Molecular Marker, Primer, Kit, Identification Method and Application for Reproductive Performance of Large White Sows

Abstract

This application relates to the technical field of detecting the reproductive performance of Large White sows, specifically to molecular markers, primers, kits, identification methods and applications for the reproductive performance of Large White sows. The molecular marker primers are shown as SEQ ID NO.1 to SEQ ID NO.2. The molecular marker includes a nucleotide sequence formed by a single-base mutation of T>C at the 40058390th base on porcine chromosome 10 and / or a nucleotide sequence formed by a single-base mutation of C>T at the 40058492th base. The 2 SNPs screened in the CDS region of the BAMBI gene are both related to the reproductive performance of Large White sows, and can provide reference data for the molecular marker-assisted breeding of Large White sows.

Description

Technical Field

[0001] The present application relates to the technical field of detecting the reproductive performance of Large White sows, and specifically relates to molecular markers, primers, kits, identification methods and applications for the reproductive performance of Large White sows. Background Art

[0002] The reproductive performance of Large White sows is a key factor affecting the economic benefits of pig farming. However, the reproductive performance of Large White sows is a quantitative trait controlled by minor genes with low heritability, and the effect of breeding improvement based on conventional methods is not significant. With the development of molecular biology techniques, technologies such as high-density SNP chips, genotyping, and genome-wide association analysis have been rapidly developed and applied, entering the molecular breeding process from phenotypic breeding for important traits and associated genes, achieving continuous genetic improvement of livestock populations and continuous improvement of comprehensive performance. Single nucleotide polymorphism sites (SNPs) refer to genetic markers formed by single nucleotide variations on the genome, which are related to animal growth, reproduction, and diseases. Therefore, mining SNPs related to the reproductive performance of sows is of great significance for improving the reproductive performance of sows. Summary of the Invention

[0003] The inventors of the present application have shown through a large amount of research that the BAMBI gene may be related to the litter size of pigs. SNPs of the BAMBI gene were screened and genotyped by pooled DNA sequencing combined with multiplex PCR, and an association analysis was performed with the reproductive performance of Large White sows. It was found that both of the 2 SNPs screened in the CDS region of the BAMBI gene are related to the reproductive performance of Large White sows, which can provide reference data for molecular marker-assisted breeding of Large White sows.

[0004] Therefore, the embodiments of the present application at least disclose the following technical solutions:

[0005] A molecular marker primer for the reproductive performance of Large White sow, comprising DNA molecules shown in SEQ ID NO.1 and SEQ ID NO.2.

[0006] A molecular marker for the reproductive performance of Large White sow, amplified by the molecular marker primer.

[0007] A molecular marker for the reproductive performance of Large White sow, comprising:

[0008] A nucleotide sequence formed by a single base mutation of T>C at the 40058390th base on porcine chromosome 10; and / or

[0009] A nucleotide sequence formed by a single base mutation of C>T at the 40058492th base on porcine chromosome 10.

[0010] Use of the described molecular marker primers and the described molecular markers in the preparation of reagents for identifying the germplasm resources and categories of Large White sow

[0011] A kit comprising the described molecular marker primers and / or the described molecular markers.

[0012] A method for identifying the reproductive performance of Large White sows, comprising:

[0013] Obtaining genomic DNA of the Large White sow to be tested;

[0014] Performing PCR amplification using the described molecular marker primers;

[0015] Detecting the genotype at locus 40058390 on porcine chromosome 10 and / or the genotype at locus 40058492 on porcine chromosome 10 according to the nucleotide sequence of the amplification product;

[0016] Determining the reproductive performance of the Large White sow according to the genotype.

[0017] Compared with the prior art, the present application has at least one of the following beneficial effects:

[0018] In the embodiment of the present application, SNPs of the BAMBI gene are screened and genotyped by the method of pooled DNA sequencing combined with multiplex PCR, and correlation analysis is performed with the reproductive performance of Large White sows. It is found that the 2 SNPs screened in the CDS region of the BAMBI gene are both related to the reproductive performance of Large White sows, which can provide reference data for molecular marker-assisted breeding of Large White sows.

[0019] In the embodiment of the present application, two synonymous mutation sites, g.390T>C and g.492C>T, are screened in the CDS region of the BAMBI gene. The two loci g.390T>C and g.492C>T are in strong linkage disequilibrium (R 2 = 0.66) and conform to the Hardy-Weinberg equilibrium state (P>0.05) in the Large White sow population. mRNA secondary structure prediction shows that the g.390T>C and g.492C>T mutations in the BAMBI gene change the mRNA secondary structure and free energy of the BAMBI gene. Correlation analysis shows that g.390T>C is significantly correlated with the number of nipples, total number of piglets born, number of live piglets born, and number of healthy piglets of Large White sows (P < 0.05), and is extremely significantly correlated with the litter weight at birth of Large White sows (P < 0.01); g.492C>T is significantly correlated with the number of nipples, maternal index, reproductive index, total number of piglets born, number of live piglets born, number of mummies, and corrected litter weight at 21 days of Large White sows (P < 0.05), and is extremely significantly correlated with the number of healthy piglets of Large White sows (P < 0.01). Description of the Drawings

[0020] Figure 1PCR amplification of the BAMBI gene provided by the embodiments of the present application.

[0021] Figure 2 SNPs sites of the BAMBI gene provided by the embodiments of the present application.

[0022] Figure 3 Results of linkage disequilibrium analysis of the BAMBI gene provided by the embodiments of the present application; Note: A, linkage disequilibrium map (D` value): The numbers in the grid are the values of D`×100. If there is no number in the grid, it means D` = 1; B, linkage disequilibrium map (R 2 value): The numbers in the grid are the values of R 2 ×100. The linkage disequilibrium state between loci is judged according to the R 2 value. R 2 = 0 indicates complete linkage equilibrium, R 2 > 0.33 indicates strong linkage disequilibrium, R 2 = 1 indicates complete linkage disequilibrium.

[0023] Figure 4 Results of secondary structure analysis of the BAMBI gene provided by the embodiments of the present application; Note: A is the secondary structure of the wild type of the BAMBI gene, B is the secondary structure of the g.390T>C mutant of the BAMBI gene, and C is the secondary structure of the g.492C>T mutant of the BAMBI gene; The numbers represent the minimum free energy. Detailed implementation manners

[0024] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application. The reagents not specifically described in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not specifically described in detail are all conventional experimental methods and can be known from the prior art.

[0025] It should be noted that the terms "first", "second", etc. in the specification and claims of the present invention and the above-mentioned drawings are used to distinguish similar objects and do not necessarily need to describe a specific order or sequence, nor do they play a substantial limiting role on the subsequent technical features. It should be understood that such data can be interchanged under appropriate circumstances so that the embodiments of the present invention described herein can be implemented in an order other than those illustrated or described herein. In addition, the terms "comprising" and "having" and any variations thereof are intended to cover non-exclusive inclusion. For example, a process, method, system, product or device comprising a series of steps or units does not necessarily have to be limited to those steps or units clearly listed, but may include other steps or units not clearly listed or inherent to these processes, methods, products or devices.

[0026] For better understanding of the present invention rather than limiting the scope thereof, all numbers representing amounts, percentages, and other numerical values used in this application should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may vary depending on the desired properties to be obtained. Each numerical parameter should be regarded as being obtained at least according to the significant figures reported and by the conventional rounding method.

[0027] To study the relationship between genetic variations of BMP and Activin Membrane-Bound Inhibitor (BAMBI) and the reproductive performance of Large White sows. In the embodiments of this application, healthy Large White sows were selected as experimental materials, ear tissue DNA was extracted for pooled sequencing to screen for potential SNPs in the BAMBI gene, and genotyping technology was used to genotype the candidate SNPs and perform an association analysis with the reproductive performance of Large White sows.

[0028] For this purpose, the embodiments of this application provide a molecular marker primer for the reproductive performance of Large White sow, including the DNA molecule as shown in SEQ ID NO.1 and the DNA molecule as shown in SEQ ID NO.2. Among them, the "molecular marker primer" is used to amplify the nucleotide sequence containing the molecular marker linked to the reproductive performance of Large White sow, such as SNPs, to analyze the genotype of the molecular marker, so as to know the reproductive performance of Large White sows.

[0029] Based on this, the embodiments of this application also provide a molecular marker for the reproductive performance of Large White sow, which is amplified by the above-mentioned molecular marker primer. In some embodiments, this molecular marker includes the DNA molecules as shown in SEQ ID NO.3-6.

[0030] Based on this, the embodiments of this application also provide a molecular marker for the reproductive performance of Large White sow, including:

[0031] The nucleotide sequence formed by a single-base mutation of T>C at the 40058390th base on porcine chromosome 10; and / or

[0032] The nucleotide sequence formed by a single-base mutation of C>T at the 40058492th base on porcine chromosome 10.

[0033] In some embodiments, at position 40058390 on porcine chromosome 10, the TC genotype in the number of nipples of Large White sows is significantly higher than the TT genotype. For parity Large White sows, the total number of piglets born and the number of live piglets born are both significantly higher for the CC genotype than the TT genotype. For the number of healthy piglets, both the CC and TC genotypes are significantly higher than the TT genotype. For the litter weight at birth of parity Large White sows, the CC genotype is extremely significantly higher than the TT genotype.

[0034] In some embodiments, at position 40058492 on porcine chromosome 10, both the TC and TT genotypes in the number of nipples of Large White sows are significantly higher than the CC genotype. For the maternal index and reproductive index, the TT genotype is significantly higher than the CC genotype. For the total number of piglets born to parity Large White pigs, both the CT and TT genotypes are significantly higher than the CC genotype. For the number of live piglets born, the CT genotype is significantly higher than the CC genotype. For the number of healthy piglets, the CT genotype is extremely significantly higher than the CC genotype. For the number of mummies, the CT genotype is significantly less than the TT genotype. For the adjusted litter weight at 21 days of age of parity Large White pigs, the CC genotype is significantly higher than the CT genotype.

[0035] Based on this, the embodiments of the present application further provide the use of the molecular marker primers and / or the molecular markers in the preparation of reagents for identifying the germplasm resources and categories of Large White sow.

[0036] Based on this, the embodiments of the present application further provide a kit comprising the molecular marker primers and / or the molecular markers.

[0037] Based on this, the embodiments of the present application further provide a method for identifying the reproductive performance of Large White sows, comprising:

[0038] Obtaining genomic DNA of the Large White sow to be tested;

[0039] Performing PCR amplification using the molecular marker primers;

[0040] Detecting the genotype at position 40058390 on porcine chromosome 10 and / or the genotype at position 40058492 on porcine chromosome 10 according to the nucleotide sequence of the amplification product;

[0041] Determining the reproductive performance of the Large White sow according to the genotype.

[0042] In some embodiments, the reproductive performance indicators of the Large White sow include one or more of the number of nipples of the Large White sow, maternal index, reproductive index, total number of piglets born to parity Large White pigs, number of live piglets born, number of healthy piglets, number of mummies, and adjusted litter weight at 21 days of age of parity Large White pigs.

[0043] The present invention will be further described below in conjunction with specific examples. The following examples are only for explaining the present invention and do not constitute a limitation to the present invention. The test samples and test procedures used in the following examples include the following content (if the specific experimental conditions are not specified in the examples, they are usually in accordance with conventional conditions or the conditions recommended by reagent companies; the reagents, consumables, etc. used in the following examples can be obtained from commercial sources without special instructions).

[0044] 1. Experimental materials

[0045] The experimental pig population (316 Large White sows) all came from Tiankang Animal Husbandry Breeding Farm in Wujiaqu, Xinjiang. All the test pigs were in good health, had similar weights, and consistent feeding and management conditions. Ear tissue samples were collected for the extraction of tissue DNA. The relevant reproductive data of 316 Large White sows were sorted out and reserved for future use.

[0046] 2. Extraction of genomic DNA from pig population

[0047] The extraction of genomic DNA referred to the instruction manual of the Blood, Cell and Tissue DNA Extraction Kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. After DNA extraction, the DNA concentration was measured using Nano 2000. Samples with a 260 / 280 value between 1.7 and 2.0 and a concentration greater than 50 ng / μL were selected and stored in a -20°C refrigerator for subsequent use.

[0048] 3. Primer design

[0049] According to the full-length sequence of the pig BAMBI (Ensembl ID: ENSSSCG00000011014) gene provided by the Ensembl database, the Primer Primier 5.0 software was used to design PCR amplification primers. The primer sequences are shown in Table 1. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0050] Table 1 Primer information

[0051]

[0052] 3. Pooled library construction and PCR product sequencing

[0053] Randomly select 40 DNA samples, 10 μL for each sample to construct a DNA pool and perform PCR amplification. The PCR reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles. After detection by 1.2% agarose gel electrophoresis and the size of the target band, it was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were analyzed by chromas 2.6.5 software to screen for potential SNPs sites of the BAMBI gene.

[0054] 4. Polymorphic Locus Genotyping

[0055] After screening out the potential SNPs loci of the BAMBI gene, Shijiazhuang Borui Biotechnology Co., Ltd. was commissioned to perform genotyping on the DNA samples of 316 Large White sows using targeted sequencing genotyping technology based on multiplex PCR.

[0056] 5. Data Acquisition

[0057] The birth weight and number of nipples of the test pig population were recorded. The estimated breeding value (EBV) was evaluated by the pig farm based on the phenotypic and pedigree information of each performance, and the best linear unbiased prediction (BLUP) was established. The Maternal line index (MLI) and Swine Productivity Index (SPP) were calculated according to the EBV of each phenotypic data by the following (Formula 1-2). The reproductive performances of the test pig population in the 2nd to 6th parities were also statistically analyzed, including total number of born piglets, number of live born piglets, number of stillborn piglets, number of mummified piglets, number of healthy piglets, birth litter weight, and corrected 21-day litter weight.

[0058] Maternal line index (MLI) = 100 + 120.0×BVW2E + 8.8×BVLWT - 24.0×BVBF - 10.0×BVDAYS Reproductive index (SPP) = 100 + 120.0×BVNBA - 20.0×BVW2E + 8.8×BVLWT

[0059] In the formula, BVBF is the breeding value of corrected 100Kg backfat thickness, VDAYS is the breeding value of days to 100Kg body weight, BVNBA is the breeding value of number of live born piglets per litter, BVW2E is the breeding value of days from weaning to re-breeding, and BVLWT is the breeding value of corrected 21-day litter weight.

[0060] 6. Data Statistics and Analysis

[0061] The genotype frequency, gene frequency, observed heterozygosity (Ho), expected heterozygosity (He), effective number of alleles (Ne), polymorphism information content (PIC), and χ 2 value of each polymorphic locus were calculated according to the following (Formula 3-7), and the Hardy-Weinberg test was performed.

[17] The online software (RNA fold webserver) was used to predict the secondary structure of mRNA before and after BAMBI gene mutation, and Haploview 4.2 was used for linkage disequilibrium (LD) analysis. The general linear model (GLM) of SPSS 26.0 was used to analyze the differences in each reproductive trait among different genotypes. The results were expressed as "mean ± standard deviation", and P<0.05 was used as the criterion for judging significant differences. The correlation analysis model between each reproductive performance and genotype is shown in Equation 8.

[0062] Genetic homozygosity (Ho) (3):

[0063] Genetic heterozygosity (He) (4):

[0064] Effective number of alleles (Ne) (5):

[0065] Polymorphism information content (PIC) (6):

[0066] In the formula, n is the number of alleles at a certain locus, and Pi and Pj are the gene frequencies of the i-th and j-th alleles in the population, respectively.

[0067] χ 2 value (7): X 2 =(Oi - Ei) 2 / Ei

[0068] In the formula, Oi is the theoretical frequency and Ei is the actual observed frequency.

[0069] Correlation analysis model between each reproductive trait and each genotype (8): y ij1 =u + G i +P j +e ij1

[0070] In the formula, y ij1 is the trait observation value, μ is the overall mean, G i is the genotype effect, P j is the parity effect, and e ijl is the random error.

[0071] 7. Results and Analysis

[0072] (1) PCR amplification of BAMBI gene and screening of SNPs sites

[0073] After the PCR products were identified by 1.2% agarose gel electrophoresis, the band sizes were consistent with the target band (523 bp) Figure 1 ), and they could be used for subsequent sequencing analysis. The pooled sequencing chromatograms were analyzed using Chromas software Figure 2 and Table 2). Two synonymous mutation sites were screened in the CDS region of the BAMBI gene, that is, single-base mutations of T>C at the 40058390th base and C>T at the 40058492th base on Sus scrofa chromosome 10, named g.390T>C and g.492C>T respectively, both of which are synonymous mutations and do not change the encoded amino acids.

[0074] Table 2 Information table of mutation sites

[0075] SNPs Region where located Physical position Allele Mutation type g.390T>C CDS g.40058390 T>C Synonymous mutation (Ser) g.492C>T CDS g.40058492 C>T Synonymous mutation (Arg)

[0076] The obtained BAMBI gene SNPs: g.390T>C and g.492C>T are located in the nucleotide sequences shown in SEQ ID NO.3 - 6 (i.e., the DNA products amplified by the above primers) as follows:

[0077] ctctttgtttctgctccttcctataggacaaggcaacaggtatcagcctgacggtagcagaaacctcatcaccaaagtgcaggagctgacttcctccaaagagttgtggttccgggcggcagtgatcgctgttcccatcgccggagggctgatcctggtgttgctgatcatgctggccctgaggatgctgcggagcgagaacaagaggctgcaggaccagcggcagcagatgctgtcccgtttgcactacagcttccacggacgccactccaaaaaggggcaggttgccaagttggacttggagtgcatggtgcctgtgag T / C ggccacgagaactgctgtctgacgtgcgataagatgaggcaagctgacctcagccacgaccggctcctctcgctggtgcactggggcgtgtacagcggccg C / T gggaggctggagttcgtatgatggagactccccggaaccccacttccgggaccctcgaaggcccttgagttctgctggacaggagcactttatccgaag;

[0078] Among them, there is a polymorphism of g.390T>C at the base of the first underlined position, and a polymorphism of g.492C>T at the base of the second underlined position. When the first SNP is T and the second SNP is C, the nucleotide sequence is as shown in SEQ ID NO.3. When the first SNP is C and the second SNP is C, the nucleotide sequence is as shown in SEQ ID NO.4. When the first SNP is C and the second SNP is T, the nucleotide sequence is as shown in SEQ ID NO.5. When the first SNP is T and the second SNP is T, the nucleotide sequence is as shown in SEQ ID NO.6. (2) BAMBI gene genotyping results and population genetics analysis

[0079] Genetic structure analysis showed (Tables 3 and 4): For the two SNPs of the BAMBI gene, three genotypes of TT, CT, and CC were detected in the Large White sow population. Among the three genotypes in the Large White sow population, the heterozygous type > wild homozygous type > mutant homozygous type. Among them, T is the dominant gene at the g.390T>C locus, and C is the dominant gene at the g.492C>T locus; the two SNPs were in Hardy-Weinberg equilibrium in the Large White pig population (P>0.05); the two SNPs were moderately polymorphic in the Large White pig population (0.25<PIC<0.5), with relatively high polymorphic information content and large genetic variation, and more selection results could be obtained, indicating that the uniformity of these loci has the potential to be further improved as the sample size increases.

[0080] Table 3 Genotype frequencies and gene frequencies of BAMBI gene SNPs

[0081]

[0082] Table 4 Population genetics analysis of BAMBI gene SNPs

[0083]

[0084] (3) Linkage disequilibrium and haplotype analysis of BAMBI gene SNPs

[0085] Further linkage disequilibrium analysis was performed on the two SNPs (g.390T>C and g.492C>T) in the BAMBI gene. As Figure 3 can be seen, D` = 1 and R 2 = 0.66 > 0.33 for the two loci of g.390T>C and g.492C>T, indicating that g.390T>C and g.492C>T are in a strong linkage disequilibrium state in the Large White sow population.

[0086] (4) Prediction of the secondary structure of the BAMBI gene

[0087] Prediction of the secondary structure of BAMBI gene mRNA showed that after the g.390T>C mutation occurred in the CDS region of the BAMBI gene, its mRNA secondary structure did not change, but its minimum free energy was greater than that of the wild type ( Figure 4 B); after the g.492C>T mutation occurred in the CDS region of the BAMBI gene, its mRNA secondary structure changed, and its minimum free energy was less than that of the wild type ( Figure 4 C). After the g.390T>C and g.492C>T mutations occurred in the CDS region of the BAMBI gene, both would cause changes in the minimum free energy of the BAMBI gene, which might affect the stability of the BAMBI gene mRNA secondary structure and the results and quantities of protein products, and further affect its phenotype.

[0088] (5) Effects of polymorphic sites of the BAMBI gene on the reproductive performance of Large White sows

[0089] For the g.390T>C locus of the BAMBI gene, the TC genotype was significantly higher than the TT genotype in the number of nipples of Large White sows (P < 0.05). For the g.492C>T locus of the BAMBI gene, the TC and TT genotypes were significantly higher than the CC genotype in the number of nipples of Large White sows (P < 0.05), and the TT genotype was significantly higher than the CC genotype in the maternal index and reproductive index (P < 0.05) (Table 5).

[0090] Table 5 Effects of BAMBI on the reproductive performance of Large White sows

[0091]

[0092] (6) Effects of polymorphic sites of the BAMBI gene on the litter performance of parity Large White sows

[0093] For the g.390T>C locus of the BAMBI gene, the CC genotype was significantly higher than the TT genotype in the total number of piglets born and the number of live piglets born in parity Large White sows (P < 0.05), the CC and TC genotypes were significantly higher than the TT genotype in the number of healthy piglets (P < 0.05), and there was no significant difference among genotypes in the number of stillborn piglets and mummies; for the g.492C>T locus of the BAMBI gene, the CT and TT genotypes were significantly higher than the CC genotype in the total number of piglets born in parity Large White pigs (P < 0.05), the CT genotype was significantly higher than the CC genotype in the number of live piglets born (P < 0.05), the CT genotype was extremely significantly higher than the CC genotype in the number of healthy piglets (P < 0.01), the CT genotype was significantly less than the TT genotype in the number of mummies (P < 0.05), and there was no significant difference among genotypes in the number of stillborn piglets (Table 6).

[0094] Table 6 Effects of BAMBI gene SNPs on the litter performance of parity Large White sows

[0095]

[0096] (7) Effect of BAMBI gene polymorphic loci on the reproductive performance of parity Large White sows

[0097] For the g.390T>C locus of the BAMBI gene, the CC genotype was extremely significantly higher than the TT genotype in the litter weight at birth of parity Large White sows (P < 0.01), and there was no significant difference among genotypes in the corrected litter weight at 21 days of age. For the g.492C>T locus of the BAMBI gene, the CC genotype was significantly higher than the CT genotype in the corrected litter weight at 21 days of age of parity Large White pigs (P < 0.05), and there was no significant difference among genotypes in the litter weight at birth (Table 7).

[0098] Table 7 Effect of BMBAI gene SNPs on the reproductive performance of parity Large White sows

[0099]

[0100] In the examples of this application, through software (RNAfold web server) analysis, it was found that after the synonymous mutations (g.390T>C and g.492C>T) occurred in the BAMBI gene, the secondary structure and free energy of the mRNA of the BAMBI gene changed. Through correlation analysis with the reproductive performance of Large White sows, it was found that both synonymous mutation sites of the BAMBI gene were related to the reproductive performance of Large White sows. It is suggested that the influence of genetic variation of the BAMBI gene on the reproductive performance of Large White sows may be related to the influence on the mRNA stability or protein translation efficiency after the synonymous mutation of the BAMBI gene, but the specific mechanism remains to be further studied in the future.

[0101] As mentioned above, the above are only the preferred specific embodiments of this application, but the protection scope of this application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in this application should be covered by the protection scope of this application.

Claims

1. Use of molecular marker primers in the preparation of a reagent for identifying the reproductive performance of Large White sows, wherein the molecular marker primers comprise a DNA molecule such as SEQ ID NO.1 and a DNA molecule shown in SEQ ID NO.2; The DNA sequence containing the molecular marker amplified by the molecular marker primers is as follows: ctctttgtttctgctccttcctataggacaaggcaacaggtatcagcctgacggtagcagaaacctcatcaccaaagtgcaggagctgacttcctccaaagagttgtggttccgggcggcagtgatcgctgttcccatcgccggagggctgatcctggtgttgctgatcatgctggccctgaggatgctgcggagcgagaacaagaggctgcaggaccagcggcagcagatgctgtcccgtttgcactacagcttccacggacgccactccaaaaaggggcaggttgccaagttggacttggagtgcatggtgcctgtgagYggccacgagaactgctgtctgacgtgcgataagatgaggcaagctgacctcagccacgaccggctcctctcgctggtgcactggggcgtgtacagcggccgYgggaggctggagttcgtatgatggagactccccggaaccccacttccgggaccctcgaaggcccttgagttctgctggacaggagcactttatccgaag; The DNA sequence is located in the CDS region of the pig BAMBI gene, and the Ensembl ID of the pig BAMBI gene in the Ensembl database is ENSSSCG00000011014; the molecular marker is the Y base in the DNA sequence, located at positions 40058390 and 40058492 on porcine chromosome 10, with a single-base mutation of T > C at position 40058390 and a single-base mutation of C > T at position 40058492; Among them, The reproductive performance of the Large White sows is one or more of the number of nipples, maternal index, reproductive index of Large White sows, and the total number of piglets born, number of live piglets born, number of healthy piglets, number of mummies, litter weight at birth, and adjusted litter weight at 21 days of age of parity Large White sows; The molecular marker at position 40058390 has genotypes TT, TC, and CC; in terms of the number of nipples of Large White sows, the TC genotype is significantly higher than the TT genotype; in terms of the total number of piglets born and number of live piglets born of parity Large White sows, the CC genotype is significantly higher than the TT genotype; in terms of the number of healthy piglets, the CC and TC genotypes are significantly higher than the TT genotype; in terms of the litter weight at birth of parity Large White sows, the CC genotype is extremely significantly higher than the TT genotype; The molecular markers at position 40058492 have genotypes TT, TC, and CC; in terms of the number of teats of Large White sows, the TC and TT genotypes are significantly higher than the CC genotype; in terms of the maternal index and reproductive index of Large White sows, the TT genotype is significantly higher than the CC genotype; in terms of the total number of piglets born alive of parity Large White sows, the CT and TT genotypes are significantly higher than the CC genotype, and in terms of the number of live piglets born of parity Large White sows, the CT genotype is significantly higher than the CC genotype; in terms of the number of healthy piglets of parity Large White sows, the CT genotype is extremely significantly higher than the CC genotype; in terms of the number of mummies of parity Large White sows, the CT genotype is significantly less than the TT genotype; in terms of the adjusted litter weight at 21 days of age of parity Large White sows, the CC genotype is significantly higher than the CT genotype.

2. A method for identifying the reproductive performance of Large White sows, comprising: Obtaining the genomic DNA of the Large White sow to be tested; Performing PCR amplification with molecular marker primers, the molecular marker primers comprising a DNA molecule such as SEQ ID NO.1 and a DNA molecule shown in SEQ ID NO.2, and the DNA sequence containing the molecular marker amplified by the molecular marker primers is as follows: ctctttgtttctgctccttcctataggacaaggcaacaggtatcagcctgacggtagcagaaacctcatcaccaaagtgcaggagctgacttcctccaaagagttgtggttccgggcggcagtgatcgctgttcccatcgccggagggctgatcctggtgttgctgatcatgctggccctgaggatgctgcggagcgagaacaagaggctgcaggaccagcggcagcagatgctgtcccgtttgcactacagcttccacggacgccactccaaaaaggggcaggttgccaagttggacttggagtgcatggtgcctgtgagYggccacgagaactgctgtctgacgtgcgataagatgaggcaagctgacctcagccacgaccggctcctctcgctggtgcactggggcgtgtacagcggccgYgggaggctggagttcgtatgatggagactccccggaaccccacttccgggaccctcgaaggcccttgagttctgctggacaggagcactttatccgaag; The DNA sequence is located in the CDS region of the porcine BAMBI gene. The Ensembl ID of the porcine BAMBI gene in the Ensembl database is ENSSSCG00000011014; the molecular marker is the Y base in the DNA sequence, located at positions 40058390 and 40058492 of porcine chromosome 10, with a single-base mutation of T > C at position 40058390 and a single-base mutation of C > T at position 40058492; Detect the genotype of the base at position 40058390 and / or the genotype of the base at position 40058492 according to the DNA sequence of the amplification product. There is a single-base mutation of T > C at position 40058390 and a single-base mutation of C > T at position 40058492; Determine the reproductive performance of the Large White sows according to the genotype. The reproductive performance of the Large White sows is one or more of the number of nipples, maternal index, reproductive index of the Large White sows, and the total number of piglets born, number of live piglets born, number of healthy piglets, number of mummies, litter weight at birth, and corrected litter weight at 21 days of age of the parity Large White sows; The molecular marker at position 40058390 has genotypes TT, TC, and CC; in terms of the number of nipples of the Large White sows, the TC genotype is significantly higher than the TT genotype; in terms of the total number of piglets born and number of live piglets born of the parity Large White sows, the CC genotype is significantly higher than the TT genotype; in terms of the number of healthy piglets, the CC and TC genotypes are significantly higher than the TT genotype; in terms of the litter weight at birth of the parity Large White sows, the CC genotype is extremely significantly higher than the TT genotype; The molecular marker at position 40058492 has genotypes TT, TC, and CC; in terms of the number of nipples of the Large White sows, the TC and TT genotypes are significantly higher than the CC genotype; in terms of the maternal index and reproductive index of the Large White sows, the TT genotype is significantly higher than the CC genotype; in terms of the total number of piglets born of the parity Large White sows, the CT and TT genotypes are significantly higher than the CC genotype, and in terms of the number of live piglets born of the parity Large White sows, the CT genotype is significantly higher than the CC genotype; in terms of the number of healthy piglets of the parity Large White sows, the CT genotype is extremely significantly higher than the CC genotype; in terms of the number of mummies of the parity Large White sows, the CT genotype is significantly less than the TT genotype; in terms of the corrected litter weight at 21 days of age of the parity Large White sows, the CC genotype is significantly higher than the CT genotype.

Images