Detection of peripheral blood plasma biomarkers in asthma patients

By detecting the expression of miR-129-2-3p in the peripheral plasma of asthma patients and combining it with miR-129-2-3p antagonist intervention, the problem of airway epithelial barrier damage caused by PM2.5 in asthma was resolved, providing an effective diagnostic and therapeutic target and significantly improving asthma symptoms.

CN116590404BActive Publication Date: 2026-03-03SHANXI MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-26
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

In the current technology, the mechanism by which PM2.5 damages the airway epithelial barrier function of asthma patients is unclear, leading to the aggravation of asthma, and there is a lack of effective diagnostic and therapeutic targets.

Method used

Using miR-129-2-3p as a peripheral plasma biomarker in asthma patients, we detected the expression level of miR-129-2-3p in exosomes and, combined with miR-129-2-3p antagonist intervention, regulated the TIAM1/RAC1/PAK1 signaling pathway and improved airway epithelial barrier function.

Benefits of technology

miR-129-2-3p is significantly upregulated in asthma patients and has high sensitivity and specificity as a diagnostic biomarker. It can alleviate asthma symptoms, improve airway epithelial barrier function, and reduce inflammatory response through antagonist intervention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116590404B_ABST
    Figure CN116590404B_ABST
Patent Text Reader

Abstract

This disclosure provides a peripheral blood plasma biomarker for detecting asthma patients, belonging to the field of biotechnology. The peripheral blood plasma biomarker for detecting asthma patients includes miR-129-2-3p. miR-129-2-3p can serve as a target for the diagnosis and treatment of asthma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of biotechnology, and in particular to a biomarker for detecting peripheral blood plasma in asthma patients. Background Technology

[0002] Asthma is a heterogeneous disease involving multiple cells and cytokines, characterized by reversible airflow limitation, chronic airway inflammation, mucus secretion, and airway remodeling. It is one of the most common chronic respiratory diseases. Asthma results from complex gene-environment interactions, and environmental factors, including allergens, pathogenic microorganisms, and air pollutants such as PM2.5, are playing an increasingly prominent role in the pathogenesis of asthma. 2.5 As a major air pollutant, it is closely related to the occurrence and development of asthma. The airway epithelium is the body's first physical defense barrier against external allergens and other risk factors, and its damage is often the initiating factor in the occurrence and development of asthma.

[0003] Studies have found that PM 2.5 Damage to epithelial cells, macrophages, and lung fibroblasts leads to inflammatory responses and lesions, inducing epithelial-mesenchymal transition and airway remodeling, thus exacerbating respiratory damage and lung disease. In asthma patients, the tight junctions of bronchial biopsy tissue show patchy breaks, indicating damage to the bronchial epithelial barrier. PM 2.5 After 24 hours of treatment with alveolar epithelial cells, the expression of the tight junction protein ZO-1 between alveolar epithelial cells was downregulated, cell permeability increased, and barrier function was significantly weakened. Therefore, it can be inferred that PM 2.5 It may exacerbate asthma by damaging the barrier function of the airway epithelium and increasing intercellular permeability, but the specific mechanism of action is not yet fully understood.

[0004] The information disclosed in the background section is only for enhancing the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0005] The purpose of this disclosure is to provide a potential value of detecting peripheral blood plasma biomarkers in asthma patients as diagnostic biomarkers and intervention targets for asthma.

[0006] To achieve the above-mentioned objectives, the present disclosure adopts the following technical solution:

[0007] According to a first aspect of this disclosure, a method for detecting peripheral blood plasma biomarkers, including miR-129-2-3p, is provided for asthma patients.

[0008] In some embodiments of this disclosure, miR-129-2-3p has the sequence shown in SEQ ID NO:1.

[0009] According to a second aspect of this disclosure, a kit for detecting peripheral blood plasma in asthma patients is provided, comprising primers for reverse transcription of the peripheral blood plasma biomarkers for detecting asthma patients as described above to synthesize cDNA.

[0010] In some embodiments of this disclosure, the primers include an upstream primer and a downstream primer, the upstream primer having the sequence shown in SEQ ID NO:2, and the downstream primer being mRQ 3'Primer.

[0011] In some embodiments of this disclosure, an internal reference primer U6 is also included.

[0012] According to a third aspect of this disclosure, a method for detecting peripheral blood plasma in asthma patients is provided, using the peripheral blood plasma detection kit for asthma patients as described above.

[0013] In some embodiments of this disclosure, peripheral blood samples were collected, plasma exosomes were extracted, and the expression level of exosome miR-129-2-3p was detected using U6 as an internal reference.

[0014] According to a fourth aspect of this disclosure, a medicament for treating asthma patients is provided, comprising a miR-129-2-3p antagonist, said miR-129-2-3p antagonist inhibiting the function of miR-129-2-3p by competitively binding to mature miR-129-2-3p in the body, preventing complementary pairing of miR-129-2-3p with its target gene mRNA.

[0015] In some embodiments of this disclosure, miR-129-2-3p has the sequence shown in SEQ ID NO:1.

[0016] This study collected peripheral blood from asthma patients and healthy controls, extracted plasma exosomes, and used U6 as an internal control to detect the expression level of exosomal miR-129-2-3p. Compared with the healthy control group, miR-129-2-3p was significantly upregulated in the plasma exosomes of asthma patients. Therefore, the elevated level of exosomal miR-129-2-3p in the plasma of asthma patients suggests its potential value as a biomarker for asthma diagnosis and an intervention target.

[0017] This disclosure establishes an animal model of asthma, in which miR-129-2-3p is highly expressed in lung tissue and plasma exosomes of asthmatic mice. miR-129-2-3p targets the TIAM1 / RAC1 / PAK1 signaling pathway to regulate PM2.5. 2.5It exacerbates airway epithelial barrier dysfunction and inflammatory response in asthmatic mice. miR-129-2-3p antagomir can improve the damaged epithelial barrier, thereby alleviating the inflammatory response. This further suggests that miR-129-2-3p may serve as a target for the diagnosis and treatment of asthma. Attached Figure Description

[0018] The above and other features and advantages of this disclosure will become more apparent from a detailed description of exemplary embodiments thereof with reference to the accompanying drawings.

[0019] Figure 1.1 Volcano plot for the GSE25230 dataset;

[0020] Figure 1.2 Clustering heatmap of the GSE25230 dataset;

[0021] Figure 1.3 Venn diagrams of target genes predicted from the TargetScan, miRDB, and miRWalk databases;

[0022] Figure 1.4 For GO feature annotation and KEGG feature enrichment analysis;

[0023] Figure 1.5 For the cAMP signaling pathway;

[0024] Figure 1.6 A network diagram of protein-gene interactions predicting the target genes of miR-129-2-3p;

[0025] Figure 1.7 To verify the targeting relationship between miR-129-2-3p and TIAM1;

[0026] Figure 2.1 Transmission electron microscope image of plasma exosomes (80000×);

[0027] Figure 2.2 NTA diagram of plasma exosomes;

[0028] Figure 2.3 Results of marker protein detection for plasma exosomes (n=3);

[0029] Figure 2.4 The expression level of miR-129-2-3p in plasma exosomes;

[0030] Figure 2.5 ROC curve analysis of plasma exosome miR-129-2-3p;

[0031] Figure 3.1 For PM 2.5 Schematic diagram of an aggravated mouse asthma model;

[0032] Figure 3.2 The organ coefficients of mice in each group;

[0033] Figure 3.3 The total number of cells and cell differential count in the bronchoalveolar lavage fluid;

[0034] Figure 3.4 The expression level of OVA-sIgE in plasma;

[0035] Figure 3.5 HE staining images of mouse lung and tracheal tissues (200×);

[0036] Figure 3.6 PAS staining images of mouse lung and tracheal tissues (200×);

[0037] Figure 3.7 The expression level of miR-129-2-3p in mouse lung tissue and plasma exosomes;

[0038] Figure 3.8 The mRNA expression levels of signaling pathway-related indicators in mouse lung tissue;

[0039] Figure 3.9 The mRNA expression levels of connexins and inflammatory factors in mouse lung tissue;

[0040] Figure 3.10 The protein expression levels of connective protein-related indicators in mouse lung tissue;

[0041] Figure 3.11 The protein expression levels of signaling pathway-related indicators in mouse lung tissue;

[0042] Figure 3.12 The expression levels of inflammatory factors in mouse bronchoalveolar lavage fluid;

[0043] Figure 3.13 Expression of TIAM1 in mouse lung tissue (200×);

[0044] Figure 3.14 The expression of connexin in mouse lung tissue (200×). Detailed Implementation

[0045] The embodiments of this disclosure will now be described in detail with reference to the accompanying drawings:

[0046] Example 1: Differential miRNA Screening and Target Gene Prediction

[0047] 1.1 Differential miRNA Screening

[0048] The differentially expressed miRNAs between Healthy and Asthma samples in the GEO25230 dataset were screened using the GEO2R tool (https: / / www.ncbi.nlm.nih.gov / geo / geo2r / ) that comes with the GEO database, with thresholds of |log2(fold change)|≥1 and adj.P.value<0.05.

[0049] A total of 13 differentially expressed miRNAs were obtained (including 11 upregulated and 2 downregulated), as shown in Table 1.1. The results of the differentially expressed miRNAs were then visualized to obtain volcano plots and clustering heatmaps, as shown in Table 1.1. Figure 1.1 and Figure 1.2 As shown. Figure 1.1 Each dot represents a gene; red dots represent miRNAs with increased expression; blue dots represent miRNAs with decreased expression; and black dots represent miRNAs with no significant difference in expression. Figure 1.2 In the diagram, A represents the asthma group and C represents the healthy control group; red indicates upregulated miRNA expression and blue indicates downregulated miRNA expression.

[0050] Five mouse-human shared miRNAs with the highest |log2FC| values ​​in Table 1.1 were selected: hsa-mir-576, hsa-mir-335, hsa-mir-129, hsa-mir-181a, and hsa-mir-181c. These were validated in lung tissue of an asthmatic rat model. The results showed that miR-129 expression was the highest, significantly higher than the control group. A literature review found no reports of miR-129 in asthma; therefore, miR-129-2-3p was selected for further research.

[0051] Table 1.1 Differentially expressed miRNAs in the GSE25230 dataset

[0052]

[0053] 1.2 Target gene prediction

[0054] The target genes of miR-129-2-3p were predicted using three miRNA target gene prediction databases: TargetScan, miRDB, and miRWalk. The target gene set was obtained by taking the intersection of the three databases using Venn diagrams.

[0055] A total of 195 target genes were identified. Figure 1.3 .

[0056] 1.3 GO Functional Annotation and KEGG Functional Enrichment Analysis

[0057] GO functional annotation and KEGG functional enrichment analysis of the target gene set were performed using the DAVID database (The Database for Annotation, Visualization and Integrated Discobery; https: / / dabid.ncifcrf.gov / ). P < 0.05 was considered statistically significant.

[0058] GO annotation results are as follows Figure 1.4 As shown in Figure A, the biological processes in which target genes are enriched mainly include signal transduction, positive regulation of RNA polymerase II promoter transcription, nervous system development, and regulation of small GTPase-mediated signal transduction. Cellular component analysis shows that target genes are mainly located in the cytoplasm, plasma membrane, nucleoplasm, and cytoskeleton. In terms of molecular function, target genes are mainly enriched in transcription factor activity, sequence-specific DNA binding, RNA polymerase II sequence-specific DNA binding to transcription factors, and ion channel binding. The KEGG functional enrichment analysis results are as follows: Figure 1.4 As shown in B, the target genes are mainly concentrated in the cAMP signaling pathway, cancer pathways, and MAPK signaling pathway. Table 1.2 lists the differentially expressed signaling pathways and their enriched target genes. The TIAM1 / RAC1 / PAK1 axis in the cAMP signaling pathway mediates cytoskeleton remodeling and altered adhesion junctions. Figure 1.5 TIAM1 is one of the target genes predicted by miR-129-2-3p. Therefore, we hypothesize that miR-129-2-3p may play a role in asthma by targeting and regulating TIAM1.

[0059] Table 1.2 KEGG functionally enriched miR-129-2-3p target genes

[0060]

[0061] 1.5 Target Gene PPI Network Analysis

[0062] The screened target genes were analyzed using the string database (https: / / string-db.org / cgi / input.pl) to obtain PPI protein interaction network results, as follows: Figure 1.6 The protein interaction network shown consists of 127 nodes and 290 edges.

[0063] 1.6 Dual-luciferase reporter gene assay

[0064] Cell transfection

[0065] (1) 293T cells were divided into 2x10 4Seeds were placed into 96-well plates and transfected when the cell density reached 50%-70%.

[0066] (2) Mix 10 μL of DMEM with 0.16 μg of h-TIAM1-3UTR target plasmid and 5 pmol of hsa-miR-129-2-3p / Negative Control (NC) thoroughly (Solution A), then mix 10 μL of DMEM with 0.3 μL of transfection reagent thoroughly (Solution B) and let stand at room temperature for 5 min;

[0067] (3) Mix solution A and solution B thoroughly and let stand at room temperature for 20 minutes;

[0068] (4) Replace the culture medium with fresh medium before transfection, then add the transfection mixture and mix well. Incubate at 37°C with 5% CO2;

[0069] (5) Replace with fresh culture medium 6 hours after transfection, and collect cells for testing 48 hours after transfection;

[0070] Lysed cells

[0071] (1) Remove the culture medium, rinse once with PBS, being careful not to blow the cells up; add 30 μL of 1X Lysis Buffer (lysis buffer);

[0072] (2) Mix the cells with 1X Lysis Buffer, place the culture plate on a shaker and incubate at room temperature for 15 min;

[0073] (3) Transfer the lysate to a new EP tube, centrifuge at 4°C and 12,000 rpm for 1 min, and collect the supernatant for later use;

[0074] Fluorescence detection

[0075] (1) Take 20 μL of lysate, add 100 μL of luciferase reaction inhibitor equilibrated to room temperature, mix well, and then use an ELISA reader to detect the Renilla luciferase value as the internal control value.

[0076] (2) Then add 100 μL of luciferase reaction inhibitor (Luciferase Reaction Reagent II) equilibrated to room temperature, mix well, and then use a microplate reader to detect the Renilla luciferase value, which is the reporter gene luminescence value.

[0077] According to Targetscan's predictions, the miR-129-2-3p seed sequence has a potential binding site with the TIAM13'UTR, such as... Figure 1.7As shown in Figure A, the wild-type sequence fragment of the TIAM1 gene was fused into a dual-luciferase plasmid and co-transfected into 293T cells with miR-129-2-3pmimics and mimics-NC, respectively. Fluorescence signals were detected after 48 hours. The results showed that, compared with the NC group, hsa-miR-129-2-3p significantly downregulated the expression of luciferase in h-TIAM1-3UTR-WT (P < 0.05), indicating a targeting relationship between miR-129-2-3p and TIAM1. After TIAM1 mutation, compared with the NC group, hsa-miR-129-2-3p failed to downregulate the expression of luciferase in h-TIAM1-3UTR-MUT (P > 0.05), indicating successful mutation. Figure 1.7 B).

[0078] Example 2: Detection of peripheral blood plasma samples

[0079] 2.1 Peripheral blood plasma sample extraction and preservation

[0080] All subjects had 10 mL of fasting venous blood collected in the morning into EDTA anticoagulant tubes. The tubes were gently inverted to mix, centrifuged at room temperature, and the supernatant was collected as plasma. The plasma was then aliquoted into 1.5 mL enzyme-free Eppendorf tubes on ice and stored at -80°C.

[0081] In this embodiment, a total of 15 asthma patients and 15 healthy controls were included. The mean age of the asthma group was (44.6±2.60) years and the mean age of the healthy control group was (43.7±2.95) years. There was no statistically significant difference in age distribution between the two groups (P=0.820). There were no statistically significant differences in gender, body mass index, education level and average monthly income between the two groups (P>0.05) (see Table 2.1).

[0082] Table 2.1 Basic characteristics of asthma patients and healthy controls

[0083]

[0084] 2.2 Extraction of plasma exosomes

[0085] Plasma exosomes were extracted using the serum-plasma exosome extraction kit from Yumeibo Biotechnology Co., Ltd., following the instructions.

[0086] (1) Sampling: Take the frozen sample out of the -80℃ freezer and thaw it in a 25℃ water bath. Place the completely thawed sample on ice.

[0087] (2) Centrifugation to remove cell debris: Transfer the sample to a centrifuge tube and centrifuge at 4°C and 3000g for 10 min to remove cell debris from the sample;

[0088] (3) Transfer of supernatant: Transfer the centrifuged supernatant after removing cell debris to a new centrifuge tube;

[0089] (4) Centrifugation to remove impurities: Centrifuge the supernatant after transfer at 4℃ at 10000g for 10min to remove impurities from the sample. Transfer the supernatant after centrifugation to a new centrifuge tube (it can be centrifuged multiple times until there is no obvious precipitate).

[0090] (5) Supernatant pretreatment: Add pre-cooled 1×PBS to the centrifuged supernatant after removing impurities for dilution, and then add BloodPureExo Solution (BPS); 1 mL of plasma is added to 3 mL of PBS, and then 1 mL of BPS is added.

[0091] (6) Solution mixing: After adding BPS reagent, mix well by vortex shaker for 1 min, and then let stand in a refrigerator at 4℃ for 2 h;

[0092] (7) Precipitation of exosomes: Take out the centrifuge tube containing the mixture and centrifuge at 10,000g for 60 min at 4℃. Discard the supernatant. The precipitate is rich in exosome particles. (Note: Aspirate the supernatant as thoroughly as possible.)

[0093] (8) Resuspension of exocrine secretions: Add 1×PBS and gently pipette the centrifuged precipitate until dissolved. Transfer the resuspension to a new 1.5mL centrifuge tube. Add 0.1mL PBS to every 0.2mL of plasma.

[0094] (9) Harvesting exosome particles: Centrifuge a 1.5 mL centrifuge tube containing the resuspension at 4°C at 12000 g for 2 min and retain the supernatant, which is rich in exosome particles;

[0095] (10) Purification of exosomes: The crude exosome particles were transferred into the upper chamber of an Exosome Purification Filter (EPF column) and centrifuged at 3000g for 10 min at 4℃. After centrifugation, the liquid at the bottom of the EPF column was collected. This liquid is the purified exosome particles.

[0096] (11) Preservation of exosomes: The purified exosomes were aliquoted into 50-100 μL and stored in a -80℃ freezer for subsequent experiments.

[0097] 2.3 Identification of plasma exosomes

[0098] 2.3.1 Transmission electron microscopy (TEM) was used to examine the morphology and size of exosomes.

[0099] (1) Take an appropriate amount of PBS to dilute the plasma exosome sample, take 10 μL of the diluted sample and drop it onto the sealing film, float a copper mesh (300 mesh) on the droplet, and let it stand at room temperature for 3 min;

[0100] (2) Add 10 μL of 2% uranium acetate to the copper grid, let it stand at room temperature for 1 min, and then use filter paper to remove the liquid from the surface of the copper grid.

[0101] (3) Let it air dry at room temperature for 30 minutes, then observe and photograph it with a transmission electron microscope.

[0102] Exosomes were extracted from the plasma of asthma patients using a plasma exosome extraction kit, and their morphology and structure were observed using transmission electron microscopy. Figure 2.1 As shown (indicated by the arrow), the exosomes exhibit a saucer-like lipid bilayer structure with a diameter between 30 and 150 nm, consistent with the reported morphology and size of plasma exosomes.

[0103] 2.3.2 Nanoparticle Tracking Analyzer (NTA) for Exosome Particle Size Detection

[0104] (1) Clean the sample pool with deionized water;

[0105] (2) Calibrate the instrument using polystyrene microspheres (100 nm);

[0106] (3) Clean the sample cell with 1×PBS solution;

[0107] (4) Dilute the exosome sample with 1×PBS solution and inject for detection.

[0108] The particle size and concentration of exosomes were determined using a nanoparticle tracking analyzer (NTA). Figure 2.2 As shown, the average diameter of the exosomes is 93.5 ± 30.7 nm, which is consistent with the size of exosomes, which is approximately 30-150 nm in diameter.

[0109] 2.3.3 Western Blot Detection of Exosomal Marker Proteins

[0110] Remove the extracted exosomes from the -80℃ freezer, add an appropriate amount of exosome-specific lysis buffer, and lyse on ice for 30 min; centrifuge at 9500 rpm for 20 min at 4℃, take the supernatant for plasma exosome protein BCA quantification and detection by Western Blot method.

[0111] plasma exosome RNA extraction

[0112] (1) Add 1 mL of RNAiso Plus to the exosome sample, mix well, and place on ice for 30 min;

[0113] (2) Add 200 μL of chloroform, mix by inverting for 15 seconds, and let stand at room temperature for 5 minutes;

[0114] (3) Centrifuge at 4℃ and 12000g for 15 min. The liquid in the tube will be divided into three layers. RNA is mainly concentrated in the upper aqueous phase. Carefully aspirate 500 μL of the upper aqueous phase into a new RNase-free EP tube to avoid aspirating the middle layer.

[0115] (4) Add 500 μL of isopropanol, invert and mix 15 times, and let stand at room temperature for 10 min.

[0116] (5) Centrifuge at 4℃ and 12000g for 10 min, and discard the supernatant;

[0117] (6) Wash the precipitate three times with 1 mL of pre-cooled 75% ethanol (diluted with DEPC water), and centrifuge at 4°C and 7500 g for 5 min.

[0118] (7) Discard the supernatant, invert the EP tube opening onto clean filter paper, and allow the precipitate to dry at room temperature for 5-10 minutes;

[0119] (8) Add an appropriate amount of RNase-free water to dissolve the precipitate;

[0120] (9) RNA concentration detection: Use an ultra-micro spectrophotometer, zero it with DEPC water, take 1 μL of RNA solution to detect the concentration, and record the RNA concentration and 260 / 280 ratio.

[0121] Plasma exosomal miRNA reverse transcription

[0122] According to the kit instructions, miRNA was reverse transcribed into cDNA using the tailing method.

[0123] (1) Prepare a mixture in an RNase-free 0.2 mL EP tube according to the following reaction system.

[0124]

[0125] (2) Perform miRNA reverse transcription according to the following procedure. Add 90 μL of RNase-free water to the synthesized cDNA, mix well, dispense, and store at -20℃ for later use.

[0126] Reaction temperature Reaction time

[0127] 37℃ for 60 minutes

[0128] 85℃ for 5 minutes

[0129] Primer design and synthesis

[0130] The primers for miR-129-2-3p were designed and synthesized by Shanghai Sangon Biotech Co., Ltd. The upstream primer sequence is: ACAAGAAGCCCTTACCCCAAAAAGC, and the downstream primer is the mRQ 3' Primer (Shanghai Sangon, catalog number: B661601) included in the kit. The internal control U6 primer (Shanghai Sangon, catalog number: B661602) is included in the kit.

[0131] Real-time quantitative PCR reaction of plasma exosomes miR-129-2-3p

[0132] (1) Using the TB fluorescence quantitative reagent kit Premix Ex Taq TM To perform quantitative detection of miR-129-2-3p, the reaction solution was prepared according to the following reaction system, with three replicates for each sample, and the detection was performed on a real-time PCR instrument.

[0133]

[0134] (2) Perform the quantitative PCR reaction according to the following reaction procedure.

[0135]

[0136] (3) Using U6 as an internal reference, the expression level of miR-129-2-3p was calculated using the ΔΔCT method.

[0137] 2.3.4 Statistical Analysis

[0138] All experiments were repeated three times. SPSS 22.0 software was used for statistical analysis of the experimental data. GraphpadPrism 9.0 and Origin 2022b software were used to process the analysis results and generate graphs. Quantitative data are expressed as mean ± standard error. The differences between the two groups were compared using an independent samples t-test if the groups followed a normal distribution, and an independent samples nonparametric test if they did not. The AUC value was obtained by analyzing the ROC curve to assess the ability of plasma exosome miR-129-2-3 to distinguish between asthma patients and healthy controls.

[0139] The ROC curve, also known as the receiver operating characteristic curve (ROC), is a curve plotted with sensitivity on the ordinate and (1-specificity) on the abscissa. The area under the curve is called the area under the curve (AUC). A higher AUC value indicates higher diagnostic accuracy. The Youden's index can be calculated from the A and B axes of the ROC curve; its value is the sum of sensitivity and specificity minus 1, and its range is between 0 and 1. Analyzing the ROC curve to obtain the AUC value allows for the assessment of the ability of plasma exosome miR-129-2-3 to distinguish between asthma patients and healthy controls.

[0140] In this section, Western blot was used to detect the exosome marker proteins HSC70 and TSG101, as well as the negative control Calnexin, in exosomes and their extracted supernatant. The results are as follows: Figure 2.3 As shown, Supernatant: the supernatant after exosome extraction; Exosomes: exosomes extracted from plasma. Exosomes highly expressed the marker proteins HSC70 and TSG101, but did not express Calnexin; while the supernatant control expressed a small amount of HSC70 and a large amount of Calnexin.

[0141] Expression levels of plasma exosomal miR-129-2-3p in asthma patients

[0142] Exosomal RNA was extracted from the plasma of 15 asthma patients and 15 healthy controls. The expression level of miR-129-2-3p was detected by qRT-PCR. Figure 2.4 As shown, data are expressed as mean ± standard deviation, n = 15, *P < 0.05. Healthy: healthy control group; Asthma: asthma patients. Compared with the healthy control group, the level of miR-129-2-3p in plasma exosomes was significantly increased in the asthma group, and the difference was statistically significant (P < 0.05).

[0143] Area under the curve of plasma exosome miR-129-2-3p

[0144] ROC curve analysis was performed on plasma exosomal miR-129-2-3p from 15 asthma patients and 15 healthy controls. Figure 2.5 As shown, the area under the curve (AUC) was 0.7384 (95% CI: 0.543–0.932), with a sensitivity of 60%, specificity of 100%, and Youden index of 0.6, indicating a high ability to distinguish between asthma patients and healthy controls.

[0145] In this embodiment, peripheral blood was collected from 15 asthma patients and 15 healthy controls. Plasma exosomes were extracted, and the expression level of exosomal miR-129-2-3p was detected using U6 as an internal control. Compared with the healthy control group, miR-129-2-3p was significantly upregulated in the plasma exosomes of asthma patients, which is consistent with the results of bioinformatics analysis. Therefore, the elevated level of exosomal miR-129-2-3p in the plasma of asthma patients suggests that it has potential value as a biomarker for asthma diagnosis and an intervention target.

[0146] Example 3 miR-129-2-3p antagomir in PM 2.5 Studies in mouse models of aggravated asthma

[0147] 3.1 Establish PM 2.5 A mouse model of asthma was exacerbated, and the level of miR-129-2-3p in mouse plasma exosomes was measured. Mice were then treated with the miRNA antagomir.

[0148] miRNA antagomir is a specially modified miRNA antagonist that inhibits the function of mature miRNAs by competitively binding to them, preventing complementary pairing between the miRNA and its target gene mRNA. Compared to ordinary inhibitors, miRNA antagomir exhibits higher stability and inhibitory efficacy in vitro and in vivo, and can overcome cell membrane and tissue barriers to accumulate in target cells. In animal experiments, it can be administered via systemic or local injection, inhalation, or oral administration, with effects lasting up to several weeks.

[0149] Specifically, mice were given free access to purified water and sterile feed for one week of acclimatization. Sensitization was performed on days 0, 7, and 14 of the experiment. The NS group received an intraperitoneal injection of 200 μL of sterile PBS, while the other groups received an intraperitoneal injection of 200 μL of PBS suspension containing 25 μg OVA and 1 mg aluminum hydroxide. Starting on day 20, mice were anesthetized with isoflurane and then nasally instilled with PM2.5. 2.5 The toxic solution was administered every other day for a total of 10 times. The NS and OVA groups received 20 μL of blank toxic solution via nasal instillation, while other groups received 20 μL of PM at different concentrations via nasal instillation. 2.5 Treatment fluid. On days 35, 37, and 39, mice were anesthetized with isoflurane and then intranasally instilled with miR-129-2-3p antagomir / NC. HPM 2.5 +NC group received 50 μL of antagomir-NC at a concentration of 1 μg / μL via nasal drops, HPM 2.5The +antagomir group received 50 μL of the same concentration of miR-129-2-3p antagomir via nasal instillation, followed by challenge via 2% OVA nebulization 1 hour later. Other groups received the same volume of sterile PBS via nasal instillation. On day 40, mice were euthanized by enucleation and blood collection, followed by cervical dislocation for tissue analysis. PM 2.5 A schematic diagram illustrating the induction of an aggravated mouse asthma model is shown below. Figure 3.1 As shown. The specific intervention methods for each group of mice are as follows:

[0150] Control group (NS group): PBS was injected intraperitoneally, PBS was nebulized, and 20 μL of blank disinfectant was dripped into the nasal cavity.

[0151] Asthma group (OVA group): intraperitoneal injection of OVA, 2% OVA nebulization, and nasal instillation of 20 μL of blank disinfectant solution.

[0152] OVA + low concentration PM 2.5 LPM (Laboration Group) 2.5 Group 1: Intraperitoneal injection of OVA, 2% OVA nebulization, and nasal instillation of PM2.5. 2.5 Suspension 1.8 mg / kg·bw.

[0153] OVA+ medium concentration PM 2.5 MPM (Poisoning Group) 2.5 Group 1: Intraperitoneal injection of OVA, 2% OVA nebulization, and nasal instillation of PM2.5. 2.5 Suspension 3.6 mg / kg·bw.

[0154] OVA + high concentration of PM 2.5 HPM (High Motion Patients Group) 2.5 Group 1: Intraperitoneal injection of OVA, 2% OVA nebulization, and nasal instillation of PM2.5. 2.5 The suspension was 7.2 mg / kg·bw.

[0155] OVA + high concentration of PM 2.5 Drug use + antagomir-NC group (HPM) 2.5 +NC group): Intraperitoneal injection of OVA, 2% OVA nebulization, and nasal instillation of PM. 2.5 Suspension 7.2 mg / kg·bw and antagomir-NC solution 50 μg / 50 μL / animal.

[0156] OVA + high concentration of PM 2.5 Drug use + antagomir group (HPM) 2.5 +antagomir group): Intraperitoneal injection of OVA, 2% OVA nebulization, and nasal instillation of PM. 2.5 Suspension 7.2 mg / kg·bw and antagomir solution 50 μg / 50 μL / animal.

[0157] 3.2 Specimen Collection

[0158] After weighing the mice, the left eyeball was removed, and blood was collected using an EDTA anticoagulant tube. The blood was gently mixed, incubated at room temperature for 30 minutes, centrifuged at 3000g for 20 minutes, and the supernatant plasma was separated and stored at -80℃ for later use. After blood collection, the mice were euthanized by cervical dislocation, fixed on the lab table, and the thoracic and abdominal cavities were opened. The liver, spleen, kidneys, heart, lungs, brain, and trachea were removed sequentially, and the fascia on the surface of the organs was removed. The organs were weighed and their coefficients were calculated. The left lung lobe and bronchus were placed in an embedding cassette, fixed in tissue fixative for 24 hours, and embedded in paraffin for pathological sections. The right lung lobe was placed in a cryovial and stored at -80℃ for total protein and RNA extraction.

[0159] The organ coefficient, also known as the organ-to-body weight ratio, is the ratio of the weight of a specific organ to the total body weight in an experimental animal. It is a commonly used indicator in toxicology experiments. Normally, the ratio of each organ to its body weight is relatively constant. However, after an animal is exposed to toxins, the weight of the damaged organs can change, thus altering the organ coefficient. An increased organ coefficient indicates organ congestion, edema, or hyperplasia and hypertrophy; a decreased organ coefficient indicates organ atrophy and other degenerative changes. Figure 3.2 As shown, A: Body weight; B: Heart; C: Liver; D: Spleen; E: Lung; F: Brain; G: Kidney; H: Trachea. Heart coefficient (MPM) 2.5 The liver coefficient in the OVA group was higher than that in the NS group (P<0.05); the liver coefficient in the OVA group was higher than that in the NS group, and the HPM was higher. 2.5 Group higher than LPM 2.5 Group, HPM 2.5 The +antagomir group had significantly lower levels than HPM. 2.5 Group (P<0.05); Lung coefficient was significantly higher in the OVA group than in the NS group, and in the PM group 2.5 The dose-response relationship increased in the group, and the difference was statistically significant (P<0.05); the brain coefficient HPM 2.5 The group was significantly higher than the OVA group and LPM. 2.5 The organ coefficients of the spleen, kidneys, and trachea did not change significantly.

[0160] 3.3 Collection of bronchoalveolar lavage fluid

[0161] After euthanizing the mice, they were fixed on the lab bench, disinfected with 75% alcohol, and the neck skin was cut open to fully expose the thoracic cavity and separate the trachea. An inverted "T"-shaped incision was made along the upper edge of the cricoid cartilage, and a disposable intravenous catheter was inserted and fixed in place. 1 mL of PBS was injected into the lung tissue using a syringe until the lung apex expanded. The mouse lungs were gently pressed, and the syringe was gently aspirated to transfer the collected bronchoalveolar lavage fluid (BALF) into a centrifuge tube. This procedure was repeated three times. After collecting the BALF, it was centrifuged at 1000 rpm for 10 min, and the supernatant was aliquoted and stored at -80°C for detecting inflammatory factor levels; the cell pellet was used for differential counting.

[0162] Total white blood cell count in BALF, MPM 2.5 Groups and HPM 2.5 The percentages of neutrophils and eosinophils were significantly higher in the OVA group than in the PM group, but significantly lower after antagomir intervention (P<0.05); the percentages of neutrophils and eosinophils were significantly higher in the OVA group than in the PM group. 2.5 All groups showed significant increases; the percentage of lymphocytes in the OVA group was significantly higher than that in the NS group, and HPM was significantly higher. 2.5 The +antagomir group was significantly lower than HPM. 2. Groups and HPM 2.5 +NC group; the percentage of macrophages changed most significantly, with the OVA group being significantly lower than the NS group, and each PM 2.5 The drug-treated group had lower levels than the OVA group, but after intervention with antagomir, there was a significant improvement (P<0.05). Figure 3.3 A: Total number of cells; B: Neutrophil percentage; C: Lymphocyte percentage; D: Macrophage percentage; E: Eosinophil percentage.

[0163] 3.4 Cell classification and counting

[0164] After centrifugation with BALF, the cell pellet was resuspended in 0.5 mL of PBS and mixed well. 10 μL of the suspension was then used for cell counting under an optical microscope using a hemocytometer. A suitable amount of the cell suspension was then spread evenly on a glass slide, allowed to air dry, fixed in methanol for 10 min, and stained with Giemsa stain. Two hundred white blood cells were counted under 400x magnification and classified into neutrophils, eosinophils, phagocytes, and lymphocytes based on morphological characteristics, and their percentages were calculated.

[0165] 3.5 Pathological analysis of lung tissue

[0166] Paraffin sections of lung and tracheal tissue were stained with hematoxylin-eosin (HE), periodic acid-Schiffstain (PAS), and immunohistochemically, and then mounted with neutral resin for microscopic examination.

[0167] HE staining of mouse lung tissue sections showed that the bronchial structure of the lung tissue in the NS group mice was intact, with no obvious accumulation of inflammatory cells around blood vessels and bronchi; the bronchial walls of the lung tissue in the OVA group mice were thickened, and a large number of inflammatory cells infiltrated around blood vessels and in the submucosal epithelium of the bronchi; PM 2.5 In the toxic treatment group, with increasing toxic dose, perivascular and peribronchial inflammatory cell infiltration significantly increased; while in the antagomir intervention group, inflammatory cell infiltration decreased. Figure 3.5 A). HE staining of mouse tracheal tissue sections showed that the tracheal mucosa of mice in the NS group was a clear and healthy pseudostratified ciliated columnar epithelium, with neatly and uniformly arranged cilia in the tracheal epithelial cells; in the OVA group, the tracheal mucosal epithelial cells underwent localized metaplasia into squamous epithelium accompanied by shedding, increased glands, and inflammatory cell infiltration; PM 2.5 With increasing doses of the toxin, the lamina propria in the poisoned group showed congestion and edema, increased glandular tissue, and greater infiltration of inflammatory cells; while in the HPM group... 2.5 Compared to the group, HPM 2.5 In the +antagomir group, glandular tissue and infiltrated inflammatory cells were significantly reduced. Figure 3.5 B).

[0168] PAS staining of mouse lung and tracheal tissues as follows Figure 3.6 The data shows that A: lung tissue; B: tracheal tissue. No significant goblet cell proliferation was observed in the lung and tracheal tissues of the NS group mice, while the OVA group and PM group showed no significant goblet cell proliferation. 2.5 The number of goblet cells was significantly increased in the group exposed to the toxin, but decreased significantly after intervention with antagomir.

[0169] 3.6 Detection of miR-129-2-3p levels in mouse plasma exosomes

[0170] Extraction of mouse plasma exosomes, extraction of mouse plasma exosome RNA, reverse transcription of mouse plasma exosome RNA, and real-time quantitative PCR of mouse plasma exosome miR-129-2-3p.

[0171] The levels of miR-129-2-3p in plasma exosomes and lung tissue of asthmatic mice were detected by qRT-PCR. The results showed that compared with the NS group, the level of miR-129-2-3p in plasma exosomes of mice in the OVA group was significantly increased; HPM 2.5 and MPM 2.5 Group ratio OVA group and LPM2.5 Both increased significantly; while compared with HPM 2.5 Compared to the group, HPM 2.5 The antagomir group showed a significant decrease, and the difference was statistically significant (P<0.05). Figure 3.7 A). The expression level of miR-129-2-3p in mouse lung tissue was significantly higher in the OVA group than in the NS group, MPM 2.5 The level in the group was significantly higher than that in the OVA group, and after intervention with antagomir, it was significantly reduced, with a statistically significant difference (P<0.05). Figure 3.7 B).

[0172] 3.7 Detection of mRNA and miRNA in mouse lung tissue

[0173] Total RNA was extracted from mouse lung tissue, and RNA was reverse transcribed and subjected to quantitative real-time PCR. β-actin was used as an internal control, and the relative expression levels of mRNA were calculated using the ΔΔCT method. miRNA reverse transcription and quantitative real-time PCR were also performed.

[0174] The method is the same as above. Primer sequences are shown in Table 3.1.

[0175] Table 3.1 mRNA primer sequences

[0176]

[0177] The mRNA expression levels of signaling pathways Tiam1 / Rac1 / Pak1, connexins, and inflammatory factors in the lung tissue of mice in each group were detected by qRT-PCR.

[0178] The relevant indicators of signaling pathways, connexins, and inflammatory factors in the lung tissue of mice in each group were detected by qRT-PCR, and the relative expression levels of their mRNAs were calculated using the ΔΔCt relative quantification method. Figure 3.8 Middle signaling pathway molecules and Figure 3.9 As shown, A: connexins; B: inflammatory factors. Compared with the NS group, the expression levels of signaling pathway molecules Tiam1, Rac1, and Pak1, as well as connexin molecules ZO-1, Occludin, and E-cadherin, were significantly reduced in the OVA group; PM 2.5 After exposure to the toxin, their expression levels were lower than in the OVA group; however, after intervention with antagomir, their expression levels significantly increased again. Meanwhile, the expression levels of inflammatory factors IL-6, Cxcl15 (a homolog of human IL-8), and Tnfα were significantly higher in the OVA group than in the NS group; PM 2.5 The expression level was significantly higher in the lung tissue after exposure to the drug than in the OVA group; however, it was significantly reduced after intervention with antagomir (P<0.05). Western blot analysis was performed to detect the expression of related proteins in lung tissue.

[0179] Lung tissue (approximately 30 mg) was taken from a -80°C freezer and placed in an EP tube. An appropriate amount of protein lysis buffer containing 1% PMSF and 1% phosphatase inhibitor was added. The tissue was then lysed using an ultrasonic homogenizer and then lysed on ice for 30 min. After centrifugation at 4°C and 12,000 rpm for 10 min, the supernatant was transferred to a new EP tube. After BCA protein quantification, Western blot was used to detect the expression of related proteins in the lung tissue.

[0180] Western blot was used to detect related indicators of signaling pathways and connective proteins in the lung tissue of mice in each group. The gray value of the GAPDH band was used as an internal reference to relatively quantify the changes in the protein expression levels of each indicator. Figure 3.10 As shown in Figure 11, the protein levels of signaling pathway molecules TIAM1, RAC1, and PAK1, as well as conjugate proteins ZO-1, Occludin, and E-cadherin, were significantly lower in the OVA group than in the NS group; PM 2.5 After exposure to the toxin, their expression levels further decreased; however, intervention with miR-129-2-3p antagomir upregulated these indicators. The expression of OVA-specific IgE (OVA-sIgE) in mouse plasma and the expression of cytokines in mouse bronchoalveolar lavage fluid were detected by ELISA.

[0181] IgE is a mediator of allergic reactions, and elevated plasma OVA-specific IgE is the strongest evidence for the success of the OVA-induced asthma model. Compared with the NS group, the OVA-sIgE levels in other groups were significantly increased (P<0.05). Antagomir intervention reduced OVA-sIgE to some extent, and the difference was statistically significant (P<0.05). Figure 3.4 ).

[0182] The expression levels of IL-6, CXCL15 (a homolog of human IL-8), and TNF-α in the bronchoalveolar lavage fluid of mice in each group were detected using an ELISA kit. Figure 3.12 As shown, A: IL-6; B: CXCL15; C: TNF-α. Compared with the NS group, the expression levels of IL-6, CXCL15, and TNF-α were significantly increased in the OVA group; in PM... 2.5 In the drug-treated group, IL-6 and CXCL15 showed an increasing trend, but the difference was not statistically significant (P>0.05). Only TNF-α expression was significantly higher than that in the OVA group (P<0.05). In the antagomir intervention group, the expression levels of all three were significantly reduced (P<0.05).

[0183] The airway epithelial barrier is a crucial defense mechanism for the lungs against harmful external stimuli, with tight junction proteins ZO-1 and Occludin, and adhesion junction protein E-cadherin playing key roles. TIAM1, a target gene of miR-129-2-3p, plays a significant role in regulating the epithelial barrier. Therefore, we evaluated the impairment of airway epithelial barrier function in an asthma model by detecting the distribution of TIAM1, ZO-1, Occludin, and E-cadherin in mouse lung bronchial epithelial cells. Results showed that in the NS group, TIAM1, ZO-1, Occludin, and E-cadherin were evenly distributed on epithelial cells; while in the OVA group, the expression of TIAM1, ZO-1, Occludin, and E-cadherin was reduced in lung bronchial epithelial cells; PM... 2.5 The levels of TIAM1, ZO-1, Occludin, and E-cadherin in bronchial epithelial cells were further reduced after exposure to the drug, significantly lower than in the OVA group; after intervention with antagomir, the distribution of TIAM1, ZO-1, Occludin, and E-cadherin in bronchial epithelial cells was significantly lower than in the HPM group. 2.5 Groups and HPM 2.5 The +NC group showed significant improvement ( Figure 3.13 and Figure 3.14 ).

[0184] In this embodiment, five mice were used in each group for all experiments, and SPSS 22.0 software was used for statistical analysis of the experimental data. GraphpadPrism 9.0 software was used to process the analysis results and generate graphs. Independent samples t-tests were used to compare differences between two groups; one-way ANOVA was used to compare differences among multiple groups. If the variances of the groups were homogeneous, the LSD method was used for pairwise comparisons; if the variances were unequal, Dunnett's T3 method was used for pairwise comparisons. P < 0.05 indicated statistical significance, and * indicated P < 0.05.

[0185] In this embodiment, miR-129-2-3p was elevated in lung tissue and plasma exosomes of asthmatic mice. miR-129-2-3p targets the TIAM1 / RAC1 / PAK1 signaling pathway to regulate PM. 2.5 It exacerbates airway epithelial barrier dysfunction and inflammatory response in asthmatic mice. miR-129-2-3p antagomir can improve the damaged epithelial barrier, thereby alleviating the inflammatory response. This further suggests that miR-129-2-3p may serve as a target for the diagnosis and treatment of asthma.

[0186] It should be understood that this disclosure is capable of other implementations and can be implemented and performed in various ways. The foregoing variations and modifications fall within the scope of this disclosure. It should be understood that this disclosure, as disclosed and defined herein, extends to all alternative combinations of two or more individual features mentioned or apparent in the text and / or drawings. All these different combinations constitute multiple alternative aspects of this disclosure. The embodiments described in this specification illustrate the best known mode for implementing this disclosure and will enable those skilled in the art to utilize this disclosure.

Claims

1. The use of a primer for detecting peripheral blood plasma biomarkers in asthma patients in the preparation of a reagent kit for detecting peripheral blood plasma biomarkers in asthma patients, characterized in that, The peripheral blood plasma biomarkers detected in the asthma patients include miR-129-2-3p, the sequence of which is shown in SEQ ID NO:

1.

2. The use of the primers for detecting peripheral blood plasma biomarkers in asthma patients according to claim 1 in the preparation of a reagent kit for detecting peripheral blood plasma in asthma patients, characterized in that, The primers include an upstream primer and a downstream primer.

Citation Information

Patent Citations

  • Method and kit for detecting microrna

    WO2023025259A1