Application of Oroxylin B in the preparation of drugs for preventing and / or treating atherosclerosis

Abstract

The present invention provides the application of oroxindin B in the preparation of drugs for preventing and / or treating atherosclerosis, belonging to the fields of biotechnology and pharmaceutical technology. The present invention discovers through research that oroxindin B can be used to prepare Notch signaling pathway inhibitors. The oroxindin B can inhibit the protein of the key transcription factor RBPJ of the Notch pathway, change the expression / function of Notch cofactors or effector factors, thereby inhibiting the expression of downstream genes, and further achieving the purpose of inhibiting the development of AS and reducing the generation of atherosclerotic plaques. The oroxindin B has good application prospects in the preparation of drugs for preventing and / or treating atherosclerosis.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and medicine, and particularly relates to the application of oroxindin B in the preparation of drugs for preventing and / or treating atherosclerosis. Background Art

[0002] Atherosclerosis (AS) is a systemic arterial disease involving the interaction between endothelial cell dysfunction, macrophage inflammation, and vascular smooth muscle cell (VSMC) proliferation. During the development of atherosclerosis, lipids, fibrous tissue, inflammatory cells, and VSMCs gradually deposit on the arterial intima to form atherosclerotic plaques. In the early stage of atherosclerosis, there are generally no obvious symptoms. However, as the disease progresses, the plaque gradually invades the vascular lumen, hindering the normal blood flow of the blood vessel, and clinically manifested as coronary artery disease, stroke, transient ischemic attack, and peripheral arterial disease.

[0003] The conduction of Notch signal is mediated by highly conserved receptor-ligands and plays a key role in regulating cell proliferation, differentiation, apoptosis, etc. Adjacent Notch receptors interact with ligands, and through the cleavage of ADAM metalloprotease and γ-secretase, the intracellular domain (NICD) of the Notch receptor is released into the nucleus. RBPJ binds to NICD and recruits other co-transcription factors to achieve the regulation of downstream target genes HES1, HES5, HEY1, and HEY2.

[0004] In the aorta of APOE mice induced by high-fat diet - / - it was observed that the downstream genes of Notch, HES1, 5, 7, and HEY1, HEY2 were highly expressed, indicating that the Notch signaling pathway was abnormally activated during the occurrence and development of AS, and was positively correlated with the disease development of AS. Using the γ-secretase inhibitor DAPT to inhibit the expression of the Notch signaling pathway and its downstream target genes could reduce macrophage activity and plaque formation. The γ-secretase inhibitor blocks the Notch signal by inhibiting the cleavage of the Notch receptor. However, γ-secretase interacts with multiple signaling pathways, and inhibiting γ-secretase will inhibit multiple signaling pathways, resulting in very serious toxic side effects in the clinical trials of γ-secretase inhibitors. Selecting the key transcription factor RBPJ that can directly act on the Notch signaling pathway as a target is expected to avoid the problems caused by γ-secretase inhibitors. However, few RBPJ inhibitors have been developed. Therefore, it is of great significance to develop small molecule inhibitors of RBPJ transcription factors with structural diversity for anti-atherosclerosis.

[0005] Computer-aided drug screening can significantly reduce the cost and time of new drug research and development, and virtual screening technology has gradually become one of the core technologies of computer-aided drug design. Virtual screening is based on the conformation of the target protein or the structure of active small molecule ligands to screen and score the constructed compound library, and the compounds with high scores are used as lead compounds for further research and development. There are few existing developments of Notch signaling pathway inhibitors, and there is little reference inhibitor information. Virtual screening provides an effective technical means for the research and development of Notch pathway inhibitors and anti-atherosclerosis drugs.

[0006] Oroxin B, CAS No. 114482-86-9, molecular weight 594.5 g / mol, chemical name Baicalin-7-diglucoside, molecular formula C 27 H 30 O 15 , and the chemical structure is as follows:

[0007]

[0008] Oroxin B is a natural flavonoid compound extracted from Oroxylum indicum. Oroxylum indicum is a traditional Chinese medicine, mainly used for diseases such as cough due to lung heat and sore throat. Oroxin B has biological activities such as anti-tumor, anti-osteoarthritis, and anti-ulcer. Studies have found that Oroxin B can exhibit anti-osteoarthritis effects by inhibiting the PI3K / AKT / mTOR signaling pathway and enhancing the autophagy process. So far, there have been no reports on the use of Oroxin B as a Notch inhibitor to regulate the Notch signaling pathway to achieve anti-atherosclerosis effects. Summary of the Invention

[0009] In view of the deficiencies in the existing technology, the present invention provides the application of Oroxin B in the preparation of drugs for preventing and / or treating atherosclerosis; the present invention has found through research that Oroxin B can be used to prepare a Notch signaling pathway inhibitor, and the Oroxin B can inhibit the RBPJ protein, a key transcription factor of the Notch pathway, and change the expression / function of Notch cofactors or effector factors, thereby inhibiting the expression of downstream genes, and further achieving the purpose of inhibiting the development of AS and reducing the formation of atherosclerotic plaques; the Oroxin B has good application prospects in the preparation of drugs for preventing and / or treating atherosclerosis.

[0010] To achieve the above technical objectives, the present invention adopts the following technical means:

[0011] The present invention first provides the application of Oroxin B in the preparation of drugs for preventing and / or treating atherosclerosis.

[0012] Preferably, the application is that wogonoside B regulates the Notch signaling pathway.

[0013] Preferably, the regulation is to inhibit the Notch signaling pathway.

[0014] Preferably, the Notch signaling pathway is inhibited by the following methods:

[0015] (A) Inhibiting the key transcription factor RBPJ protein of the Notch pathway; and / or

[0016] (B) Altering the expression / function of Notch cofactors or effectors.

[0017] The present invention also provides a drug for preventing and / or treating atherosclerosis, and the active ingredient of the drug includes the above-mentioned wogonoside B.

[0018] The present invention also provides the application of the above-mentioned wogonoside B in the preparation of an RBPJ protein inhibitor.

[0019] The present invention also provides an RBPJ protein inhibitor, and the active ingredient of the inhibitor includes the above-mentioned wogonoside B.

[0020] The present invention also provides the application of the above-mentioned RBPJ protein inhibitor in the preparation of a product for preventing and / or treating diseases caused by abnormal activation of the Notch signaling pathway.

[0021] Preferably, the diseases caused by abnormal activation of the Notch signaling pathway include atherosclerotic drugs.

[0022] The present invention also provides a Notch signaling pathway inhibitor, and the active ingredient of the inhibitor includes the above-mentioned wogonoside B.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] The present invention screens out candidate compounds that can bind to the RBPJ protein through molecular docking, and analyzes the binding free energy of the candidate compounds and the RBPJ protein by using the molecular dynamics simulation method. Compared with the traditional research methods, the method of the present invention can effectively save costs and time and improve the screening efficiency.

[0025] The present invention designs and implements pharmacological experiments, and for the first time verifies that wogonoside B can be used as a Notch inhibitor. By inhibiting the activation of the Notch signaling pathway, the anti-atherosclerotic effect is achieved, and it has a significant therapeutic effect on cardiovascular diseases, providing a new way for broadening the screening and research and development of Notch signaling pathway inhibitors and anti-atherosclerotic drugs. Brief Description of the Drawings

[0026] Figure 1Schematic diagram of the binding of wogonoside B to the target protein RBPJ. Among them, A is the diagram of the interaction between the groups of wogonoside B and RBPJ, and B is the diagram of the spatial interaction between wogonoside B and RBPJ.

[0027] Figure 2 Schematic diagram of wogonoside B blocking the binding of protein RBPJ to DNA. Among them, A is the front view and B is the side view.

[0028] Figure 3 RMSD diagram of wogonoside B and RBPJ.

[0029] Figure 4 Effect diagram of wogonoside B with different concentrations on the proliferation in macrophages; Note: Compared with the blank group, mean±SD, n = 3, *P<0.05, **P<0.01, ***P<0.001.

[0030] Figure 5 Inhibitory effect diagram of wogonoside B on the mRNA gene expression of the Notch downstream target genes HES family and HEY family HES1, HES5, HEY1, and HEY2 in macrophages; Note: Compared with the blank group, mean±SD, n = 3, *P<0.05, **P<0.01, ***P<0.001. Detailed implementation mode

[0031] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make changes or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention. The methods, equipment, and materials in the following implementation cases, if not specifically stated, are all conventional methods, equipment, and materials in the art and can be purchased from the market.

[0032] Example 1: Screening and analysis of compounds specifically binding to the target protein RBPJ

[0033] In this example, molecular docking technology and molecular dynamics simulation technology are used to screen compounds specifically binding to the target protein RBPJ and analyze the interaction between the target protein RBPJ and the candidate compounds. The specific steps are as follows:

[0034] (1) Establishment of the compound database:

[0035] Collect compounds from TCMSP, PubChem, BindingDB databases and DrugBank, save them in SDF format, and establish a compound database.

[0036] (2) Collection of target proteins:

[0037] Collect and download the complex crystal structure of the RBPJ target protein from the PDB database. The downloaded file contains other molecules such as other proteins. Delete water molecules and other protein structures, and retain the RBPJ structure as the target protein structure file for molecular docking.

[0038] (3) Screening of compounds that specifically bind to the target protein RBPJ:

[0039] Using the molecular docking software MOE, with RBPJ as the docking acceptor, perform molecular docking with the compound library constructed in step (1) above. The docking results are sorted according to the optimized binding energy, and then further superimpose the compounds to block the binding of the target protein RBPJ to DNA. Select the compound with the best docking state, namely baicalein glycoside B, and use it for subsequent molecular dynamics simulation and pharmacological analysis.

[0040] Figure 1 is the binding schematic diagram of baicalein glycoside B and RBPJ. The left figure is the group interaction diagram of baicalein glycoside B and RBPJ, and the right figure is the spatial interaction diagram of baicalein glycoside B and RBPJ.

[0041] Figure 2 is the schematic diagram of baicalein glycoside B blocking the binding of protein RBPJ to DNA. The left figure shows the front view of the binding of DNA and RBPJ after the binding of baicalein glycoside B, and the right figure shows the side view of the binding of DNA and RBPJ after the binding of baicalein glycoside B. From Figure 2 It can be found that under normal circumstances, RBPJ binds to DNA to form a stable complex, which promotes the activation of the Notch signaling pathway under the action of NICD. However, when baicalein glycoside B binds to RBPJ, it interacts with RBPJ, resulting in a conformational change of RBPJ, making it unable to bind to DNA correctly, thereby inhibiting the activation of the Notch signaling pathway and the expression of downstream genes.

[0042] (4) Molecular dynamics simulation to analyze the binding stability and binding free energy of baicalein glycoside B and RBPJ:

[0043] Use the molecular dynamics simulation software Gromacs to perform molecular dynamics simulation, and select the GAFF force field as the force field for molecular dynamics simulation. The specific simulation process is as follows:

[0044] Use the gmx pdb2gmx command to generate the complex topology file, and then use gmx editconf to set the boundary. Place the complex formed by baicalin B and RBPJ protein in a cubic box with a boundary set to 1.1 nm. Subsequently, use the gmxsolvate command to add water molecules to the system with the water model being TIP3P, and then add Na + and Cl - to neutralize the system charge and make the system electrically neutral, while making the final concentration of NaCl 0.1 M. Perform energy minimization for 1000 steps, and then perform 1 ns of NVT and 1 ns of NPT equilibration under the condition of restricting the system position.

[0045] After the system is equilibrated, remove the position restriction and perform 10 ns of molecular dynamics simulation on the system. Use the gmx rms command to calculate the RMSD of the receptor, ligand, and complex respectively. The calculation results are as Figure 3 shown. Among them, the RMSD value represents the distance of the atoms in the target molecule from the initial position during the simulation, and to a certain extent, it can reflect the stability of the structure.

[0046] Figure 3 This is the RMSD graph of baicalin B and RBPJ. It can be seen from the graph that baicalin B fluctuates within a small range of 0.1 - 0.2 nm during 7 - 9 ns of kinetic simulation, and the fluctuation of the RMSD value in the kinetic simulation system tends to be flat within a certain range, indicating that the kinetic simulation system is stable and the data is true and reliable.

[0047] Calculate the binding free energy by the molecular mechanics / Poisson - Boltzmann surface area (MM / PBSA) method, and select the amino acids in the binding region for binding free energy decomposition. The results are shown in Table 1.

[0048] Table 1. Binding free energy of small molecule compound - protein

[0049] Compound Name Compound CID Number Binding Free Energy (kj / mol) Oroxylin B 10077207 -58.255

[0050] It can be seen from Table 1 that the binding free energy of baicalin B is -58.255 kJ / mol, indicating that baicalin B has a high binding affinity with RBPJ protein, can form a stable complex, and block the expression of Notch downstream genes.

[0051] Example 2: Verification of baicalin B inhibiting the Notch signaling pathway and anti - atherosclerotic cells

[0052] To investigate the inhibitory effect of oroxindin B on the Notch pathway and atherosclerosis, qRT-PCR was used to detect the effects of oroxindin B on the expression of downstream target genes HES1, HES5, HEY1, and HEY2 in the Notch signaling pathway in macrophages after administration. The specific steps are as follows:

[0053] Macrophages RAW264.7 (purchased from the Cell Bank of the Chinese Academy of Sciences' Type Culture Collection Committee) were cultured in complete medium prepared with DMEM high-glucose medium (purchased from Hyclone) and 10% fetal bovine serum (purchased from ExCell), and cultured under the conditions of 37 °C and 5% CO2. Discard the old medium, add 3 mL of fresh complete medium to the culture flask to disperse and wash down the adherent cells, and gently pipette evenly. After pipetting, transfer the cell suspension into three new T25 culture flasks and supplement with fresh medium to 6 - 8 mL per flask.

[0054] (2) Effects of oroxindin B at different concentrations on the proliferation of macrophages:

[0055] The macrophages RAW264.7 in step (1) were plated in a 96-well plate at a cell density of 2.5×10 4 cells / well, 100 μL per well. After the cells were cultured and adhered for 24 h, 1 μg / mL of bacterial lipopolysaccharide (LPS) was added to the wells and a blank control was set, and the cells were stimulated for 12 h. Subsequently, the LPS solution in each well was aspirated, and oroxindin B at concentrations of 0.1 μM, 1 μM, 10 μM, and 100 μM was added. After culturing for 24 h, CCK8 reagent was added, and the effects of oroxindin B at four concentrations of 0.1 μM, 1 μM, 10 μM, and 100 μM and the blank control group were measured to investigate the effects of oroxindin B at different concentrations on the proliferation of macrophages. The investigation results are as Figure 4 shown.

[0056] Figure 4 is the graph of the proliferation effect of oroxindin B at different concentrations in macrophages; Note: Compared with the blank group, mean±SD, n = 3, *P<0.05, **P<0.01, ***P<0.001. It can be seen from Figure 4 that after treatment with oroxindin B for 24 h, compared with the blank control group, the cell viability decreased and there was a difference when the administration concentration reached 100 μM, and the cell viability in the other concentration groups did not decrease significantly. Therefore, 100 μM of oroxindin B was selected for subsequent experiments.

[0057] (3) RNA extraction:

[0058] The macrophages RAW264.7 in step (1) were plated in a 6-well plate at a cell density of 5×10 5per well, 2 mL per well. After 12 h of LPS stimulation, aspirate and discard the supernatant, then add 100 μM baicalin B and continue culturing for 24 h. When the cell confluence reaches 90 - 100%, aspirate and discard the culture medium, add PBS and wash twice. Add 500 μL of Lysis Buffer to each well and pipette up and down to mix evenly.

[0059] Then collect the cells into a 1.5 mL centrifuge tube, add 500 μL of absolute ethanol, invert the tube up and down, add the liquid to the centrifuge tube, and then centrifuge at 4000 x g for 1 min; add 500 μL of Wash Buffer to the RNA column, then centrifuge at 12000 x g for 1 min, discard the waste liquid in the collection tube, reinstall the RNA column into the collection tube, and centrifuge the empty tube again to remove the residual Wash Buffer; place the column on another clean and enzyme-free 1.5 mL EP tube; add 20 - 50 μL of Elution Buffer to the center of the RNA membrane, let it stand at room temperature for 2 min, then centrifuge at 12000 x g for 1 min, pour the solution back into the RNA column, let it stand for 5 min and then centrifuge again to obtain more RNA, measure the concentration of the eluted RNA, and store it at -80 °C for later use.

[0060] (4) Reverse transcription and fluorescence quantitative PCR:

[0061] Take 1 μg of total RNA from the RNA extracted in step (3), perform reverse transcription according to the Roche reverse transcription kit. The qRT-PCR primers used are as follows:

[0062] β-actin-F: CTACCTCATGAAGATCCTGACC (SEQ ID NO:1);

[0063] β-actin-R: CACAGCTTCTCTTTGATGTCAC (SEQ ID NO:2);

[0064] Hey2-F: CCACCTCTCTTCTGTCTCTTTC (SEQ ID NO:3);

[0065] Hey2-R: TTATTGTTTGTCCCAGTGCTTG (SEQ ID NO:4);

[0066] Hey1-F: GGTCTCCCATCTCAACAACTAC (SEQ ID NO:5);

[0067] Hey1-R: GATGTGTGGGTGATGTCCGAA (SEQ ID NO:6);

[0068] HES5-F: TGCACCAGGACTACAGCGA (SEQ ID NO:7);

[0069] HES5-R: AGTGGTAAAGCAGCTTCATCTG (SEQ ID NO:8);

[0070] HES1-F: AATTTGCCTTTCTCATCCCCAA (SEQ ID NO:9);

[0071] HES1-R: GAAGGTGACACTGCGTTAGG (SEQ ID NO:10).

[0072] β-actin was used as an internal reference. The primers β-actin, HES1, HES5, HEY1, and HEY2 were prepared into a 10 μM solution with DEPC water. Using β-actin as the internal reference gene, the qPCR reaction system was prepared according to Table 2, and 3 parallel replicates were set for each sample. The prepared reaction system was centrifuged and mixed evenly, and a LightCycler96 fluorescence quantitative PCR instrument was used for amplification and quantitative detection. The qPCR reaction program was set according to Table 3, and the melting curve was set using a PCR instrument.

[0073] Table 2. qPCR reaction system

[0074]

[0075]

[0076] Table 3. qPCR reaction conditions

[0077] Number of Cycles Temperature Time Pre-denaturation 1 95℃ 10 minutes Denaturation 35 95℃ 15 seconds Annealing, Extension 35 95℃ 1 minute Melting Curve 1 Instrument Default Instrument Default

[0078] Figure 5 It is a graph showing the inhibitory effect of baicalein B on the mRNA gene expression of the HES family and HEY family HES1, HES5, HEY1, and HEY2, which are downstream target genes of Notch, in macrophages; among them, compared with the blank group, mean±SD, n = 3, *P<0.05, **P<0.01, ***P<0.001. From Figure 5 it can be seen that compared with the blank control group, the expressions of HES1, HES5, HEY1, and HEY2 in the baicalein B group were significantly down-regulated.

[0079] In summary, it is shown that baicalein B can act on the Notch pathway and can produce an anti-atherosclerotic effect by inhibiting the Notch signaling pathway, and can be further studied as a potential small molecule Notch inhibitor.

[0080] The described embodiments are the preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Without departing from the essential content of the present invention, any obvious improvements, substitutions or modifications that those skilled in the art can make all fall within the protection scope of the present invention.

Claims

1. Use of puerarioside B in the preparation of a medicament for preventing and / or treating atherosclerosis.

2. The application according to claim 1, characterized in that, The said use is that puerarioside B regulates the Notch signaling pathway.

3. The application according to claim 2, wherein The said regulation is to inhibit the Notch signaling pathway.

4. The application according to claim 3, characterized in that, The Notch signaling pathway is inhibited by the following means: (A) inhibiting the protein of the key transcription factor RBPJ of the Notch pathway; and / or (B) altering the expression / function of Notch cofactors or effectors.

5. Use of puerarioside B in the preparation of a product for preventing and / or treating a disease with abnormal activation of the Notch signaling pathway; the disease with abnormal activation of the Notch signaling pathway is atherosclerosis.

Images