A quality evaluation model and method for constant mountain astragalus root
By establishing a quality evaluation model based on agronomic traits, effective component content, and enzyme gene expression levels, the problem of diversified quality evaluation of Hengshan Astragalus was solved, and the quality characteristics of Astragalus were effectively expressed, providing a scientific basis for the breeding and cultivation of superior varieties.
Patent Information
- Application Number
- CN202310337989.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2043-03-31
AI Technical Summary
Existing technologies lack diversified methods for evaluating the quality of Astragalus membranaceus, making it difficult to effectively express its quality characteristics and affecting the selection and cultivation of superior varieties.
A quality evaluation model based on agronomic traits, effective component content, and enzyme gene expression was established, including the detection and correlation analysis of root agronomic trait indicators, effective component content, and synthase gene expression. The detection was performed using HPLC-UV/ELSD and real-time quantitative PCR.
Diverse quality evaluation methods can effectively express the quality characteristics of Hengshan Astragalus, providing a scientific basis for the selection of superior varieties and improving cultivation efficiency.
Smart Images

Figure CN116559387B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of raw material quality evaluation, and particularly relates to a quality evaluation model and a quality evaluation method of Hengshan Astragalus membranaceus. BACKGROUND
[0002] Hengshan Astragalus membranaceus is a Shanxi local medicinal material, and is named after being mainly produced in Hengshan Mountain and the surrounding area, and is a synonym of Chinese high-quality Astragalus membranaceus. The Hengshan Astragalus membranaceus on the market is mostly Mongolian Astragalus membranaceus, which is perennial and has the self-interbreeding incompatibility characteristic, and the good seed selection work of the Hengshan Astragalus membranaceus is relatively lagging at the present stage, and the genetic resources are still relatively chaotic. Therefore, it is of great significance to preliminarily find the correlation among agronomic traits, effective component content and gene expression quantity from the existing Astragalus membranaceus grown in the Hengshan area for the selection of excellent varieties of Astragalus membranaceus.
[0003] At present, the correlation research on the agronomic traits and effective component content of Astragalus membranaceus is mostly focused on the correlation analysis of root traits and root effective component content, and there is little report on the correlation research among deeper root agronomic traits, effective component content and enzyme gene expression quantity of synthesized effective components. Lindermayr C found that the 4CL gene family can participate in the growth and development of plants; Song Dongliang found that the 4CL gene can participate in the metabolism of lignin, which is a kind of phenolic polymer and mainly participates in the composition of secondary cell wall and exists in the form of high cross-linking in the secondary cell wall, which can enhance the mechanical support ability of plants; Zhao Ying found that the 4CL gene can participate in the synthesis of flavonoids such as calycosin-7-glucoside in roots. Therefore, the field expects more diversified effective evaluation of the quality of Hengshan Astragalus membranaceus to provide technical support for the good seed selection and extensive cultivation of Hengshan Astragalus membranaceus. SUMMARY
[0004] Therefore, the technical problem to be solved by the present application is to provide a quality evaluation model of Hengshan Astragalus membranaceus, which can effectively express the quality characteristics of Hengshan Astragalus membranaceus based on the diversified quality evaluation of Hengshan Astragalus membranaceus from the aspects of agronomic traits, effective component content and enzyme gene expression quantity of synthesized effective components.
[0005] The second technical problem to be solved by the present application is to provide a method for evaluating the quality of Hengshan Astragalus membranaceus based on the characteristics such as agronomic traits, effective component content and enzyme gene expression quantity of synthesized effective components.
[0006] To solve the above technical problems, the quality evaluation model of Hengshan Astragalus membranaceus provided by the present application comprises the following quality evaluation indexes:
[0007] (a) the agronomic trait index of the root of Hengshan Astragalus membranaceus;
[0008] (b) the content of effective components in Hengshan Astragalus membranaceus;
[0009] (c) the expression amount of the effective component synthesis enzyme gene in the Hengshan Astragalus.
[0010] Specifically, the quality evaluation model of the Hengshan Astragalus, the agronomic trait indexes of the root of the Hengshan Astragalus include the root length, root weight, and root thickness value of the Hengshan Astragalus.
[0011] Specifically, the quality evaluation model of the Hengshan Astragalus, the effective components of the Hengshan Astragalus include calycosin-7-glucoside, ononin, calycosin, formononetin, and astragaloside IV.
[0012] Specifically, the quality evaluation model of the Hengshan Astragalus, the effective component synthesis enzyme gene in the Hengshan Astragalus includes a key enzyme gene for synthesizing ketone components and / or a key enzyme gene for synthesizing saponin components.
[0013] Preferably, the key enzyme gene for synthesizing ketone components includes 4CL gene, I3'H gene, CHR gene, CHI gene, IFS gene, PAL gene, C4H gene, CHS gene, IOMT gene, and / or UCGT gene.
[0014] Preferably, the key enzyme gene for synthesizing saponin components includes HMGS gene, HMGR1 gene, HMGR2 gene, HMGR3 gene, MK gene, MVD gene, IDI gene, PMK gene, FPS gene, SS gene, SE gene, CAS gene, and / or AACT gene.
[0015] The application further discloses a quality evaluation method of the Hengshan Astragalus, which comprises the step of detecting the Hengshan Astragalus according to the indexes in the quality evaluation model.
[0016] Specifically, the quality evaluation method of the Hengshan Astragalus comprises the following steps:
[0017] (1) detecting the agronomic trait indexes of the Hengshan Astragalus;
[0018] (2) detecting the effective component content in the Hengshan Astragalus;
[0019] (3) detecting the expression amount of the effective component synthesis enzyme gene in the Hengshan Astragalus;
[0020] (4) respectively analyzing the correlation of the agronomic trait indexes, the effective component content, and the expression amount of the effective component synthesis enzyme gene of the Hengshan Astragalus.
[0021] Specifically, the quality evaluation method of the Hengshan Astragalus, in the step (2), the step of detecting the effective component content in the Hengshan Astragalus is detected by using the HPLC-UV / ELSD method.
[0022] Preferably, the HPLC-UV / ELSD detection step conditions include:
[0023] Chromatographic column Waters C 18 Symmetry;
[0024] Column temperature 25±5℃;
[0025] Flow rate 1.0 mL / min;
[0026] Injection volume 10 μL;
[0027] Detection wavelength 260 nm;
[0028] Mobile phase acetonitrile (A)-0.2% formic acid (B);
[0029] Elution using binary gradient elution mode: 0-5 min, 2.2%-2.3% A, 5-10 min, 2.3%-2.4% A, 10-14 min, 2.4%-9.0% A, 14-23 min, 9.0%-12.0% A, 23-30 min, 12.0%-19.3% A, 30-38 min, 19.3%-24.3% A, 38-45 min, 24.3%-28.8% A, 45-47 min, 28.8%-29.2% A, 47-55 min, 29.2%-29.3% A, 55-56 min, 29.3%-30.0% A, 56-57.5 min, 30.0%-34.0% A, 57.5-58.5 min, 34.0%-40.0% A, 58.5-66.5 min, 40.0%-40.0% A, 66.5-70.0 min, 40.0%-60.0% A, 70.0-75.0 min, 60.0%-60.0% A;
[0030] Evaporative light scattering detector parameters: Evaporation temperature 75℃, gas flow 2.5 mL / min, signal gain 3, sampling frequency 20 Hz.
[0031] Specifically, in the step (3), the expression amount of the effective component synthesis enzyme gene in the Hengshan Astragalus is detected by using real-time fluorescent quantitative PCR method.
[0032] Preferably, the primers for different target genes include:
[0033] PAL-F: CATCAAATCTCTCTGGCAGTAGGAA;
[0034] PAL-R: AGTTCACATCTTGGTTATGCTGCTC;
[0035] C4H-F: AACAAAGTGAGGGATGAAATTGACA;
[0036] C4H-R: GGATTGCCATTCTTAGCCTTAGTGT;
[0037] 4CL-F: TGTCCCTCCTATTGTTTTGGCTATT;
[0038] 4CL-R: CTTTGGGGAATTTAGCTCTGACAGT;
[0039] CHS-F: CCTTCTTTGGATGCTAGACAAGACA;
[0040] CHS-R: CGAAGACCCAAGAGTTTGGTTAGTT;
[0041] CHR-F: AAACAAGGTTACAGGCATTTTGACA;
[0042] CHR-R: GGAAGAACGAGATGAGGATGATTTT;
[0043] CHI-F: ATCGAGTTTTTCCACCAGGATCTAC;
[0044] CHI-R: ATCATAGTCTCCAACACAGCCTCAG;
[0045] IFS-F: CCTTCACCTATTGGACAAACCTCTT;
[0046] IFS-R: CCTGGTATTAAAGGAAGAAGCCTCA;
[0047] IOMT-F: TGAGGGAATGGCAAGTGA;
[0048] IOMT-R: CCCAGCAAGTTAGCGACA;
[0049] I3'H-F: GGATGTTAAAGAAGCGAAGCAATTT;
[0050] I3'H-R: ATCAAACAATCTCAACAAAGGCAAA;
[0051] UCGT-F: GAACTCGACTCTGGAAAGTGTGTGT;
[0052] UCGT-R: GGTGCATAAATCTTCAAAACCTCAG;
[0053] AACT-F: GGTGAGCGGAGAGAAGGCAT;
[0054] AACT-R: CGAGTGCTGGAGCGGTTGTA;
[0055] HMGS-F: CCTTCTTCGGCATTGCTTTCATC;
[0056] HMGS-R: TCGAGATCCCGGCTTTGGTA;
[0057] HMGR1-F: CCTTCTTCGGCATTGCTTTCATC;
[0058] HMGR1-R: ACTCCGGCAGTGGTTTCCTG;
[0059] HMGR2-F: GCCGGCCACCATAAACGA;
[0060] HMGR2-R: CGACGGAGAAGAAGAGGGTGAA;
[0061] HMGR3-F: GCCGGCCACCATAAACGA;
[0062] HMGR3-R: GGTCGGCAATTTTCGATGGTAG;
[0063] MK-F: AACATGCCGTTGTTCACGGA;
[0064] MK-R: AACTCCAATGCCGCATCGTT;
[0065] PMK-F: AGATCACCCGGACAGGAAGGA;
[0066] PMK-R: CCGCACATAGCGATGACTTCC;
[0067] MVD-F: TAAGGGAGATCCGCGCTCGT;
[0068] MVD-R: CAGCTGACGAAGCCAGTCCA;
[0069] IDI-F: TGCTGGTGAGGGAGGTTTGAA;
[0070] IDI-R: TCATGTCAGCGACCTCACCAA;
[0071] FPS-F: CGACCGGATGCTGGACTACA;
[0072] FPS-R: CCAACCAAGAGCACTGGCAA;
[0073] SS-F: AAGCAGATCCCTCCGGAACC;
[0074] SS-R: ACAGCGTTGCGAAGTTCGGT;
[0075] SE-F: TGGAACAAGGAACCGTGACATCT;
[0076] SE-R: ACAAAGAGAACGCCTCAAGTTGGA;
[0077] CAS-F: TGGAGATTTCCCACAGCAGGA;
[0078] CAS-R: CAAGTTGCGGCATTTGGTGT;
[0079] 18S RNA-F: TGCAGAATCCCGTGAACCATC;
[0080] 18S RNA-R: AGGCATCGGGCAACGATATG.
[0081] Specifically, in the step (4), the correlation between the agronomic trait indexes, the effective component content and the expression amount of the effective component synthesis enzyme gene of the Hengshan Astragalus includes: the root thickness, the root length and the root weight of the Hengshan Astragalus are positively correlated with each other, and are negatively correlated with the flavonoid component content and positively correlated with the saponin component content; the thicker the root of the Hengshan Astragalus is, the lower the flavonoid component content in the root is, the higher the saponin component content in the root is, and the higher the expression amount of the 4CL, I3'H, HMGR1, MK, MVD and IDI genes in the root is.
[0082] The application further discloses application of the quality evaluation model or the quality evaluation method in the quality evaluation field of the Hengshan Astragalus.
[0083] The quality evaluation model of Hengshan Astragalus can provide certain theoretical reference for directional breeding of Hengshan Astragalus by determining agronomic characters of roots of the Hengshan Astragalus, contents of effective components, and expression amounts of key enzyme genes for synthesizing flavonoids and saponins, and by exploring correlations among the root characters of the Hengshan Astragalus, the effective component contents, and the expression amounts of the key enzyme genes for synthesizing flavonoids and saponins.
[0084] The quality evaluation model of Hengshan Astragalus is based on the basic principles of high content of test samples, easy measurement, good quality of control samples, and easy acquisition, and selects calycosin-7-glucoside, ononin, calycosin, formononetin, and astragaloside as the research indexes, as important pharmacodynamic material bases for tonifying qi and blood of Astragalus, and the five components have good curative effects on treating various complex diseases and can be used as quality markers for evaluating quality of Astragalus. The evaluation method can provide certain help for selection and breeding of Astragalus in the future, and when calycosin-7-glucoside with neuroprotective and antioxidant stress effects is used as a breeding target, the Astragalus with thinner stems can be regarded as high-quality Astragalus, thereby providing a scientific basis for selection and cultivation of Hengshan Astragalus plants.
[0085] The quality evaluation method of Hengshan Astragalus can be used for determining agronomic characters, main effective component contents, and effective component synthesis enzyme gene expression amounts of Hengshan Astragalus, and for characterizing and analyzing correlations among the three. It can be found that the root thickness, the root length, and the root weight are positively correlated with each other, and are negatively correlated with the flavonoid content and positively correlated with the saponin content in Hengshan Astragalus; and with the increase of the root thickness, the expression amounts of 4CL, I3'H, HMGR1, and MK genes in the roots significantly increase, and the expression amounts of MVD and IDI genes have an increasing trend but the significance is not strong or not significant. The quality evaluation method of Hengshan Astragalus can show that the thicker the root of Hengshan Astragalus is, the lower the flavonoid content in the root is, the higher the saponin content in the root is, and the higher the expression amounts of 4CL, I3'H, HMGR1, MK, MVD, and IDI genes in the root are, and the six genes can be used as switches for regulating the root thickness and the contents of flavonoids and saponins in Hengshan Astragalus, and the early regulation of the six genes in the roots of Hengshan Astragalus can realize the optimal solution of double high of the plant root thickness and the effective component content, thereby providing technical support for optimized breeding of Hengshan Astragalus. BRIEF DESCRIPTION OF DRAWINGS
[0086] In order to make the content of the present application more easily understood, the present application is further described in detail below according to specific embodiments of the present application and in conjunction with the drawings, in which,
[0087] Figure 1HPLC-UV / ELSD chart of standard solution (A) and sample solution (B); wherein, 1-calycosin-7-glucoside, 2-ononin, 3-calycosin, 4-formononetin, 5- astragaloside IV;
[0088] Figure 2 Heat map of correlation between effective component content and agronomic traits of Hengshan Astragalus membranaceus (Fisch.) Bunge;
[0089] Figure 3 Correlation analysis result between expression amount of key enzyme gene for synthesizing flavonoid component and root thickness;
[0090] Figure 4 Correlation analysis result between expression amount of key enzyme gene for synthesizing saponin component and root thickness. DETAILED DESCRIPTION
[0091] In the following examples of the present application, the devices involved include:
[0092] Digital display constant temperature water bath (Changzhou Guoyu Instrument Manufacturing Co., Ltd., HH-S6);
[0093] Pharmacopoeia sieve (Shaoxing Shangyu Shengchao Instrument and Equipment Co., Ltd., four eyes);
[0094] Oven (Shanghai Boxun, HPX-9162MBE);
[0095] Universal pulverizer (Red Fairy Trade, DE-100g, DE-50g);
[0096] Ultrasonic cleaner (Ningbo Xinzhi Biology, SB25-12DTDN);
[0097] High performance liquid chromatograph (e2695-2998, USA Waters);
[0098] Evaporative light scattering detector (Shanghai Tongwei, UM5800Plus);
[0099] Air pump (Shanghai Tongwei, UMA-10LP);
[0100] Waters C 18 Chromatographic column (250*4.6mm*5um, serial number: 03313027214053, USA Waters Corporation);
[0101] Real-time fluorescent quantitative PCR instrument (Bio-Rad Company, model: CFX96 TM Real-Time System);
[0102] Electronic balance (Sartorius, BSA223S);
[0103] High-speed centrifuge (Thermo Fisher SCIENTIFIC, Pico21);
[0104] Ultra-micro UV spectrophotometer (Thermo Fisher SCIENTIFIC, NanoDrop One);
[0105] PCR instrument (BIO-RAD, C1000 Touch TM Thermal Cycler);
[0106] Electrophoresis power supply (BIO-RAD, PowerPac TM Universal);
[0107] Gel imager (Tanon, Tanon 3500R).
[0108] The reagents involved in the following examples of the present application include:
[0109] Formic acid, acetonitrile (OCEANPAK, chromatographically pure);
[0110] Calycosin-7-glucoside reference substance (Shanghai Ronghe, 20633-67-4);
[0111] Formononetin reference substance (Shanghai Ronghe, 485-72-3), purity ≥98%;
[0112] Calycosin reference substance (Shanghai Ronghe, 20575-57-9), purity ≥98%;
[0113] Formononetin reference substance (Shanghai Ronghe, 486-62-4), purity ≥98%;
[0114] Astragaloside Ⅳ reference substance (Shanghai Ronghe, 84687-43-4), purity ≥98%;
[0115] Column type polysaccharide polyphenol plant RNA extraction kit (Solypure, R2060);
[0116] Universal reverse transcription kit (M-MLV) (Solypure, RP1105);
[0117] TB Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) (Takara, RR820A).
[0118] Sample pretreatment of Example 1
[0119] The constant mountain astragalus used in this embodiment was collected by the members of the research group in Hunyuan in June 2022, and all were 5-year-old wild-like Mongolian astragalus Astragalus membranaceus (Fisch.) Bge. var. mongholicus (Bge.) Hsiao, a total of 45 strains, identified by Shanxi Food and Drug Inspection Institute as Astragalus membranaceus (Fisch.) Bge. var. mongholicus (Bge.) Hsiao of Leguminosae, and stored in the biological sample bank of the collaborative innovation center of astragalus resource industrialization and internationalization of Shanxi University of Chinese Medicine.
[0120] The collected constant mountain astragalus was removed from the sand, reed head, and the agronomic trait indexes such as root diameter and root length were measured. According to the measurement results, 15 strains with root diameter >1.33 cm were classified as "thick" group, 15 strains with 1.12 cm > root diameter > 1.33 cm were classified as "medium" group, and 15 strains with root diameter <1.12 cm were classified as "thin" group.
[0121] Respectively take 1-2 mm of xylem outer layer and phloem inner layer tender fiber at 0-2 cm below the cut, and freeze storage, wait for use; the rest of the medicinal materials are washed with running water, dried in a 55°C oven, cut into sections, and then pulverized with a universal pulverizer, and sieved (four No. pharmaceutical sieve), and used.
[0122] Example 2 Measurement of Agronomic Traits
[0123] In this embodiment, the agronomic trait data of the astragalus samples treated in the above-mentioned embodiment 1 were measured. Among them, the root length of the astragalus was measured as the distance from the root cut to the root tip, the root diameter was measured as the diameter at 3.5 cm below the cut, and the root weight was measured as the mass of the part from the root cut to the root tip. The root length and root diameter data of each astragalus were recorded, and the results are shown in Table 1 below.
[0124] Table 1 Agronomic trait determination results of 45 astragalus strains
[0125]
[0126]
[0127] Example 3 Effective component content determination
[0128] In this embodiment, the effective component content of the astragalus samples treated in the above-mentioned embodiment 1 was detected, and the detection components included calycosin-7-glucoside, formononetin, calycosin, calycosin-7-glucoside, and astragaloside A. The specific determination method was detected by HPLC method.
[0129] Preparation of solutions
[0130] Preparation of mixed reference solution: 7.5 mg of calycosin-7-glucoside, 3.7 mg of formononetin, 2.5 mg of calycosin, 1.2 mg of ononin were accurately weighed into a 5 mL brown volumetric flask, dissolved with methanol, and diluted to the mark. An appropriate amount of astragaloside IV reference substance was accurately weighed, and 80% methanol was added to prepare a solution containing 0.5 mg per 1 mL.
[0131] Preparation of test solution: The preparation method of flavonoid active ingredients and astragaloside IV test solution was prepared according to the method shown in the first part of the 2020 edition of Chinese Pharmacopoeia.
[0132] According to the literature, the roots of Hengshan Huangqi were washed clean, dried in a 55°C oven, cut into sections, pulverized, passed through a No. 4 sieve, 1 g of Hengshan Huangqi powder was accurately weighed into a round-bottom flask, 50 mL of methanol was accurately added, the mass was determined, heated to reflux for 4 h, cooled, the mass was determined again, the lost mass was made up with methanol, shaken well, filtered, 25 mL of the filtrate was accurately measured, the solvent was recovered to dryness, the residue was dissolved with methanol, transferred to a 5 mL volumetric flask, added with methanol to the mark, and shaken well to obtain the test solution.
[0133] Chromatographic conditions
[0134] Chromatographic column: Waters C 18 Symmetry (batch number: 0331302721);
[0135] Column temperature: 25 ± 5°C;
[0136] Flow rate: 1.0 mL / min;
[0137] Injection volume: 10 μL;
[0138] Detection wavelength: 260 nm;
[0139] Mobile phase: acetonitrile (A) - 0.2% formic acid (B);
[0140] Elution was performed using a binary gradient elution mode: 0-5 min, 2.2%-2.3% A; 5-10 min, 2.3%-2.4% A; 10-14 min, 2.4%-9.0% A; 14-23 min, 9.0%-12.0% A; 23-30 min, 12.0%-19.3% A; 30-38 min, 19.3%-24.3% A; 38-45 min, 24.3%-28.8% A; 45-47 min, 28.8%-29.2% A; 47-55 min, 29.2%-29.3% A; 55-56 min, 29.3%-30.0% A; 56-57.5 min, 30.0%-34.0% A; 57.5-58.5 min, 34.0%-40.0% A, 58.5-66.5min, 40.0%-40.0% A, 66.5-70.0min, 40.0%-60.0% A, 70.0-75.0min, 60.0%-60.0% A;
[0141] Evaporation light scattering detector parameters: evaporation temperature 75℃, gas flow rate 2.5mL / min, signal gain 3, sampling frequency 20Hz.
[0142] In this embodiment, the HPLC-UV / ELSD spectra of the reference solution and the sample solution are shown in the figure below. Figure 1 As shown in (A)-(B), the peaks in the spectrum represent: 1-verrucous isoflavone glucoside, 2-ammoniazolin, 3-verrucous isoflavone, 4-ammoniazolin, and 5-astragaloside A.
[0143] Example 4 Methodological Investigation
[0144] In this embodiment, a methodological investigation is conducted on the method for detecting the effective components of Astragalus membranaceus in Example 3 above.
[0145] Linearity and range
[0146] Accurately pipette 0.1 mL, 0.25 mL, 0.5 mL, 0.75 mL, and 1 mL of the mixed reference stock solution into five 5 mL volumetric flasks. Dilute with methanol and bring to the mark to obtain five gradient concentrations of the mixed reference solution. Inject and measure the solutions, and construct a regression equation with peak area as the ordinate (Y) and concentration as the abscissa (X). The results are shown in Table 2 below.
[0147] Table 2 Linear Relationships of Each Component
[0148] Ingredients Regression equation r Linear range / (pg / ml) Calycosin-7-glucoside Y = 25020X + 71882 0.9995 25.2-252 Formononetin Y = 43519X + 95440 0.9995 19.2-192 Calycosin Y = 148675X + 255897 0.9997 4-40 Formononetin Y = 67203X + 45547 0.9996 7.2-72
[0149] Precision test
[0150] The control solution was injected continuously 6 times, 1 portion each time, under the same chromatographic conditions as in Example 3, and the peak areas of the determined peaks were recorded. The results showed that the RSD values of the peak areas of calycosin-7-glucoside, formononetin, calycosin, and ononin after 6 injections were 0.43%, 0.41%, 0.43%, and 0.37%, respectively, indicating that the precision of the instrument was good.
[0151] Repeatability test
[0152] Six sample solutions of HYQ-19 were prepared according to the method shown in Example 3, and were injected for determination, and the RSD values of the peak areas of the determined peaks were recorded and calculated. The results showed that the RSD values of calycosin-7-glucoside, formononetin, calycosin, and ononin were 1.84%, 2.15%, 2.64%, and 2.34%, respectively, indicating that the repeatability of the method was good.
[0153] Stability test
[0154] At 0, 2, 4, 6, 8, and 12 h, the sample of HYQ-19 was injected according to the method in Example 3, and the RSD values of the peak areas of the determined peaks were calculated. The results showed that the RSD values of calycosin-7-glucoside, formononetin, calycosin, and ononin were 0.25%, 0.38%, 2.23%, and 0.51%, respectively, indicating that the stability of the sample solution was good within 12 h.
[0155] Recovery test
[0156] Nine samples of Astragalus membranaceus with known contents were precisely weighed, and the mixed control solution was precisely added at 50%, 100%, and 150% of the content of the effective components in the samples, with each mass concentration repeated 3 times. The sample solutions were prepared according to the method shown in Example 3, and were injected for determination, and the RSD values of the peak areas of the determined peaks were calculated. The average recovery rate was calculated, and the results are shown in Table 3. It can be seen that the RSD values were all less than 5%, indicating that the accuracy was good.
[0157] Table 3 Calculation results of the recovery rates of the four effective components in the roots of Astragalus membranaceus
[0158]
[0159] The effective components of the aforementioned 45 strains of Astragalus membranaceus were detected by the above method, and the results are shown in Table 4.
[0160] Table 4 Determination results of the contents of the effective components in 45 strains of Astragalus membranaceus
[0161]
[0162]
[0163] Example 5: Statistical analysis of the content of effective components and agronomic traits of Astragalus membranaceus
[0164] This embodiment uses SPSS 26.0 for statistical description and correlation analysis between factors, and OriginPro 2022 and Graphpad Prism 9.5.0 for plotting.
[0165] The effective component content and agronomic traits of the above 45 Astragalus plants were descriptively analyzed, and the results are shown in Table 5. The correlation heatmap between the effective component content and agronomic traits of Hengshan Astragalus is attached. Figure 2 The coefficients in the squares are correlation coefficients; the larger the coefficient, the stronger the correlation.
[0166] Table 5. Descriptive statistics of the results of the determination of the effective component content and agronomic traits of Astragalus membranaceus.
[0167] Ingredients Minimum Maximum Mean Standard deviation Coefficient of variation Calycosin-7-glucoside 0.031 0.406 0.151 0.091 0.605 Formononetin 0.008 0.111 0.031 0.021 0.668 Calycosin 0.001 0.004 0.002 0.001 0.278 Formononetin 0.000 0.002 0.001 0.001 1.333 Astragaloside IV 0.012 0.385 0.197 0.097 0.489 Root length 33.000 79.000 56.522 11.030 0.195 Root weight 0.005 0.245 0.054 0.046 0.850 Root thickness 0.134 2.704 1.311 0.437 0.333
[0168] As shown in Table 5, the contents of verbenaciferone glucoside, as collected in this invention from the 45 Astragalus plants ranged from 0.031% to 0.406%, astragaloside from 0.008% to 0.111%, verbenaciferone from 0.001% to 0.004%, astragalin from 0.000% to 0.002%, and astragaloside A from 0.012% to 0.385%. The coefficient of variation for astragalin was the highest at 1.333, while the coefficient of variation for root length was the lowest at 0.195.
[0169] like Figure 2 The results show that most agronomic traits of *Astragalus membranaceus* are negatively correlated with flavonoid content and positively correlated with saponin content. Among the correlations between agronomic traits and flavonoid content, only root thickness is positively correlated with gentianin content. The thicker the root of *Astragalus membranaceus*, the longer and heavier the root. Simultaneously, higher levels of gentianin and astragaloside A are associated with lower levels of verbascoside glucoside, verbascoside, and gentianin.
[0170] Example 6: Detection of expression levels of key enzyme genes in the synthesis of flavonoids and saponins
[0171] In this embodiment, the expression of key enzyme genes of synthetic flavonoids and saponin components in the processed Astragalus membranaceus sample in Example 1 above was detected. Among them, the key enzyme genes of synthetic flavonoids include PAL, C4H, 4CL, CHS, CHR, CHI, IFS, IOMT, I3'H, UCGT genes; the key enzyme genes of synthetic saponin components include AACT, HMGS, HMGR1, HMGR2, HMGR3, MK, PMK, MVD, IDI, FPS, SS, SE, CAS genes.
[0172] The total RNA of the root sample was extracted according to the column polysaccharide polyphenol RNA extraction kit instructions, the primer sequences are shown in Table 6 below, which were synthesized by Shanghai Biosynth. After extraction, the purity and concentration of the RNA were detected by ultramicro UV spectrophotometer, and the electrophoresis detection was performed on the RNA meeting the requirements.
[0173] Table 6 Primer information table
[0174]
[0175]
[0176] The qualified RNA sample was mixed according to the general reverse transcription kit (M-MLV) kit instructions to synthesize cDNA, and 2 μL of cDNA was added to 1 μL of primer before and after mixing, 12.5 μL of fluorescent dye, and sterilized water was added to 25 μL. 3 biological repeats, real-time fluorescent quantitative PCR instrument detection and 2 -ΔΔCt Quantitative, the reaction program of qPCR is: 95℃ 30s, 95℃ 5s, 60℃ 30s, 40 cycles of amplification.
[0177] The expression of key enzyme genes of synthetic flavonoids and saponin components in 45 strains of Astragalus membranaceus was determined by the above method, and the results are shown in Table 7 below.
[0178] Table 7 Gene expression data table of 45 strains of Astragalus membranaceus
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185] Example 7: Statistical analysis of the correlation between the expression level of key enzyme genes for flavonoid synthesis and root diameter.
[0186] This embodiment uses SPSS 26.0 for statistical description and correlation analysis between factors, and OriginPro 2022 and Graphpad Prism 9.5.0 for plotting.
[0187] The statistical results of the correlation between the expression levels of key enzyme genes synthesizing flavonoids and root diameter in 45 Astragalus plants in this example are attached. Figure 3 .
[0188] like Figure 3 The results show that the expression levels of most key enzyme genes involved in the synthesis of flavonoids are related to root thickness. Among them, the expression levels of 4CL and I3'H genes are positively correlated with root thickness, and the expression levels of 4CL and I3'H genes in roots increase significantly with increasing root thickness. The expression levels of CHR, CHI, and IFS genes are negatively correlated with root thickness, and the expression levels of these three genes tend to decrease with increasing root thickness, but the significance is not strong or not significant.
[0189] Example 8: Correlation analysis of expression levels of key enzyme genes in the synthesis of saponins and root diameter
[0190] This embodiment uses SPSS 26.0 for statistical description and correlation analysis between factors, and OriginPro 2022 and Graphpad Prism 9.5.0 for plotting.
[0191] The statistical results of the correlation between the expression levels of key enzyme genes for synthetic saponins and root diameter in 45 Astragalus plants in this example are attached. Figure 4 .
[0192] like Figure 4 The results show that the expression levels of most key enzyme genes involved in the synthesis of saponins are related to root thickness. Among them, the expression levels of HMGR1 and MK genes are positively correlated with root thickness, and the expression levels of these two genes increase significantly with increasing root thickness. The expression levels of MVD and IDI genes show an increasing trend with increasing root thickness, but the significance is not strong or not significant. The expression level of HMGR2 gene is negatively correlated with root thickness, and the thicker the root, the lower the expression level of this gene.
[0193] Example 9
[0194] In this embodiment, the Hengshan Astragalus samples were collected from Hunyuan, Yingxian and Tianzhen in October 2021 using the five-point sampling method. All of them were 5-year-old wild-like Astragalus membranaceus (Fisch.) Bge. var. mongholicus (Bge.) Hsiao. A total of 92 samples were identified as authentic products by Shi Xianhai, chief pharmacist of Shanxi Food and Drug Inspection Institute, and were stored in the biological sample bank of the Collaborative Innovation Center for Astragalus Resource Industrialization and Internationalization of Shanxi University of Chinese Medicine.
[0195] According to the method and index in the preceding embodiment 2, the root length, root weight, aboveground biomass, stem diameter, plant height, and root diameter of 92 Hengshan Astragalus samples were determined. The plant height was the distance from the top of the aboveground part of the plant to the base of the plant, the stem diameter was the diameter of the base of the plant, the root length was the distance from the cut end of the root to the root tip, the root diameter was the diameter at 3.5 cm below the cut end, the aboveground biomass was the mass of the aboveground part (stem + leaf), and the root weight was the mass of the part from the cut end of the root to the root tip. The detection results are shown in Table 8 below.
[0196] Table 8: Agronomic trait determination results of 92 Astragalus samples
[0197]
[0198]
[0199]
[0200] According to the method described in the preceding embodiment 3, the effective components of Astragalus were determined, and the results are shown in Table 9 below.
[0201] Table 9: Effective component content determination results of 92 Astragalus samples
[0202]
[0203]
[0204]
[0205]
[0206]
[0207] In this embodiment, simple correlation analysis and stepwise regression analysis were performed using SPSS 26.0 software to lock the R 2 The highest regression equation was further analyzed by path analysis to explore the correlation between the effective component content and the agronomic traits.
[0208] According to the description statistics of the effective component content and agronomic trait indicators obtained by the above detection, the determination results are shown in Table 10.
[0209] Table 10 Determination results of effective component content and agronomic trait indexes of 92 strains of Huangqi in Hengshan
[0210] Item Minimum Maximum Mean Standard deviation Coefficient of variation / % Calycosin-7-glucoside 0.002 0.128 0.034 0.025 72.150 Formononetin 0.001 0.054 0.013 0.010 76.920 Calycosin 0 0.026 0.004 0.005 126.770 Formononetin 0 0.010 0.001 0.002 151.420 Astragaloside IV 0.022 0.254 0.117 0.050 42.400 Root length 17.000 170.000 68.770 29.050 42.240 Root weight 0.005 0.260 0.081 0.062 76.430 Aboveground biomass 0.001 0.275 0.029 0.039 134.170 Stem thickness 0.210 0.970 0.489 0.156 31.800 Plant height 4.800 145.000 77.693 33.044 42.530 Root thickness 0.430 3.184 1.494 0.465 31.150
[0211] It can be seen that the content of calycosin-7-glucoside of 92 strains of Huangqi is distributed in the range of 0.002%-0.128%, the content of ononin is distributed in the range of 0.001%-0.054%, the content of calycosin is distributed in the range of 0-0.026%, the content of formononetin is distributed in the range of 0-0.010%, and the content of astragaloside IV is distributed in the range of 0.022%-0.254%. Among them, the coefficient of variation of formononetin is the largest, being 151.42%, and the coefficient of variation of root thickness is the smallest, being 31.15%.
[0212] According to the results of determination of agronomic traits and effective component content, correlation analysis was carried out, and the results are shown in Table 11.
[0213] Table 11 Simple correlation analysis of main effective content in root of Huangqi in Hengshan and agronomic traits
[0214]
[0215]
[0216] Note: * P<0.05 indicates significant correlation, ** P<0.01 indicates extremely significant correlation.
[0217] It can be seen that most of the agronomic traits are significantly negatively correlated with glycoside components and significantly positively correlated with aglycone components. Among the correlation of agronomic traits and aglycone components, only root length has a negative effect on the content of calycosin. The content of calycosin-7-glucoside is significantly negatively correlated with root weight, aboveground biomass, plant height, root thickness, stem thickness and root length. The number of species of effective component content that is significantly correlated with root weight is the most, up to 3 species. The number of species of effective component content that is significantly correlated with the rest of the agronomic traits is not much different, being 1-2 species. Stem thickness and plant height can establish a significant positive correlation with root weight and root thickness, but cannot establish a correlation with root length.
[0218] According to the results of determination of agronomic traits and effective component content, stepwise regression analysis was carried out, and the content of 5 kinds of effective components in root was taken as dependent variable, represented by Y1, Y2, Y3, Y4 and Y5 respectively, and the rest of the variables were taken as independent variable (X). Stepwise regression analysis equation was established, and the results are shown in Table 12.
[0219] Table 12 Summary table of stepwise regression analysis equation
[0220] Ingredients Regression equation [R 2 ]]> Calycosin-7-glucoside [Y1 = 0.016 - 0.019X 茎粗 + 1.170X 毛蕊异黄酮 - 3.393X 芒柄花素 + 2.170X 芒柄花苷 ]]> 0.825 Calycosin [Y2 = 0.001 + 1.903X 芒柄花素 ]]> 0.629 Formononetin [Y3 = 0.001 - 0.04X 株高 + 0.323X 毛蕊异黄酮 + 0.067X 芒柄花苷 ]]> 0.689 Formononetin [Y4 = 0.001 + 0.345X 株高 ]]> 0.782 Astragaloside IV [Y5 = 0.202 + 0.000367X 株高 - 0.111X 茎粗 - 0.039X 根粗 ]]> 0.260
[0221] From the above results, when the calycosin-7-glucoside content is the dependent variable and other indicators are independent variables, the regression equation R 2 is 0.825; when the astragaloside IV content is the dependent variable and other indicators are independent variables, the R 2 is only 0.260. Taking the regression equation of the calycosin-7-glucoside content as an example, for every 1 unit increase in the average calycosin-7-glucoside content in the root, the average stem diameter decreases by 0.019 units, the calycosin content increases by 1.170 units, the formononetin content decreases by 3.393 units, and the calycosin-7-glucoside content increases by 2.170 units. The same applies to the other equations.
[0222] In the above results, the parameter R 2 represents the degree of explanation of the regression model, and the greater the degree of explanation. Therefore, the regression equation with the highest R 2 value, i.e., Y1=0.016-0.019X 茎粗 +1.170X 毛蕊异黄酮 -3.393X 芒柄花素 +2.170X 芒柄花苷 (R 2 =0.825), is subjected to a deeper path analysis, and the results are shown in Table 13 below.
[0223] Table 13 Path Analysis Table
[0224]
[0225] From the above results, the four independent variables have a direct impact on the calycosin-7-glucoside content in the root, and the order of the direct impact is formononetin content > calycosin-7-glucoside content > calycosin content > stem diameter. Among them, whether from the direct effect or the indirect effect, the stem diameter ultimately has a negative effect on the calycosin-7-glucoside content in the root, while the calycosin-7-glucoside and formononetin ultimately have a positive effect on the accumulation of calycosin-7-glucoside in the root. Although calycosin has a positive direct effect on the accumulation of calycosin-7-glucoside in the root, due to the greater negative effect of other components, the accumulation of calycosin ultimately has a negative correlation with the accumulation of calycosin-7-glucoside.
[0226] The present embodiment analyzes the correlation and quantitative relationship between the content of main effective components and the agronomic traits of Hengshan Astragalus by correlation analysis and regression model construction, and preliminarily explains the simple correlation and change rule between the indexes; the simple correlation coefficient is decomposed into direct path coefficient and indirect path coefficient by the decomposition of path analysis, and the action mode and size between the indexes are further clarified. It can be seen that in the Hengshan Astragalus sample, the thicker the stem of Astragalus, the thicker the root, and the lower the content of astragaloside A in the root. In addition to the correlation between root thickness and effective components, the present application also finds that the thicker the stem of Astragalus, the lower the content of calycosin-7-glucoside in the root, which is the first exploration of the relationship between the agronomic traits of Astragalus and the content of calycosin-7-glucoside, and provides technical support for the resource development and utilization of Hengshan Astragalus.
[0227] In summary, the present application evaluates the correlation between the content of main effective components in the root of Hengshan Astragalus and the agronomic traits, the expression amount of key enzyme genes of synthesized flavonoids and saponin components, and can be used for evaluating and characterizing the quality of Hengshan Astragalus. The results of the present application show that the thicker the root of Astragalus, the higher the expression amount of 4CL gene, and the lower the content of flavonoids, so it can be inferred that 4CL gene has the effects of promoting root diameter growth and synthesizing flavonoids in Astragalus, and in this effect, the effect of promoting root diameter growth is dominant. Similarly, the present application also finds that the effect produced by the expression of I3'H gene is consistent with that of 4CL gene, that is, the higher the expression amount of I3'H gene, the thicker the root, and the lower the content of flavonoids; the expression effects of HMGR1, MK, MVD and IDI genes are similar to but different from the expression effect of 4CL gene: the higher the expression amount of HMGR1, MK, MVD and IDI genes, the thicker the root, and the higher the content of saponin components in the root, indicating that the expression of HMGR1, MK, MVD and IDI genes has synergistic effect on the effects of causing root diameter growth and synthesizing saponin.
[0228] Therefore, the present application screens 4CL, I3'H, HMGR1, MK, MVD and IDI genes in the root of Hengshan Astragalus as the "switch" for regulating the root thickness and the content of flavonoids and saponin components, and through the early regulation of the six genes in the root of Hengshan Astragalus, the "optimal solution" of double high of plant root thickness and effective component content can be realized, and the specific mechanism is further studied.
[0229] Obviously, the above embodiments are only examples for clear illustration, and are not limitations on the embodiments. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Here, all the embodiments need not and cannot be exhausted. The obvious changes or variations derived therefrom are still within the protection scope of the present application.
Claims
1. A quality evaluation method of Hengshan Astragalus, characterized in that, Comprise the following steps: (1) The agronomic traits index of the Hengshan Astragalus is detected, and the agronomic traits index of the Hengshan Astragalus is the root agronomic traits index; The root agronomic traits index includes the root length, root weight, and root thickness value of the Hengshan Astragalus; (2) The content of the effective components in the Hengshan Astragalus is detected; The effective components of the Hengshan Astragalus include calycosin-7-glucoside, lupein, calycosin, formononetin, and astragaloside A; (3) The expression amount of the effective component synthesis enzyme gene in the Hengshan Astragalus is detected; The effective component synthesis enzyme gene in the Hengshan Astragalus includes a key enzyme gene for synthesizing ketone components and / or a key enzyme gene for synthesizing saponin components; The key enzyme gene for synthesizing ketone components includes 4CL gene, I3'H gene, CHR gene, CHI gene, IFS gene, PAL gene, C4H gene, CHS gene, IOMT gene, and / or UCGT gene; The key enzyme gene for synthesizing saponin components includes HMGS gene, HMGR1 gene, HMGR2 gene, HMGR3 gene, MK gene, MVD gene, IDI gene, PMK gene, FPS gene, SS gene, SE gene, CAS gene, and / or AACT gene; (4) The agronomic traits index, the content of the effective components, and the expression amount of the effective component synthesis enzyme gene of the Hengshan Astragalus are analyzed for correlation; In step (4), the correlation of the agronomic traits index, the content of the effective components, and the expression amount of the effective component synthesis enzyme gene of the Hengshan Astragalus includes that the root thickness, root length, and root weight of the Hengshan Astragalus are positively correlated with each other, and are negatively correlated with the content of flavonoids and positively correlated with the content of saponins; The thicker the root of the Hengshan Astragalus is, the lower the content of flavonoids in the root is, the higher the content of saponins in the root is, and the higher the expression amount of 4CL, I3'H, HMGR1, MK, MVD, and IDI genes in the root is.
2. The quality evaluation method of Hengshan Astragalus according to claim 1, characterized in that, In step (2), the content of the effective components in the Hengshan Astragalus is detected by HPLC-UV / ELSD method; The HPLC-UV / ELSD detection step conditions include: Column Waters Symmetry 18 C18; 3.5 μm; 4.6 x 150 mm The column temperature is 25±5℃; The flow rate is 1.0 mL / min; The injection volume is 10 μL; The detection wavelength is 260 nm; The mobile phase is acetonitrile (A)-0.2% formic acid water (B); Elution used binary gradient elution mode: 0-5min, 2.2%-2.3% A, 5-10min, 2.3%-2.4% A, 10-14min, 2.4%-9.0% A, 14-23min, 9.0%-12.0% A, 23-30min, 12.0%-19.3% A, 30-38min, 19.3%-24.3% A, 38-45min, 24.3%-28.8% A, 45-47min, 28.8%-29.2% A, 47-55min, 29.2%-29.3% A, 55-56min, 29.3%-30.0% A, 56-57.5min, 30.0%-34.0% A, 57.5-58.5min, 34.0%-40.0% A, 58.5-66.5min, 40.0%-40.0% A, 66.5-70.0min, 40.0%-60.0% A, 70.0-75.0min, 60.0%-60.0% A; Evaporative light scattering detector parameters: Evaporation temperature 75℃, gas flow 2.5mL / min, signal gain 3, sampling frequency 20Hz.
3. The method for evaluating the quality of Hengshan Astragalus according to claim 1 or 2, characterized in that, In the step (3), the expression amount of the effective component synthesis enzyme gene in the Hengshan Astragalus is detected by using real-time fluorescent quantitative PCR method; The primers selected for different target genes include: PAL-F: CATCAAATCTCTCTGGCAGTAGGAA; PAL-R: AGTTCACATCTTGGTTATGCTGCTC; C4H-F: AACAAAGTGAGGGATGAAATTGACA; C4H-R: GGATTGCCATTCTTAGCCTTAGTGT; 4CL-F: TGTCCCTCCTATTGTTTTGGCTATT; 4CL-R: CTTTGGGGAATTTAGCTCTGACAGT; CHS-F: CCTTCTTTGGATGCTAGACAAGACA; CHS-R: CGAAGACCCAAGAGTTTGGTTAGTT; CHR-F: AAACAAGGTTACAGGCATTTTGACA; CHR-R: GGAAGAACGAGATGAGGATGATTTT; CHI-F: ATCGAGTTTTTCCACCAGGATCTAC; CHI-R: ATCATAGTCTCCAACACAGCCTCAG; IFS-F: CCTTCACCTATTGGACAAACCTCTT; IFS-R: CCTGGTATTAAAGGAAGAAGCCTCA; IOMT-F: TGAGGGAATGGCAAGTGA; IOMT-R: CCCAGCAAGTTAGCGACA; I3'H-F: GGATGTTAAAGAAGCGAAGCAATTT; I3'H-R: ATCAAACAATCTCAACAAAGGCAAA; UCGT-F: GAACTCGACTCTGGAAAGTGTGTGT; UCGT-R: GGTGCATAAATCTTCAAAACCTCAG; AACT-F: GGTGAGCGGAGAGAAGGCAT; AACT-R: CGAGTGCTGGAGCGGTTGTA; HMGS-F: CCTTCTTCGGCATTGCTTTCATC; HMGS-R: TCGAGATCCCGGCTTTGGTA; HMGR1-F: CCTTCTTCGGCATTGCTTTCATC; HMGR1-R: ACTCCGGCAGTGGTTTCCTG; HMGR2-F: GCCGGCCACCATAAACGA; HMGR2-R: CGACGGAGAAGAAGAGGGTGAA; HMGR3-F: GCCGGCCACCATAAACGA; HMGR3-R: GGTCGGCAATTTTCGATGGTAG; MK-F: AACATGCCGTTGTTCACGGA; MK-R: AACTCCAATGCCGCATCGTT; PMK-F: AGATCACCCGGACAGGAAGGA; PMK-R: CCGCACATAGCGATGACTTCC; MVD-F: TAAGGGAGATCCGCGCTCGT; MVD-R: CAGCTGACGAAGCCAGTCCA; IDI-F: TGCTGGTGAGGGAGGTTTGAA; IDI-R: TCATGTCAGCGACCTCACCAA; FPS-F: CGACCGGATGCTGGACTACA; FPS-R: CCAACCAAGAGCACTGGCAA; SS-F: AAGCAGATCCCTCCGGAACC; SS-R: ACAGCGTTGCGAAGTTCGGT; SE-F: TGGAACAAGGAACCGTGACATCT; SE-R: ACAAAGAGAACGCCTCAAGTTGGA; CAS-F: TGGAGATTTCCCACAGCAGGA; CAS-R: CAAGTTGCGGCATTTGGTGT; 18S RNA-F: TGCAGAATCCCGTGAACCATC; 18S RNA-R: AGGCATCGGGCAACGATATG.
4. The use of the quality evaluation method according to any one of claims 1-3 in the field of quality evaluation of Hedysari Radix from Mount Hengshan.