-HCl buffer to obtain the electrode modified with nucleic acid aptamer, which is labeled as Apt / AuNPs@HPC / Chit / GCE. Immerse Apt / AuNPs@HPC / Chit / GCE in 1 mmol / L... The carbofuran aptamer electrochemical sensor was obtained by storing it in 6-mercapto-1-hexanol at room temperature for 1 h and then washing it with Tris-HCl buffer. It was labeled as MCH / Apt / AuNPs@HPC / Chit / GCE.

[0018] Preferably, the method for obtaining carbon material by high-temperature carbonization of sodium alginate in step (1) under nitrogen atmosphere is as follows: 5g of sodium alginate is placed in a quartz boat and placed in a tube furnace. After nitrogen is introduced for 1 hour, the temperature is raised to the target temperature of 900℃ at a heating rate of 3℃ / min. Then, the temperature is maintained at the set temperature for 1 hour. After natural cooling, carbon material can be obtained. In step (1), the concentration of HCl solution is 3mol / L, and the drying method is to dry at 100℃ for 12 hours.

[0019] Preferably, in step (2): 0.12 mmol of chloroauric acid is dissolved in 20 mL of deionized water and stirred to disperse to obtain solution A; 50 mg of polyethylene glycol diacetate is added to 40 mL of HPC aqueous suspension and sonicated for 30 min at room temperature to obtain solution B, wherein the concentration of the HPC aqueous suspension is 1 mg / mL; after slowly adding solution A to solution B, the pH is adjusted to 3-5 with 1 mol / L HCl solution and stirred for 30 min at room temperature to obtain Au. 3+ / HPC mixture; the molar ratio of ascorbic acid to Au is 3:1. After adding ascorbic acid solution, react at room temperature for 1 h. After the reaction is completed, filter the product with a glass frit funnel with a pore size of 2 μm, rinse with anhydrous ethanol and then with deionized water, repeat 3 times. Finally, dry the product in a constant temperature oven at 60 °C under vacuum for 12 h to obtain AuNPs@HPC nanomaterials.

[0020] Preferably, in step (3), the concentration of acetic acid solution is 1%, the concentration of chitosan solution is 0.25%, and the AuNPs@HPC nanomaterials prepared in step (2) are uniformly dispersed in chitosan solution by ultrasonication to obtain AuNPs@HPC / Chit dispersion with a concentration of 1.5 mg / mL.

[0021] Preferably, in step (5), 0.134 mL of 1.0 g / mL 6-mercapto-1-hexanol is taken, dissolved in 10 mL of ethanol, and then diluted to 1000 mL with Tris-HCl buffer to obtain 1 mmol / L 6-mercapto-1-hexanol.

[0022] Preferably, in step (8), the method for polishing, cleaning, and drying the glassy carbon electrode (GCE) is as follows: the glassy carbon electrode (GCE) with a diameter of 3 mm is polished to a mirror finish on chamois leather with 0.05 μm Al2O3 powder, the residual powder on the surface is washed away with deionized water, and then ultrasonically cleaned with HNO3 aqueous solution, anhydrous ethanol and deionized water for 3 min in sequence, and then naturally dried. The volume ratio of HNO3 to water in the HNO3 aqueous solution is 1:1. After adding carbofuran nucleic acid aptamer solution, it is incubated at 37°C for 80 min.

[0023] The present invention also provides a method for applying the carbofuran aptamer electrochemical sensor, comprising the following steps:

[0024] (a) Preparation of standard solutions: Weigh carbofuran standard and methanol to prepare a 0.5 mg / mL stock solution. Take a certain amount of the stock solution and add it to Tris-HCl buffer solution. Make up to volume to obtain a series of carbofuran standard solutions of different concentrations.

[0025] (b) Plotting the standard curve: Insert MCH / Apt / AuNPs@HPC / Chit / GCE into 5.0 mg / L [Fe(CN)6] 3- / 4- Differential pulse voltammetry (DPV) scans were performed in a 0.1 mol / L KCl solution within the range of -0.3 to 0.5 V, and the peak current of 0.145 ± 0.1 V was recorded as I0. Then, MCH / Apt / AuNPs@HPC / Chit / GCE were inserted into standard solutions containing different concentrations of carbofuran and incubated for 40 min, followed by insertion into a 5.0 mmol / L [Fe(CN)6] solution. 3- / 4- Differential pulse voltammetry (DPV) scans were performed in a 0.1 mol / L KCl solution within the range of -0.3 to 0.5 V, and the current peak value of 0.145 ± 0.1 V was recorded as I1. The change in the current peak value showed a good linear relationship with the logarithm of the carbofuran concentration. A standard curve was plotted based on the corresponding carbofuran concentration value, and the corresponding linear equation was obtained. The above carbofuran standard solution was replaced with the sample to be tested, and the same operation was performed to measure the change in the current peak value of 0.145 ± 0.1 V. The carbofuran content in the sample was calculated by substituting the measured current peak value into the obtained linear equation.

[0026] The linear equation in the range of 1.0–100,000 pg / L is: ΔI(10 -5 A) = 0.8792LogC CBF (pg / L) + 0.7736, correlation coefficient R 2 =0.9997; where ΔI = I0 - I1, and C is the concentration of carbofuran; the detection limit of this method is 0.5 pg / L (S / N = 3).

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] This invention prepares a three-dimensional hierarchical porous carbon material (HPC) via direct carbonization of sodium alginate without adding any activator. Then, porous carbon-supported gold nanoparticles (AuNPs@HPC) are prepared via ascorbic acid reduction. Chitosan is used to stably disperse the AuNPs@HPC onto the electrode surface, and the CBF aptamer is immobilized on the support via Au-S bonds. Based on the ultra-large specific surface area, good biocompatibility, and excellent electrocatalytic ability of AuNPs@HPC, an ultrasensitive and highly selective carbofuran aptamer electrochemical sensor is established. This electrochemical sensor is used to detect carbofuran and exhibits superior analytical performance compared to similar methods reported in the literature. Furthermore, common coexisting pesticides do not significantly interfere with the detection. Attached Figure Description

[0029] Figure 1 The fabrication process of the carbofuran aptamer electrochemical sensor and the sensing principle of carbofuran;

[0030] Figure 2 This is a scanned image of HPC using electron microscopy (SEM).

[0031] Figure 3 This is a scanning electron microscope (SEM) image of AuNPs@HPC nanomaterials;

[0032] Figure 4 Differential pulse voltammetry curves of carbofuran aptamer electrochemical sensors in the range of -0.3 to 0.5 V after incubation with carbofuran standard solutions of different concentrations;

[0033] Figure 5 A standard curve was plotted based on the linear relationship between the change in peak current and the logarithm of carbofuran concentration.

[0034] Figure 6 The current response of different substances on the carbofuran aptamer electrochemical sensor. Detailed Implementation

[0035] The following is a detailed description of specific embodiments with reference to the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. In the embodiments, the parameters of the differential pulse voltammetry are: potential amplification of 4mV, pulse amplitude of 50mV, pulse width of 50ms, pulse period of 0.5s, and sensitivity (A / V): 1×10⁻⁶. -4 All chemical substances used were commercially available.

[0036] Example 1: Preparation of carbofuran aptamer electrochemical sensor

[0037] (1) Preparation of three-dimensional hierarchical porous carbon material: 5g of sodium alginate was placed in a quartz boat and then placed in a tube furnace. After purging with nitrogen for 1 hour, the temperature was increased to the target temperature of 900℃ at a rate of 3℃ / min and held for 1 hour. After natural cooling, carbon material was obtained. Subsequently, the carbon material was immersed in a 3mol / L HCl solution under magnetic stirring to remove inorganic impurities. It was then washed with deionized water until neutral, filtered to collect the black solid, and dried at 100℃ for 12 hours to obtain the three-dimensional hierarchical porous carbon material, which was denoted as HPC. The electron microscope (SEM) scan of HPC is shown below. Figure 2 As shown, the HPC surface has a honeycomb structure and contains abundant macroporous structures. These macroporous structures are intertwined to form a three-dimensional interconnected porous carbon material.

[0038] (2) Preparation of AuNPs@HPC: 0.12 mmol of chloroauric acid was dissolved in 20 mL of deionized water and stirred for 30 min to obtain solution A; 50 mg of polyvinylbenzene diketone was added to 40 mL of HPC aqueous suspension with a concentration of 1 mg / mL, and the mixture was sonicated at room temperature for 30 min to obtain solution B; solution A was slowly added to solution B, and the pH was adjusted to 3-5 with 1 mol / L HCl solution, and stirred at room temperature for 30 min to obtain AuNPs@HPC. 3+ / HPC mixture; then add 10 mL ascorbic acid solution (ascorbate / gold (molar ratio) = 3:1), react at room temperature for 1 h. After the reaction, filter the product through a glass frit funnel with a pore size of 2 μm, wash with anhydrous ethanol and then with deionized water, repeat 3 times, 50 mL each time. Finally, vacuum dry the product in a constant temperature oven at 60 °C for 12 h to obtain AuNPs@HPC nanomaterials; SEM scan of AuNPs@HPC nanomaterials, as shown below. Figure 3 As shown, gold nanoparticles are clearly distributed on the HPC.

[0039] (3) Preparation of AuNPs@HPC / Chit dispersion: Weigh 0.25g of chitosan (Chit) and dissolve it in 1% acetic acid solution to obtain a chitosan solution with a concentration of 0.25%. Take 4.5mg of AuNPs@HPC nanomaterial prepared in step (2) and add it to 3mL of chitosan solution. Then disperse it evenly with ultrasound to obtain AuNPs@HPC / Chit dispersion with a concentration of 1.5mg / mL. Store it at 4℃ for later use.

[0040] (4) Preparation of Tris-HC buffer: Dissolve 1.21g of tris(hydroxymethyl)aminomethane in 800mL of water, adjust the pH to 8.5 with HCl, and bring the volume to 1000mL to obtain a Tris-HC buffer with a concentration of 10mmol / L.

[0041] (5) Preparation of 1 mmol / L 6-mercapto-1-hexanol: Take 0.134 mL of 1.0 g / mL 6-mercapto-1-hexanol, dissolve it in 10 mL of ethanol, and then adjust the volume to 1000 mL with Tris-HCl buffer to obtain 1 mmol / L 6-mercapto-1-hexanol.

[0042] (6) 5.0 mmol / L [Fe(CN)6] 3- / 4- Preparation of 0.1 mol / L KCl solution: Weigh 0.07455 g KCl, 0.01646 g potassium ferricyanide, and 0.01842 g potassium ferrocyanide, dissolve in deionized water, and then bring the volume to 10 mL to obtain 5.0 mmol / L [Fe(CN)6]. 3- / 4- / 0.1mol / L KCl solution;

[0043] (7) Preparation of carbofuran nucleic acid aptamer solution:

[0044] The sequence number of the carbofuran aptamer is (see SEQ ID NO.1): 5′-CACCTGGGGGAGTATTGCGGAGGAAAGAGAACACTGGGGCAGATATGGGCCAGCA GGTC-(CH2)6-SH-3′; the carbofuran aptamer powder was prepared into a 5.0 μmol / L carbofuran aptamer solution using Tris-HCl buffer.

[0045] (8) Preparation of carbofuran aptamer electrochemical sensor: A glassy carbon electrode (GCE) with a diameter of 3 mm was polished to a mirror finish on chamois leather with 0.05 μm Al2O3 powder. The residual powder on the surface was washed away with deionized water. Then, it was ultrasonically cleaned for 3 min in sequence with HNO3 aqueous solution (HNO3 to water volume ratio of 1:1), anhydrous ethanol and deionized water, and then air-dried. 5 μL of the AuNPs@HPC / Chit dispersion prepared in step (3) was dropped onto the glassy carbon electrode to obtain the modified electrode, denoted as AuNPs@HPC / Chit / GCE. Subsequently, the AuNPs@HPC / Chit / GCE was... 6 μL of a 5.0 μmol / L carbofuran nucleic acid aptamer solution was added to the surface and incubated at 37 °C for 80 min. The modified electrode surface was then washed with Tris-HCl buffer to obtain a nucleic acid aptamer-modified electrode, labeled Apt / AuNPs@HPC / Chit / GCE. Apt / AuNPs@HPC / Chit / GCE was immersed in 1 mmol / L 6-mercapto-1-hexanol and stored at room temperature for 1 h. Then it was washed with Tris-HCl buffer to obtain a carbofuran aptamer electrochemical sensor, labeled MCH / Apt / AuNPs@HPC / Chit / GCE.

[0046] The fabrication process of the carbofuran aptamer electrochemical sensor and the sensing principle of carbofuran are as follows: Figure 1 As shown, the bare electrode GCE was first cleaned and set aside. Then, AuNPs@HPC / Chit dispersion was dropped onto the GCE to form AuNPs@HPC / Chit / GCE. Subsequently, a nucleic acid aptamer solution was added to the electrode surface to prepare Apt / AuNPs@HPC / Chit / GCE. Finally, the prepared electrode was immersed in 1 mM MCH and stored at room temperature for 1 h to block non-specific binding sites on the electrode. The sensitive interface of the carbofuran aptamer electrochemical sensor was thus fabricated and labeled as MCH / Apt / AuNPs@HPC / Chit / GCE. [Fe(CN)6] 3- / 4- As a redox probe, differential pulse voltammetry was used to study the electrochemical sensor and the electrochemical sensing electrode after the immunoassay in a solution containing 5.0 mmol / L [Fe(CN)6]. 3- / 4- Scanning was performed in a test substrate solution of 0.1 mol / L KCl. When carbofuran was successfully immobilized on the electrode surface, the current decreased because the carbofuran molecules are electrochemically inert and their adsorption onto the electrode surface hindered charge transfer. The carbofuran content was detected by calculating the current change before and after incubation with the carbofuran aptamer electrochemical sensor MCH / Apt / AuNPs@HPC / Chit / GCE.

[0047] Example 2: Application method of carbofuran aptamer electrochemical sensor

[0048] (a) Preparation of standard solutions: Weigh carbofuran standard and methanol to prepare a 0.5 mg / mL stock solution. Take a certain amount of the stock solution and add it to Tris-HCl buffer solution. Make up to volume to obtain a series of carbofuran standard solutions of different concentrations.

[0049] (b) Construction of the standard curve: MCH / Apt / AuNPs@HPC / Chit / GCE was inserted into 5.0 mmol / L [Fe(CN)6] 3- / 4- Differential pulse voltammetry (DPV) scans were performed in a 0.1 mol / L KCl solution within the range of -0.3 to 0.5 V, and the peak current of 0.145 ± 0.1 V was recorded as I0. Then, MCH / Apt / AuNPs@HPC / Chit / GCE were inserted into standard solutions containing different concentrations of carbofuran and incubated for 40 min, followed by insertion into 5.0 mmol / L [Fe(CN)6] solution. 3- / 4- Differential pulse voltammetry (DPV) scans were performed in a 0.1 mol / L KCl solution within the range of -0.3 to 0.5 V. The current peak value of 0.145 ± 0.1 V was recorded and denoted as I1. The change in the current peak value showed a good linear relationship with the logarithm of the carbofuran concentration. A standard curve was plotted based on the corresponding carbofuran concentration values. Figure 5 The corresponding linear equation is then obtained. The carbofuran standard solution is replaced with the sample to be tested, and the same operation is followed. The change in the current peak value of 0.145±0.1V is measured and substituted into the obtained linear equation to calculate the content of carbofuran in the sample to be tested.

[0050] The linear equation in the range of 1.0–100,000 pg / L is: ΔI(10 -5 A) = 0.8792LogC CBF (pg / L) + 0.7736, correlation coefficient R 2 =0.9997; where ΔI = I0 - I1, and C is the concentration of carbofuran. The detection limit of this method is 0.5 pg / L (S / N = 3).

[0051] Figure 4 Differential pulse voltammetry curves of carbofuran aptamer electrochemical sensors in the range of -0.3 to 0.5 V were obtained after incubation with carbofuran standard solutions of different concentrations. The carbofuran standard solution concentrations corresponding to a to g were 0 pg / L, 1.0 pg / L, 5.0 pg / L, 10.0 pg / L, 100 pg / L, 1000 pg / L, 10000 pg / L, and 100000 pg / L, respectively.

[0052] Example 3: Repeatability, stability, and specificity detection of the carbofuran aptamer electrochemical sensor.

[0053] To evaluate the repeatability and stability of the experiment, under the same experimental conditions, differential pulse voltammetry (DPV) was used to measure the electrochemical properties of five independently prepared carbofuran aptamer electrochemical sensors prepared in Example 1.

[0054] The repeatability of the MCH / Apt / AuNPs@HPC / Chit / GCE was demonstrated by a relative deviation of 4.86% for the peak current value after five repeated measurements. On the other hand, the RSD value obtained by performing five repeated measurements with one MCH / Apt / AuNPs@HPC / Chit / GCE was 3.12%, indicating that the sensor has good reproducibility.

[0055] The assembled carbofuran aptamer electrochemical sensor was stored at 4°C for 7 days, and its current response was tested daily to detect the storage stability of the sensor. The results showed that the current value retained 90.5% of the original value, indicating that its stability was good.

[0056] To test the anti-interference capability of the carbofuran aptamer electrochemical sensor in actual detection, this embodiment selected several pesticides frequently used in combination with carbofuran—carbendazim, malathion, metribuzin, methyl parathion, atrazine, and acetamiprid—as interfering agents to test the sensor's specificity. The concentration of carbofuran was 10 ng / L, and the concentrations of carbendazim, malathion, metribuzin, methyl parathion, atrazine, and acetamiprid were each 100 ng / L. The experimental results are as follows: Figure 6 ,from Figure 6 As can be seen, the ΔI values ​​produced by substances other than carbofuran are very weak, indicating that the carbofuran aptamer electrochemical sensor has good selectivity for the detection of carbofuran, and the current responses of the six interfering substances are essentially negligible. Therefore, the carbofuran aptamer electrochemical sensor prepared according to Example 1 exhibits good specificity and maintains excellent application characteristics even in the presence of interfering substances.

[0057] Example 4 Sample Testing

[0058] The samples to be tested were celery and rapeseed. Following the standard method (GB / T 20769-2008), fresh celery and rapeseed samples (purchased from the local market in Nanning) were pulverized and mixed, accurately weighed (10g), and 20.0mL of acetonitrile was added. The mixture was vortexed for 1 min, followed by approximately 3g of sodium chloride and vortexed for another 1 min. The mixture was then centrifuged at 4000 rpm for 5 min. The supernatant was collected in a heart-shaped flask, concentrated by rotation, and nearly dried in a 40℃ water bath. The final residue was dissolved in 1.0mL of methanol, filtered through a Creole IC-QuEChERS column and a 0.22μm organic filter membrane, and finally diluted to 10mL with Tris-HCl buffer to obtain the Tris-HCl buffer solution for the analyte. Following the detection method in Example 2, the oxidation peak current value I1 was measured at 0.145±0.1V, and the oxidation peak current value I0 before incubation was used to calculate ΔI (ΔI=I0-I1). This ΔI was then substituted into the above linear equation ΔI(10 -5 A) = 0.8792LogC CBF In (pg / L)+0.7736, the corresponding carbofuran content was calculated from the standard curve based on the measured current change value, and the spiked recovery rate was calculated. The results are shown in Table 1:

[0059] Table 1. Results of Carbofuran Spiked Recovery in Celery and Rapeseed Samples

[0060]

[0061] Furthermore, the applicant compared the performance of the carbofuran aptamer electrochemical sensor of the present invention with that of other carbofuran electrochemical sensors in the prior art, as shown in Table 2. As can be seen from Table 2, the performance of the carbofuran aptamer electrochemical sensor of the present invention is superior to that of other carbofuran electrochemical sensors in the prior art.

[0062] Table 2 Comparison of performance of different carbofuran electrochemical sensors

[0063]

[0064] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A carbofuran aptamer electrochemical sensor based on the sensitizing effect of three-dimensional hierarchical porous carbon materials, characterized in that, The preparation method of the carbofuran aptamer electrochemical sensor includes the following steps: (1) Preparation of three-dimensional hierarchical porous carbon material: Sodium alginate was carbonized at high temperature under nitrogen atmosphere to obtain carbon material. Then, the carbon material was immersed in HCl solution under magnetic stirring to remove inorganic impurities. It was then washed with deionized water until neutral, filtered and collected as black solid. After drying, three-dimensional hierarchical porous carbon material was obtained. The three-dimensional hierarchical porous carbon material is denoted as HPC. (2) Preparation of AuNPs@HPC: Chloroauric acid was dissolved in deionized water to obtain solution A. Polyvinylpyrrolidone was added to the HPC aqueous suspension and ultrasonically treated to obtain solution B. Solution A was slowly added to solution B and stirred until well mixed to obtain AuNPs@HPC. 3+ / HPC mixture; then add ascorbic acid solution, react at room temperature for 0.5-2h, after the reaction is complete, filter, wash the product, and dry to obtain AuNPs@HPC nanomaterials; (3) Preparation of AuNPs@HPC / Chit dispersion: Chitosan was dissolved in acetic acid solution to obtain chitosan solution. The AuNPs@HPC nanomaterials prepared in step (2) were uniformly dispersed in chitosan solution to obtain AuNPs@HPC / Chit dispersion. (4) Preparation of Tris-HCl buffer: Dissolve 1.21g of tris(hydroxymethyl)aminomethane in 800mL of water, adjust the pH to 8.5 with HCl, and bring the volume to 1000mL to obtain a Tris-HCl buffer with a concentration of 10mmol / L. (5) Preparation of 1 mmol / L 6-mercapto-1-hexanol: Take 1.0 g / mL of 6-mercapto-1-hexanol, dissolve it in ethanol first, and then adjust the volume to 1 mmol / L with Tris-HCl buffer. (6) 5.0 mmol / L [Fe(CN)6] 3- / 4- Preparation of 0.1 mol / L KCl solution: Weigh 0.07455 g KCl, 0.01646 g potassium ferricyanide, and 0.01842 g potassium ferrocyanide, dissolve in deionized water, and then bring the volume to 10 mL to obtain 5.0 mmol / L [Fe(CN)6]. 3- / 4- / 0.1 mol / L KCl solution; (7) Preparation of carbofuran nucleic acid aptamer solution: The sequence number of the carbofuran aptamer is: 5′-CACCTGGGGGAGTATTGCGGAGGAAAGAGAACACTGGGGCAGATATGGGCCAGCAGGTC-(CH2)6-SH-3′; the carbofuran aptamer powder was prepared into a 5.0 μmol / L carbofuran aptamer solution using Tris-HCl buffer. (8) Preparation of carbofuran aptamer electrochemical sensor: Polish, clean and dry the glassy carbon electrode. Take 5 μL of the AuNPs@HPC / Chit dispersion prepared in step (3) and drop it onto the glassy carbon electrode to obtain the modified electrode, denoted as AuNPs@HPC / Chit / GCE. Then add 6 μL of 5.0 μmol / L carbofuran nucleic acid aptamer solution to the surface of AuNPs@HPC / Chit / GCE and incubate at 20-40℃ for 60-100 min. Then wash the surface of the modified electrode with Tris-HCl buffer to obtain the electrode modified with nucleic acid aptamer, labeled as Apt / AuNPs@HPC / Chit / GCE. Immerse Apt / AuNPs@HPC / Chit / GCE in 1 mmol / L 6-mercapto-1-hexanol and store at room temperature for 1 day. h, then washed with Tris-HCl buffer to obtain the carbofuran aptamer electrochemical sensor, labeled MCH / Apt / AuNPs@HPC / Chit / GCE.

2. The carbofuran aptamer electrochemical sensor according to claim 1, characterized in that: The method for obtaining carbon material by high-temperature carbonization of sodium alginate in step (1) under nitrogen atmosphere is as follows: 5 g of sodium alginate is placed in a quartz boat and placed in a tube furnace. After nitrogen is introduced for 1 h, the temperature is raised to the target temperature of 900 ℃ at a heating rate of 3 ℃ / min. Then, the temperature is maintained at the set temperature for 1 h. After natural cooling, carbon material can be obtained. In step (1), the concentration of HCl solution is 3 mol / L, and the drying method is to dry at 100 ℃ for 12 h.

3. The carbofuran aptamer electrochemical sensor according to claim 1, characterized in that: In step (2): 0.12 mmol of chloroauric acid was dissolved in 20 mL of deionized water and stirred to obtain solution A; 50 mg of polyvinylpyrrolidone was added to 40 mL of HPC aqueous suspension and sonicated at room temperature for 30 min to obtain solution B, wherein the concentration of the HPC aqueous suspension was 1 mg / mL; after slowly adding solution A to solution B, the pH was adjusted to 3-5 with 1 mol / L HCl solution and stirred at room temperature for 30 min to obtain Au. 3 + / HPC mixture; the molar ratio of ascorbic acid to Au is 3:

1. After adding ascorbic acid solution, react at room temperature for 1 h. After the reaction is completed, filter the product with a glass frit funnel with a pore size of 2 μm, wash with anhydrous ethanol and then with deionized water, repeat 3 times. Finally, dry the product in a constant temperature oven at 60 ℃ under vacuum for 12 h to obtain AuNPs@HPC nanomaterials.

4. The carbofuran aptamer electrochemical sensor according to claim 1, characterized in that: In step (3), the concentration of acetic acid solution is 1%, the concentration of chitosan solution is 0.25%, and the AuNPs@HPC nanomaterials prepared in step (2) are uniformly dispersed in chitosan solution by ultrasonication to obtain AuNPs@HPC / Chit dispersion with a concentration of 1.5 mg / mL.

5. The carbofuran aptamer electrochemical sensor according to claim 1, characterized in that: In step (5), take 0.134 mL of 1.0 g / mL 6-mercapto-1-hexanol, dissolve it in 10 mL of ethanol, and then adjust the volume to 1000 mL with Tris-HCl buffer to obtain 1 mmol / L 6-mercapto-1-hexanol.

6. The carbofuran aptamer electrochemical sensor according to claim 1, characterized in that: In step (8), the glassy carbon electrode is polished, cleaned, and dried as follows: the glassy carbon electrode with a diameter of 3 mm is polished to a mirror finish on chamois leather with 0.05 μm Al2O3 powder, the residual powder on the surface is washed away with deionized water, and then ultrasonically cleaned with HNO3 aqueous solution, anhydrous ethanol and deionized water for 3 min in sequence, and then naturally dried. The volume ratio of HNO3 to water in the HNO3 aqueous solution is 1:

1. After adding carbofuran nucleic acid aptamer solution, it is incubated at 37°C for 80 min.

7. The application method of the carbofuran aptamer electrochemical sensor according to claim 1, characterized in that, Includes the following steps: (a) Preparation of standard solutions: Weigh carbofuran standard and methanol to prepare a 0.5 mg / mL stock solution. Take a certain amount of the stock solution and add it to Tris-HCl buffer solution. Make up to volume to obtain a series of carbofuran standard solutions of different concentrations. (b) Plotting the standard curve: Insert MCH / Apt / AuNPs@HPC / Chit / GCE into 5.0 mmol / L [Fe(CN)6] 3- / 4- Differential pulse voltammetry was performed in a 0.1 mol / L KCl solution within the range of -0.3 to 0.5 V, and the peak current of 0.145 ± 0.1 V was recorded as I0. Then, MCH / Apt / AuNPs@HPC / Chit / GCE was inserted into standard solutions containing different concentrations of carbofuran and incubated for 40 min, followed by insertion into 5.0 mmol / L [Fe(CN)6] solution. 3- / 4- Differential pulse voltammetry was performed in a 0.1 mol / L KCl solution within the range of -0.3 to 0.5 V, and the current peak value of 0.145 ± 0.1 V was recorded and denoted as I1. The change in the current peak value showed a good linear relationship with the logarithm of the carbofuran concentration. A standard curve was plotted based on the corresponding carbofuran concentration value, and the corresponding linear equation was obtained. The above carbofuran standard solution was replaced with the sample to be tested, and the same operation was performed to measure the change in the current peak value of 0.145 ± 0.1 V. The carbofuran content in the sample was calculated by substituting the measured current peak value into the obtained linear equation. The linear equation in the range of 1.0~100000 pg / L is: ΔI (10 -5 A) = 0.8792 LogC CBF (pg / L) +0.7736, correlation coefficient R 2 =0.9997; where ΔI=I0-I1, and C is the concentration of carbofuran; the detection limit of this method is 0.5 pg / L (S / N=3).

Images