Therapeutic nucleic acid molecules, cocktails, medicaments and use in the treatment of solid tumors

By combining or fusing nucleic acid fragments encoding IL-7 and IL-12 with a carrier, immune cells are activated, overcoming the problem of the microenvironment barrier in solid tumors and achieving highly efficient treatment of solid tumors.

CN116621966BActive Publication Date: 2026-01-27LIVERNA THERAPEUTICS INC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202310493868.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-05-06
Filing Date
2023-05-04
Publication Date
2026-01-27
Estimated Expiration
2043-05-04

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively overcome the microenvironmental barriers of solid tumors, resulting in poor efficacy of nucleic acid molecular therapy.

Method used

Nucleic acid molecular fragments encoding the p35 and p40 subunits of IL-7 protein and interleukin IL-12 are used to form nucleic acid molecular drugs by combining or fusing different nucleic acid molecular fragments with suitable carriers. These drugs can activate a variety of immune cells, break through the microenvironment barrier, and achieve highly efficient inhibition of tumor cells.

Benefits of technology

It achieves highly effective treatment of solid tumors, activates the activity of multiple immune cells, enhances the tumor-killing ability, and synergistically induces Th1 cell differentiation, NK cell maturation and T cell expansion, inhibits tumor growth and improves treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116621966B_ABST
    Figure CN116621966B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of gene medicine, in particular to therapeutic nucleic acid molecules, mixtures, drugs and application in treating solid tumors. The present application provides nucleic acid molecules or nucleic acid molecule mixtures with nucleic acid molecule fragments encoding interleukin IL-12 p35 and p40 subunits and nucleic acid molecule fragments encoding IL-7 protein as main components, and provides nucleic acid molecules with different combination forms of the above-mentioned nucleic acid molecule fragments, the combination forms include fusion of different nucleic acid molecule fragments, and different nucleic acid molecule fragments form a composition in free form. It has been verified that the nucleic acid molecule fragments provided by the present application show effective therapeutic effect on solid tumors in the form of free combination or preparation into fusion nucleic acid molecules. The present application further uses an adaptive carrier to complex the above-mentioned nucleic acid molecule composition or fusion nucleic acid molecule to obtain a nucleic acid molecule drug, and gives a corresponding preparation method, so as to relieve the urgent demand for drugs in the treatment of solid tumors at present.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims priority to Chinese patent application filed on May 6, 2022 (application number: 2022104869114, invention title: therapeutic nucleic acid molecules, mixtures, drugs and their use in the treatment of solid tumors), the contents of which are incorporated herein by reference in their entirety. Technical Field

[0002] This invention relates to the field of gene therapy technology, and in particular to therapeutic nucleic acid molecules, mixtures, drugs, and their use in the treatment of solid tumors. Background Technology

[0003] In clinical practice, tumors are divided into solid tumors and non-solid tumors. Solid tumors are tangible tumors that can be detected through clinical examinations such as X-rays, CT scans, ultrasound, or palpation. Tumors that cannot be seen or palpated by X-rays, CT scans, ultrasound, or palpation, such as leukemia in hematological diseases, are non-solid tumors.

[0004] There are four main treatment methods for solid tumors: surgery, chemotherapy, radiation therapy, and targeted therapy. These methods can remove, destroy, kill, and damage tumor cells, thus alleviating the condition. Depending on the type of tumor, a single treatment method or a combination of multiple methods may be used. In addition, tumor immunotherapy has developed rapidly and has gradually become another effective treatment method after the four main tumor treatment methods; among them, due to the superior properties of nucleic acid molecules, nucleic acid-based tumor immunotherapy has also been proposed. Simply put, nucleic acid-based therapy utilizes chemically modified nucleic acid molecules to enter the cytoplasm, where the cytoplasm's own nucleotides are used for transcription and expression to generate proteins needed by the body.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The first objective of this invention is to provide a nucleic acid molecule or mixture of nucleic acid molecules that has a therapeutic effect on solid tumors, wherein the nucleic acid molecule or mixture of nucleic acid molecules contains multiple nucleic acid molecule fragments that can break through the microenvironment barrier of solid tumors and achieve a highly efficient inhibitory effect on tumor cells.

[0007] A second objective of the present invention is to provide a nucleic acid molecular composition or fused nucleic acid molecule composed of the above-mentioned nucleic acid molecular fragments, in the form of a composition of different nucleic acid molecular fragments or in the form of a fusion of different nucleic acid molecules, for use in the treatment of solid tumors.

[0008] A third objective of this invention is to provide a nucleic acid molecular drug comprising the above-mentioned nucleic acid molecular composition and / or fused nucleic acid molecules, and compounding them with a suitable carrier to obtain a drug that can be used clinically to treat solid tumors.

[0009] Another objective of this invention is to provide a method for preparing the above-mentioned nucleic acid molecular drugs. The method involves mixing an aqueous phase containing the above-mentioned nucleic acid molecules with an organic phase containing carrier components to obtain the nucleic acid molecular drugs. This method is simple, easy to implement, and suitable for industrial application.

[0010] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0011] In a first aspect, the present invention provides a therapeutic nucleic acid molecule or mixture of nucleic acid molecules, said nucleic acid molecule comprising: a nucleic acid molecule fragment (A) encoding an IL-7 protein; and a nucleic acid molecule fragment (B) encoding the p35 and p40 subunits of interleukin IL-12.

[0012] In this document, nucleic acid or nucleic acid molecule refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of nucleic acid or nucleic acid molecules include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. The target protein or polypeptide encoded by the nucleic acid or nucleic acid molecule may optionally encode the sense or antisense strand. The nucleic acid or nucleic acid molecule may be naturally occurring, synthetic, recombinant, or any combination thereof.

[0013] IL-12 is primarily produced by activated antigen-presenting cells such as dendritic cells and macrophages. IL-12 binds to its receptors IL-12RB1 and IL-12RB2 on the cell membrane, activating downstream receptors Jak2 and Tyk2, which in turn induces STAT4 phosphorylation and dimerization. STAT4 then binds to the promoters of target genes, regulating gene expression, such as IFNγ. IL-12 can activate NK cells to express CD69 and CD25, promoting NK cell proliferation. IL-12 can promote the differentiation and activation of Th1 cells, thereby activating cytotoxic CD8+ T cells. IL-12 can promote macrophage differentiation into the pro-inflammatory M1 type rather than the anti-inflammatory M2 type, thereby inducing the expression of chemokines CXCL9, CXCL10, and CXCL11, promoting the recruitment and accumulation of immune cells.

[0014] IL-7 is widely expressed in tissues including lymph nodes, bone marrow, spleen, skin, lungs, and liver. IL-7 interacts with its receptor to activate the Jak-Stat5 and PI3K-AKT signaling pathways, thereby regulating the expression of downstream genes. IL-7 can increase the expression of NK, NKT, LAK, and CD8+. + T cells' tumor-killing function. IL-7 can enhance the tumor-killing ability of T cells and NK cells by inducing the expression of perforin, IFNγ, and FasL. In addition, IL-7 can inhibit tumor cell growth by stimulating monocytes to release IL-1β, IL-1α, and TNF-α. IL-7 can downregulate CD8+. + PD-1 expression on T cells reverses T cell exhaustion. IL-7 plays a crucial role in maintaining the survival and proliferation of memory T cells. Furthermore, IL-7 can maintain memory CD4+ cells after antigen withdrawal. + and CD8 + Balance of the T cell pool.

[0015] Cytokines exhibit synergistic effects in their biological functions. IL-7 can increase the expression of the IL-12 receptor on NK cells and T cells, making the latter more sensitive to IL-12. IL-7 can synergistically increase IFN-γ expression with IL-12. IL-12 and IL-7 can synergistically activate T cells and NK cells, enhancing their ability to kill tumor cells. IL-12 and IL-7 synergistically induce NK cells to express NKG2E, NKp44, and NKp46, promoting NK cell maturation. IL-12 and IL-7 synergistically induce antigen-presenting cells to express HLA-DR, promoting their antigen-presenting capacity. IL-12 and IL-7 synergistically enhance T cell proliferation and maintain tumor-infiltrating lymphocytes. IL-7 can increase tumor-infiltrating CD8+. + T cell TCR diversity, while IL-12 and IL-7 work synergistically to increase the proportion of a small subset of T cell clones, thereby enhancing T cell clonality. This synergistic effect activates tumor-infiltrating T cells and enhances their anti-tumor activity.

[0016] In an optional embodiment, the nucleic acid molecule further includes a nucleic acid molecule fragment (C), which includes at least one of the following proteins: IFN-α, IFN-β, IFN-γ, GM-CSF, IL-15, and IL-2, wherein the nucleic acid molecule fragment (C) encodes IFN-α. IFN-α can enhance the antigen-presenting capacity of dendritic cells and promote their migration to lymph nodes. IFN-α enhances the killing ability of immune cells by inducing the release of perforin and granzyme. IFN-α can inhibit the immunosuppressive function and cell proliferation capacity of Tregs and MDSCs. IFN-α can promote the differentiation of M1 macrophages. In addition, IFN-α can also exert a direct anti-tumor effect through mechanisms such as inhibiting the cell cycle of tumor cells, promoting cell terminal differentiation, and inducing apoptosis.

[0017] In optional embodiments, based on the biological functions and synergistic effects of cytokines IL-12, IL-7, and IFN-α, in the field of anti-tumor therapy, the combined application of these three cytokines is expected to achieve the following main effects: inducing the differentiation and activation of Th1 cells; inducing the maturation of NK cells; activating and promoting the expansion of T cells and NK cells, as well as their tumor-killing ability; maintaining the survival and expansion of memory T cells; promoting the differentiation of macrophages into the pro-inflammatory M1 type; enhancing the antigen-presenting ability of dendritic cells; promoting the recruitment and infiltration of immune cells into tumor tissues by inducing the expression of chemokines; reversing T cell exhaustion; inhibiting the function of Tregs and MDSCs; directly inhibiting the growth of tumor cells; and inducing apoptosis.

[0018] In an optional embodiment, the amino acid sequence of IL-7 encoded by the nucleic acid fragment (A) is as shown in SEQ ID NO. 42, or contains an amino acid sequence that is at least 80% identical to SEQ ID NO. 42, for example, but not limited to, an amino acid sequence that contains at least 80%, 85%, 90%, 95%, or 98% identical to SEQ ID NO. 42.

[0019] In an optional embodiment, the nucleotide sequence of the nucleic acid fragment (A) is selected from any one of SEQ ID NO.22-24 and SEQ ID NO.47-49. SEQ ID NO.22-24 are RNA sequences, and SEQ ID NO.47-49 are DNA sequences.

[0020] In an optional embodiment, the nucleotide sequence of the nucleic acid fragment (A) is selected from any one of the nucleotide sequences that are at least 70%, 75%, 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO.22-24 and SEQ ID NO.47-49.

[0021] In an optional embodiment, the amino acid sequence of the p35 subunit of IL-12 encoded by the nucleic acid fragment (B) is as shown in SEQ ID NO.39, or contains an amino acid sequence that is at least 80% identical to SEQ ID NO.39, for example, but not limited to, an amino acid sequence that contains at least 80%, 85%, 90%, 95%, or 98% identical to SEQ ID NO.39.

[0022] In an optional embodiment, the amino acid sequence of the p40 subunit of IL-12 encoded by the nucleic acid fragment (B) is as shown in SEQ ID NO.40, or contains an amino acid sequence that is at least 80% identical to SEQ ID NO.40, for example, but not limited to, an amino acid sequence that contains at least 80%, 85%, 90%, 95%, or 98% identical to SEQ ID NO.40.

[0023] In an optional embodiment, the p35 and p40 subunits of IL-12 encoded by the nucleic acid fragment (B) are linked by a linker with the amino acid sequence shown in SEQ ID NO.41 (GSSGGGGSPGGGSS).

[0024] In an optional embodiment, the nucleotide sequence of the nucleic acid fragment (B) is selected from any one of SEQ ID NO. 19–21 and SEQ ID NO. 44–46. SEQ ID NO. 19–21 are RNA sequences, and SEQ ID NO. 44–46 are DNA sequences.

[0025] In an optional embodiment, the nucleotide sequence of the nucleic acid fragment (B) is selected from any one of the nucleotide sequences that are at least 70%, 75%, 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO.19-21 and SEQ ID NO.44-46.

[0026] In an optional embodiment, the amino acid sequence of the IFN-α polypeptide encoded by the nucleic acid fragment (C) is as shown in SEQ ID NO. 43, or contains an amino acid sequence that is at least 80% identical to SEQ ID NO. 43, for example, but not limited to, an amino acid sequence that contains at least 80%, 85%, 90%, 95%, or 98% identical to SEQ ID NO. 43.

[0027] In an optional embodiment, the nucleotide sequence of the nucleic acid fragment (C) is selected from any one of SEQ ID NO.26-28 and SEQ ID NO.50-52. SEQ ID NO.26-28 are RNA sequences, and SEQ ID NO.50-52 are DNA sequences.

[0028] In an optional embodiment, the nucleotide sequence of the nucleic acid fragment (C) is selected from any one of the nucleotide sequences that are at least 70%, 75%, 80%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO.26-28 and SEQ ID NO.50-52.

[0029] In optional embodiments, nucleic acid fragments (A), (B), and / or (C) can be sequence-optimized using mRNA sequences to improve properties related to expression efficacy after in vivo administration. These improvements include: enhancing mRNA stability; increasing translational efficiency in target tissues; reducing the number of truncated proteins expressed; improving protein folding or preventing misfolding; reducing the toxicity of the expression product; reducing cell death induced by the expression product; and increasing and / or decreasing protein aggregation, resulting in mRNAs with improved properties. Sequence optimization also aims to: optimize the formulation and delivery characteristics of nucleic acid-based therapeutics while maintaining structural and functional integrity; overcome expression thresholds; increase expression rates; improve half-life and / or protein concentration; optimize protein localization; and avoid adverse biological responses such as immune responses and / or degradation pathways. Sequence optimization techniques include: (1) codon optimization based on codon frequencies in specific organs and / or host organisms to ensure proper folding and expression; (2) adjusting G / C content to increase mRNA stability or reduce secondary structures; (3) minimizing tandem repeat codons or base runs that may impair gene construction or expression; (4) customizing transcription and translation control regions; and (5) reducing or eliminating problematic secondary structures within polynucleotides.

[0030] Sequence identity between two nucleotide sequences indicates the percentage of identical nucleotides between the sequences. Sequence identity between two amino acid sequences indicates the percentage of identical amino acids between the sequences.

[0031] The term "% identity" or similar term refers to the percentage of identical nucleotides or amino acids between sequences being compared at optimal alignment. This percentage is purely statistical, and the differences between the two sequences may (but are not necessarily) be randomly distributed across the entire length of the sequences being compared. Comparison of two sequences is typically performed after optimal alignment by comparing equivalent sequences relative to fragments or a "comparison window" to identify local regions of the corresponding sequences.

[0032] In an optional implementation, the nucleic acid molecule includes DNA molecules and / or RNA molecules.

[0033] In an optional embodiment, the DNA molecule includes a chain DNA molecule and / or a circular DNA molecule.

[0034] In an optional implementation, the RNA molecule includes mRNA or circular RNA.

[0035] In an optional embodiment, the 5' end and / or 3' end of the nucleic acid molecule fragment has protective modification groups.

[0036] In an optional embodiment, the nucleic acid molecule fragment is an mRNA fragment, and the 5' end modification group of the mRNA fragment is selected from ARCA, m7G(5"")ppp(5"")(2""OMeA)pG, m7G(5"")ppp(5"")(2""OMeG)pG, m7(3""OMeG)(5"")ppp(5"")(2""OMeG)pG, m7(3""OMeG)(5"")ppp(5"")(2""OMeA)pG, mCAP, dmCAP, tmCAP or dmCAP.

[0037] In an optional embodiment, the 3' end protective modification group of the mRNA fragment is poly(A), and the length of poly(A) is 50 to 200, preferably 80 to 200.

[0038] In an optional embodiment, the mRNA fragment further contains a 5'UTR;

[0039] In an optional embodiment, the length of the 5'UTR is preferably 10 to 200 nucleotides, more preferably 15 to 100 nucleotides;

[0040] In an optional implementation, the 5'UTR includes a KOZAK sequence or a DNAH2 5'UTR;

[0041] In an optional implementation, the nucleotide sequence of the KOZAK sequence is shown in SEQ ID. NO. 16;

[0042] In an optional embodiment, the nucleotide sequence of the DNAH2 5'UTR is shown in SEQ ID. NO. 38;

[0043] In an optional embodiment, the mRNA fragment further contains a 3'UTR;

[0044] In an optional embodiment, the 3' UTR sequence is as shown in SEQ ID. NO. 1 to 10, where SEQ ID. NO. 1 is from creatine kinase (CK), SEQ ID. NO. 2 is from myoglobin, SEQ ID. NO. 3 is from α-actin, SEQ ID. NO. 4 is from albumin, SEQ ID. NO. 5 and 7 are from histamine globulin (α-globin), SEQ ID. NO. 6 is from collagen (Col6a2; collagen, type IV, alpha 2), and SEQ ID. NO. 10 is from hemoglobin HBA2.

[0045] In an optional implementation, the mRNA includes a 5' cap, a 5' UTR, an ORF, a 3' UTR, and a 3' poly(A) tail from the 5' end to the 3' end.

[0046] In an optional embodiment, based on the provided RNA sequence, those skilled in the art will be able to obtain the corresponding DNA sequence (e.g., uracil to thymine conversion). Similarly, based on the provided DNA sequence, those skilled in the art will obtain the corresponding RNA sequence (e.g., thymine to uracil conversion). In an optional embodiment, based on the provided RNA or DNA sequence, those skilled in the art will be able to obtain the corresponding amino acid sequence.

[0047] In an optional implementation, one or more uridines in the mRNA are replaced with a modified nucleoside. In some implementations, the modified nucleoside replacing the uridine is pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), or 5-methyl-uridine (m5U).

[0048] In a second aspect, the present invention provides a first therapeutic nucleic acid molecular composition comprising a mixture of nucleic acid molecules as described in any of the foregoing embodiments.

[0049] In an optional embodiment, the mass ratio of each free nucleic acid molecular fragment is 10:1 to 1:10; preferably, the mass ratio of each free nucleic acid molecular fragment is 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, or 1:10.

[0050] Thirdly, the present invention provides a therapeutic fusion nucleic acid molecule, the therapeutic fusion nucleic acid molecule comprising the nucleic acid molecule described in any of the foregoing embodiments, the nucleic acid molecule comprising a nucleic acid molecule fragment (A) and a nucleic acid molecule fragment (B), and in an optional embodiment, further comprising a nucleic acid molecule fragment (C).

[0051] In an optional implementation, at least any two nucleic acid fragments are linked together by a linker.

[0052] In an optional embodiment, the mass ratio of each nucleic acid fragment in the fused nucleic acid molecule is 10:1 to 1:10; preferably, the mass ratio of each free nucleic acid fragment is 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, or 1:10.

[0053] Fourthly, the present invention provides a second therapeutic nucleic acid molecular composition comprising a combination of the first therapeutic nucleic acid molecular composition of the foregoing embodiments and the therapeutic fusion nucleic acid molecule of the foregoing embodiments.

[0054] In an optional embodiment, the mass ratio of each nucleic acid molecular fragment in the second therapeutic nucleic acid molecular composition is 10:1 to 1:10; preferably, the mass ratio of each free nucleic acid molecular fragment is 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, or 1:10.

[0055] Fifthly, the present invention provides the use of the nucleic acid molecule or mixture of nucleic acid molecules described in any of the foregoing embodiments, the first therapeutic nucleic acid molecule composition described in the foregoing embodiments, the therapeutic fusion nucleic acid molecule described in the foregoing embodiments, or the second therapeutic nucleic acid molecule composition described in the foregoing embodiments in the preparation of anti-solid tumor drugs or in the evaluation of the efficacy of solid tumor drugs.

[0056] In an optional embodiment, the mass ratio of each nucleic acid molecule fragment in the nucleic acid molecule or mixture of nucleic acid molecules is 10:1 to 1:10; preferably, the mass ratio of each free nucleic acid molecule fragment is 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, or 1:10.

[0057] In optional embodiments, the solid tumor includes epithelial tumors, Hodgkin's lymphoma, non-Hodgkin's lymphoma, prostate tumors, ovarian tumors, renal cell tumors, gastrointestinal tumors, liver tumors, colorectal tumors, hemangiomas, mesotheliomas, pancreatic tumors, breast tumors, sarcomas, lung tumors, colon tumors, brain tumors, melanomas, small cell lung tumors, neuroblastomas, testicular tumors, carcinomas, adenocarcinomas, gliomas, spermatomas, retinoblastomas, or osteosarcomas.

[0058] In a sixth aspect, the present invention provides a nucleic acid molecular drug for treating solid tumors, said nucleic acid molecular drug comprising nucleic acid molecular components and a carrier encapsulating the nucleic acid molecular components;

[0059] The nucleic acid molecule component is selected from any of the therapeutic nucleic acid molecules or mixtures of nucleic acid molecules described in the foregoing embodiments, the first therapeutic nucleic acid molecule composition described in the foregoing embodiments, the therapeutic fusion nucleic acid molecule described in the foregoing embodiments, or the second therapeutic nucleic acid molecule composition described in the foregoing embodiments.

[0060] In an optional embodiment, the mass ratio of each free nucleic acid molecular fragment is 10:1 to 1:10; preferably, the mass ratio of each free nucleic acid molecular fragment is 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, or 1:10.

[0061] In optional embodiments, the mass ratio of each nucleic acid fragment in the fused nucleic acid molecule is 10:1 to 1:10; preferably, the mass ratio of each nucleic acid fragment in the fused nucleic acid molecule is 10:1, 7:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:7, or 1:10.

[0062] In an optional embodiment, the carrier comprises liposome nanoparticles.

[0063] In an optional embodiment, each free nucleic acid fragment or fused nucleic acid molecule in the nucleic acid molecular component is individually encapsulated by liposome nanoparticles.

[0064] In an optional implementation, at least two free nucleic acid fragments or fused nucleic acid molecules are individually encapsulated by liposome nanoparticles. For example, two or three free nucleic acid fragments or fused nucleic acid molecules are each individually encapsulated by liposome nanoparticles.

[0065] In an optional implementation, at least two free nucleic acid fragments are co-encapsulated by liposome nanoparticles. For example, two or three free nucleic acid fragments may be co-encapsulated by liposome nanoparticles.

[0066] In an optional embodiment, at least one free nucleic acid molecule fragment and a fused nucleic acid molecule are co-encapsulated by liposome nanoparticles.

[0067] In an optional embodiment, the liposome nanoparticles comprise, by molar percentage, 20% to 50% cationic lipids, such as, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%; 20% to 50% DOPG, such as, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%; 5% to 20% cholesterol, such as, but not limited to, 5%, 10%, 15%, or 20%; and 1% to 5% PEG-DMG, such as, but not limited to, 1%, 2%, 3%, 4%, or 5%.

[0068] In an optional embodiment, the liposome nanoparticles comprise, by molar percentage, 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0069] In optional embodiments, the invention may also include therapeutic proteins or therapeutic chemical pharmaceutical components.

[0070] In an optional implementation, the therapeutic protein includes atezolizumab.

[0071] In a seventh aspect, the present invention provides a method for preparing a nucleic acid molecular drug according to any of the foregoing embodiments, wherein free nucleic acid molecular fragments and / or fused nucleic acid molecules are dissolved in a buffer solution to obtain an aqueous phase, each lipid component of liposome nanoparticles is measured and dissolved in an organic solvent to obtain an organic phase, and the aqueous phase and organic phase are mixed and the organic phase is removed to obtain the nucleic acid molecular drug.

[0072] In an optional embodiment, the volume ratio of the aqueous phase to the organic phase is 1:2 to 4, preferably 1:3.

[0073] In an optional embodiment, the buffer solution comprises citrate buffer or sodium acetate, preferably citrate buffer.

[0074] In an optional embodiment, the pH of the buffer solution is 3 to 7, preferably 4.

[0075] In an optional embodiment, the concentration of free nucleic acid fragments and / or fused nucleic acid molecules in the aqueous phase is 0.05 mg / mL to 0.5 mg / mL, preferably 0.1 mg / mL.

[0076] In an optional embodiment, the organic solvent is selected from C1 to C4 lower alcohols, preferably anhydrous ethanol.

[0077] In an optional embodiment, the concentration of the lipid component in the organic phase is 5 mg / mL to 7 mg / mL, preferably 6 mg / mL.

[0078] In an optional implementation, a microfluidic mixture of the aqueous and organic phases is used, and the organic solvent is filtered by tangential flow.

[0079] Preferably, the flow rate of the microfluidic system is >3 ml / min, and more preferably 12 mL / min.

[0080] In an optional embodiment, the mixture further includes a concentration step, wherein the concentration step brings the final concentration of the free nucleic acid fragments and / or fused nucleic acid molecules to 50 μg / mL to 200 μg / mL, preferably 100 μg / mL.

[0081] Eighthly, the present invention provides a pharmaceutical composition comprising a nucleic acid molecular drug as described in any of the foregoing embodiments, or a nucleic acid molecular drug prepared by any of the preparation methods described in any of the foregoing embodiments.

[0082] In an optional embodiment, the pharmaceutical composition further includes a protein drug selected from at least one of anti-PD-1 antibody, anti-PD-L1 antibody, anti-CTLA-4 antibody, anti-DC20 antibody, anti-Her2 antibody, anti-CD33 antibody, anti-CD52 antibody, anti-VEGFR antibody, anti-EGFR antibody, anti-RANKL antibody, anti-CD30 antibody, anti-VEGFR2 antibody, anti-GD2 antibody, anti-CD38 antibody, anti-CD22 antibody, and anti-CD33 antibody.

[0083] In an optional embodiment, the pharmaceutical composition further includes at least one of atezolizumab, nivolumab, pamumab, pidilizumab, alzolamab, durvalumab, atratromab, and ipilimumab.

[0084] Compared with the prior art, the present invention has the following beneficial effects:

[0085] The nucleic acid molecules or mixtures thereof provided by this invention, which are mainly composed of nucleic acid molecular fragments encoding IL-7 protein and p35 and p40 subunits encoding interleukin IL-12, can comprehensively activate the activity of multiple immune cells and achieve effective treatment of solid tumors.

[0086] The present invention also provides nucleic acid molecules comprising different combinations of the above-mentioned nucleic acid molecular fragments, the combinations including the fusion of different nucleic acid molecular fragments and the formation of a composition of different nucleic acid molecular fragments in free form. It has been verified that the two types of nucleic acid molecular fragments provided by the present invention, whether combined in free form or prepared into fused nucleic acid molecules, have shown effective therapeutic effects on solid tumors.

[0087] The present invention further utilizes an adaptor carrier to combine with the above-mentioned nucleic acid molecular composition or fused nucleic acid molecule to obtain a nucleic acid molecular drug, and provides a corresponding preparation method, in order to alleviate the urgent need for drugs in the current treatment of solid tumors. Attached Figure Description

[0088] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0089] Figure 1 This is a schematic diagram of the tumor inoculation site in each group of mice in the embodiments of the present invention;

[0090] Figure 2 These are the tumor volume change curves for the five groups of experiments in Example 1 of this invention;

[0091] Figure 3 These are the tumor volume change curves for the five groups of experiments in Example 3 of this invention;

[0092] Figure 4 These are the tumor volume change curves for the four groups of experiments in Example 4 of this invention;

[0093] Figure 5 This is a photograph of the mouse used in Example 5 of the present invention;

[0094] Figure 6 These are the tumor volume change curves for the three groups of experiments in Example 5 of this invention;

[0095] Figure 7 This refers to the detection results of the proportion of white blood cells infiltrating the tumor in Example 6 of the present invention;

[0096] Figure 8 The curves showing the change in tumor volume over the number of days after injection in each experimental group in Example 18 of this invention are shown.

[0097] Figure 9 The tumor volume changes of each mouse in each experimental group in Example 18 of this invention;

[0098] Figure 10This is a graph showing the tumor volume change in each experimental group in Example 19 of the present invention;

[0099] Figure 11 The curves showing the relative tumor inhibition rates of each experimental group in Example 20 of this invention are shown.

[0100] Figure 12 The curves showing the change in tumor volume with the number of days after injection in each experimental group in Example 20 of this invention are shown.

[0101] Figure 13A and Figure 13B The tumor volume changes of each mouse in each experimental group in Example 20 of the present invention;

[0102] Figure 14 The curves showing the change in tumor volume with the number of days after injection in each experimental group in Example 21 of this invention are shown.

[0103] Figure 15 The tumor volume changes of mice G1 to G6 in Example 22 of this invention. Detailed Implementation

[0104] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0105] To demonstrate that the therapeutic nucleic acid molecules or mixtures of nucleic acid molecules provided by this invention have a therapeutic effect on solid tumors, this invention constructs a method for evaluating the therapeutic effect on solid tumors, the specific steps of which are as follows:

[0106] 1. Construction of a mouse CT26 tumor model

[0107] Selection of experimental animals: (1) Strain: BALB / c, (2) Grade: SPF, (3) Age: 7.6-8.7 weeks, (4) Sex: Female.

[0108] Tumor inoculation: CT26.WT cells were resuscitated and passaged at passage N+8. CT26.WT cells in logarithmic growth phase (inoculation passage N+11) were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a dose of 1×10⁻⁶. 6 cells / 100μL / animal, inoculation site as follows: Figure 1 Position 1 is shown.

[0109] 2. Construction of a mouse KM12 tumor model

[0110] Selection of experimental animals (1) Strain: SCID mice, (2) Grade: SPF grade, (3) Age: 10 weeks, (4) Sex: female.

[0111] Tumor inoculation: KM-12 cells were resuscitated and passaged at passage number N+8. KM-12 cells in logarithmic growth phase were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a dose of 5 × 10⁶ cells / year. 6 cells / 200μL / animal, inoculation site as follows: Figure 1 Position 1 is shown.

[0112] 3. Construction of a mouse Cal27 tumor model

[0113] Selection of experimental animals (1) Strain: BALB / c nude mouse, (2) Grade: SPF grade, (3) Age: 4-6 weeks, (4) Sex: male.

[0114] Tumor inoculation: Cal27 cells were resuscitated and passaged at passage N+8. Cal27 cells in logarithmic growth phase (inoculation passage N+11) were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a dose of 5 × 10⁶ cells / year. 9 cells / L / each, inoculation site as follows Figure 1 Position 2 as shown.

[0115] 4. Construction of a mouse NCI-N87 tumor model

[0116] Selection of experimental animals: (1) Strain: SCID, (2) Grade: SPF, (3) Age: 11 weeks, (4) Sex: Female.

[0117] Tumor inoculation: NCI-N87 cells were resuscitated and passaged at passage N+8. NCI-N87 cells in logarithmic growth phase (inoculation passage N+11) were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a seeding density of 3.0 × 10⁻⁶ cells / year. 6 cells / 200μL / animal, inoculation site as follows: Figure 1 Position 1 is shown.

[0118] 5. Construction of a mouse A375 tumor model

[0119] Selection of experimental animals: (1) Strain: SCID, (2) Grade: SPF, (3) Age: 6-8 weeks, (4) Sex: Female.

[0120] Tumor inoculation: A375 cells were resuscitated and passaged at passage N+8. A375 cells in logarithmic growth phase (inoculation passage N+11) were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a dose of 5 × 10⁶ cells / year. 6cells / 200μL / animal, inoculation site as follows: Figure 1 Position 1 is shown.

[0121] 6. Construction of a mouse NCI-H1975 tumor model

[0122] Selection of experimental animals (1) Strain: NSG, (2) Grade: SPF, (3) Age: 10 weeks, (4) Sex: Female.

[0123] Tumor inoculation: NCI-H1975 cells were resuscitated and passaged at passage N+8. NCI-H1975 cells in logarithmic growth phase (inoculation passage N+11) were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a dose of 1×10⁻⁶. 6 cells / 100μL / animal, inoculation site as follows: Figure 1 Position 1 is shown.

[0124] 7. Construction of a mouse MDA-MB-231 tumor model

[0125] Selection of experimental animals: (1) Species: mouse; (2) Strain: huHSC-NCG-hIL15 (T038070); (3) Grade: SPF grade; (4) Age: 16.7 weeks (age at inoculation); (5) Sex: female.

[0126] Humanized mouse identification: 8.7 weeks after huHSC-NCG-hIL15 immune reconstitution, peripheral blood flow cytometry analysis of mice showed the following indicators: hCD45+, hCD3+, CD4, CD8, and NK (hCD56+, hCD16+). The average proportion of hCD45+ cells to viable cells was 24.82%, and the average hCD56+ / hCD45+ ratio was 10.8%, indicating successful construction of the humanized model; cell expansion was then performed.

[0127] Tumor inoculation: MDA-MB-231 cells were resuscitated and passaged at passage number N+23. 12.5 weeks after immune reconstitution, MDA-MB-231 cells in logarithmic growth phase (inoculation passage number N+33) were collected, the culture medium was removed, and the cells were washed twice with PBS before inoculation at a dose of 5 × 10⁶ cells / year. 6 cells / 100μL / animal (Matrix gel 1:1), inoculation site as follows Figure 1 Position 3 is shown.

[0128] 8. Animal euthanasia

[0129] During the experiment, tumor size was observed, mouse weight was measured, and clinical pathological assessment was performed. Clinical scores (weight, mouse posture, activity, hair, skin, etc.) were also assessed based on clinical observations. If the experimental mice exhibited the following indicators, they would be euthanized: (1) When the tumor volume of a single mouse exceeded 3000 mm. 3 (1) Euthanasia of a single mouse; (2) Persistent loose stools; (3) Slowed movement (inability to eat or drink); (4) Arched back, lying on its side; (5) Reduced activity, with signs of muscle atrophy; (6) Dyspnea; (7) Progressive hypothermia; (8) Paralysis, spasms; (9) Persistent bleeding; (10) Inability to move normally due to a large tumor or other reasons; (11) Inability to move normally due to severe ascites or enlarged abdominal girth.

[0130] 9. Indicator Calculation Formula

[0131] The tumor volume is calculated as follows: tumor volume (mm) 3 = 0.5 × tumor long diameter × tumor short diameter 2 .

[0132] TGI TV Formula for calculating (relative tumor inhibition rate):

[0133]

[0134]

[0135] V nt : Tumor volume of mouse number n on day t;

[0136] V n0 : Tumor volume of mouse number n on day 0;

[0137] RTV n : The relative tumor volume of mouse number n on day t;

[0138] mean RTV treat : Mean RTV of the treatment group;

[0139] mean RTV vehicle : Average RTV of the Vehicle group;

[0140] TGI TW Formula for calculating (tumor weight change):

[0141]

[0142] mean TW treat : The average tumor weight of mice in the treatment group at the endpoint;

[0143] mean TW vehicle The average tumor weight of mice in the Vehicle group at the endpoint treatment.

[0144] 10. Statistical Analysis

[0145] Experimental results are expressed as mean ± standard error (Mean ± SEM). Independent samples t-tests (T-Tests) were used to compare two groups. Data were analyzed using SPSS, with P < 0.05 considered statistically significant. Graphpad Prism was used for plotting.

[0146] This invention provides a method for preparing lipid nanoparticles containing mRNA. Unless otherwise specified, the mRNA used for injection administration in the following examples is administered via lipid nanoparticles obtained by encapsulating cationic lipids separately. The preparation method for lipid nanoparticles obtained by encapsulating cationic lipids separately is described in Example 8 or Example 15, and the preparation method for lipid nanoparticles obtained by co-encapsulating cationic lipids is described in Examples 7, 9, 16, or 17. Those skilled in the art can prepare lipid nanoparticles according to the type and number of nucleic acid molecules using the above preparation methods. In the following examples, the nucleotide sequences of SEQ ID NO. 11–15 and SEQ ID NO. 25 are mouse-derived, and the nucleotide sequences of SEQ ID NO. 17–24 and SEQ ID NO. 26–29 are human-derived.

[0147] It should be noted that the mRNA structure containing an open reading frame used in the following embodiments comprises, from the 5' end to the 3' end, a 5' cap, a 5' UTR, an ORF, a 3' UTR, and a 3' poly(A) tail. The 5' cap is as follows: the 5' UTR sequence is shown in SEQ ID NO. 38; the ORF is selected, for example, from any of the aforementioned SEQ ID NO. 11–15 and SEQ ID NO. 17–29; the 3' UTR sequence is shown in SEQ ID NO. 10; and the 3' poly(A) tail length is 100 Å. Uric acid in the mRNA sequence is completely replaced with N1-methyl-pseudouridine (m1ψ). In situ injection administration in this paper refers to intratumoral injection administration (intratumoral injection administration means injection into the tumor, i.e., injection of the therapeutic agent at any point of contact with the tumor).

[0148] Example 1

[0149] This embodiment investigates the effect of different combinations of mRNAs encoding different polypeptides on tumor inhibition rate.

[0150] Using the CT26 tumor model described above as an experimental model, five groups of experiments were conducted, with eight mice in each group.

[0151] Group 1.1 (G1) was administered saline twice a week for 3 weeks; Group 1.2 (G2) was a mixture of mRNA encoding IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 14), mRNA encoding IL-7 (nucleotide sequence as shown in SEQ ID No. 15), and mRNA encoding GM-CSF (nucleotide sequence as shown in SEQ ID No. 25).

[0152] Group 1.3 (G3) is a mixture of mRNAs encoding the IL-12 p35 and p40 subunits (nucleotide sequences as shown in SEQ ID No. 14), mRNAs encoding IL-7 (nucleotide sequences as shown in SEQ ID No. 15), mRNAs encoding IFN-α (nucleotide sequences as shown in SEQ ID No. 13), and mRNAs encoding GM-CSF (nucleotide sequences as shown in SEQ ID No. 25). Group 1.4 (G4) is a mixture of mRNAs encoding the IL-12 p35 and p40 subunits (nucleotide sequences as shown in SEQ ID No. 14), mRNAs encoding IL-15 (nucleotide sequences as shown in SEQ ID No. 11), mRNAs encoding IFN-α (nucleotide sequences as shown in SEQ ID No. 13), and mRNAs encoding GM-CSF (nucleotide sequences as shown in SEQ ID No. 25). Group 1.5 (G5) is a mixture of mRNA encoding the IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 14), mRNA encoding IL-7 (nucleotide sequence as shown in SEQ ID No. 15), and mRNA encoding IFN-α (nucleotide sequence as shown in SEQ ID No. 13).

[0153] The mRNA mixture was administered weekly for 3 weeks. All five groups of mice were administered via orthotopic injection, with a total mRNA dose of 0.12 mg / kg per group. Different RNAs within each group were administered in equal amounts. The experimental endpoint was set at 25 days post-grouping, and the effects of the five groups on tumors were tested. The relative tumor inhibition rate (TGI) of IL-12+IL-7+GM-CSF (G2 group) against CT26 colon cancer cells in mice was verified using the above calculation method. TV The relative tumor inhibition rate (TGI) of IL-12+IL-7+IFN-α+GM-CSF (G3 group), IL-12+IL-15+IFN-α+GM-CSF (G4 group), and IL-12+IL-7+IFN-α (G5 group) against mouse colon cancer cells CT26 was 36.46%. TVThe tumor inhibition rates were 98.56%, 97.67%, and 97.07% for the G3, G4, and G5 groups, respectively, but the relative tumor inhibition rates (TGI) for the G3-G5 groups were significantly lower. TV There was no significant difference (P>0.05). The results of the tumor volume change curve with the number of days after injection are as follows: Figure 2 As shown.

[0154] In addition, this invention also screened other components of the mRNA three-component mixture IL-12+IL-7+IFN-α, and after replacing IFN-α in the mRNA three-component mixture IL-12+IL-7+IFN-α with IFN-β or IFN-γ, the relative tumor inhibition rate (TGI) obtained was [not specified]. TV The percentages were 67% and 75%, respectively, slightly lower than IFN-α.

[0155] Example 2

[0156] This embodiment examines the ability of different mRNA sequences of the same polypeptide fragment to express the polypeptide fragment in vitro.

[0157] In this embodiment, three IL-7 mRNAs (sequences SEQ ID NO.22, SEQ ID NO.23, and SEQ ID NO.24), three IL-12 mRNAs (sequences SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21), and three IFN-α mRNAs (sequences SEQ ID NO.26, SEQ ID NO.27, and SEQ ID NO.28) were prepared by in vitro transcription and transfected into HEK293 cells. First, 4 × 10⁶ cells were used... 5 HEK293 cells were seeded at a density of [number] cells / ml. After 24 hours, when the cells reached approximately 80% confluence, transfection was performed. The transfection system, consisting of 2 μg mRNA and Lipofectamine Memormax (ThermoFisherScientific) transfection reagent, was added to one well of a 6-well plate. Transfection procedures were performed according to the reagent's product instructions.

[0158] After 24 hours, cell supernatant and cell lysate were collected, and the levels of mRNA-expressed proteins were detected by ELISA.

[0159] mRNA sequence encoding the IL-12 polypeptide relative expression level SEQ ID NO.19 1.5 SEQ ID NO.20 1 SEQ ID NO.21 0.9

[0160] mRNA sequence encoding IL-7 polypeptide relative expression level SEQ ID NO.22 1.5 SEQ ID NO.23 1 SEQ ID NO.24 0.8

[0161] mRNA sequence encoding IFN-α polypeptide relative expression level SEQ ID NO.26 1.6 SEQ ID NO.27 0.8 SEQ ID NO.28 1

[0162] The three sequences of IL-12 mRNA, IL-7 mRNA, and IFN-α mRNA listed in this invention do not show significant differences in terms of common codon frequency, GC content, mRNA secondary structure (such as mRNA free energy), cis-acting mRNA unstable sequences, RNase splicing sites, and repeat units. However, the transcription results show that the IL-12 expression level in cells transfected with the IL-12 mRNA sequence of SEQ ID NO.19 is higher than that in cells transfected with the IL-12 mRNA sequences of SEQ ID NO.20 and SEQ ID NO.21; the IL-7 expression level in cells transfected with the IL-7 mRNA sequence of SEQ ID NO.22 is higher than that in cells transfected with the IL-7 mRNA sequences of SEQ ID NO.23 and SEQ ID NO.24; and the IFN-α mRNA expression level in cells transfected with the IFN-α mRNA sequence of SEQ ID NO.26 is higher than that in cells transfected with the IFN-α mRNA sequences of SEQ ID NO.27 and SEQ ID NO.28.

[0163] This invention uses any one of the three sequences of IL-12 mRNA in the three-component mixture of mRNA (IL-12+IL-7+IFN-α) to determine the ORF. When adjusting the dosage based on the IL-12 expression levels of each sequence, it does not affect tumor regression or the relative tumor inhibition rate (TGI). TV It also has effects such as immune memory and combination therapy with anti-tumor drugs. This effect also applies to IL-7 and IFN-α.

[0164] Example 3

[0165] This embodiment examines the effect of different dosages on tumor suppression.

[0166] Using the aforementioned mouse MDA-MB-231 tumor model as the experimental model, on day 16 after model construction (14.8 weeks after immune reconstitution), 30 humanized tumor-bearing mice were randomly divided into 5 groups of 6 mice each based on tumor volume. The day of grouping was defined as day D0, and drug administration began on day D0. The remaining mice in each group were euthanized.

[0167] Group 3.1 (G1) administration regimen: saline; Group 3.2 (G2) administration regimen: 5 mg / kg Tecentriq (positive control); Group 3.3 (G3) administration regimen: 0.032 mg / kg mRNA tricomponent mixture (IL-12+IL-7+IFN-α, SEQ ID NO.19+SEQ ID NO.22+SEQ ID NO.26); Group 3.4 (G4) administration regimen: 0.16 mg / kg mRNA tricomponent mixture (IL-12+IL-7+IFN-α, SEQ ID NO.19+SEQ ID NO.22+SEQ ID NO.26); Group 3.5 (G5) administration regimen: 0.8 mg / kg mRNA tricomponent mixture (IL-12+IL-7+IFN-α, SEQ ID NO.19+SEQ ID NO.22+SEQ ID NO.26). Tumor volume changes in mice from G1 to G5 are as follows: Figure 3 As shown.

[0168] Based on statistical analysis of tumor volume data at the time of drug discontinuation, compared with the control group: G2 group Tecentriq (TGI TV =19.67%) significantly inhibited tumor growth (P<0.05*); the low-dose (TGI) group in G3 significantly inhibited tumor growth (P<0.05*); TV =45.52%), G4 group (TGI) TV =73.94%) and G5 group (TGI) TV =95.10%) can significantly inhibit tumor growth (P<0.001***).

[0169] This study evaluated the pharmacodynamic effects of different doses of the three-component mixture of test substance mRNA and the positive control drug Tecentriq in a huHSC-NCG-hIL15 mouse subcutaneous loading MDA-MB-231 breast cancer tumor model. The experimental data indicate that, under the current testing system, the positive control drug Tecentriq exhibited a significant tumor-inhibiting effect (TGI) during the tumor growth phase compared to the control group G1. TV =19.67%, P=0.021*). The three-component mixture of low, medium and high doses of the test substance mRNA all showed significant tumor inhibition effects compared with the control group G1 in terms of tumor volume.

[0170] Example 4

[0171] This embodiment tests (1) a single drug containing three components, IL-12+IL-7+IFN-α (SEQ ID NO.14+SEQ ID NO.15+SEQ ID NO.13); and (2) the antitumor effect of the single drug combined with a protein drug (taking an anti-PD-1 antibody as an example).

[0172] In this experiment, wild-type BALB / c mice were selected and inoculated with mouse colon cancer cells CT26. Three consecutive intratumoral injections of the aforementioned single drug were performed at 10, 17, and 24 days post-inoculation; and (2) combined administration of the single drug and anti-PD-1 antibody were administered. The results were compared with (3) a positive anti-PD-1 antibody drug. Figure 4 As shown, single drugs containing three different mRNA components and their combination with anti-PD-1 antibodies exhibit relative tumor inhibition rates (TGI) against CT26 colon cancer cells in wild-type BALB / c mouse models. TV The relative tumor inhibition rates (TGIs) were 99.06% and 98.39%, respectively, while the relative tumor inhibition rate of the anti-PD-1 antibody-positive drug was 47.78%. From these results, it can be concluded that when examining the differences in anti-tumor activity against CT26 mouse colon cancer cells using monotherapy with IL-12, IL-7, and IFN-α, and in combination with anti-PD-1 antibodies, the relative tumor inhibition rate (TGI) in this experiment is significant. TV In terms of tumor inhibition rate (TGI), compared with the control group saline (G1), when the combination of IL-12 + IL-7 + IFN-α was used alone (G3), the relative tumor inhibition rate (TGI) was significantly higher. TV The efficacy rate was 99.06%, indicating excellent antitumor activity. Therefore, it was used in combination with anti-PD-1 antibodies (G4, TGI). TV When the efficacy was 98.39%, the combined effect of anti-PD-1 antibodies was not observed. However, when IL-12 + IL-7 + IFN-α were used alone, their anti-tumor activity was significantly better than that of anti-PD-1 antibodies (G2, TGI) alone. TV The tumor inhibition rate was 47.78%, and its relative tumor inhibition rate (TGI) was 47.78%. TV There are significant differences.

[0173] Example 5

[0174] This embodiment investigates whether mice with tumor regression can develop immune memory after injection of an LNP preparation containing IL-12, IL-7, and IFN-α.

[0175] In this embodiment, mice with tumor regression were selected and re-inoculated with mouse colon cancer cells CT26. Tumor size was observed on days 0, 4, 7, 11, 13, 15, 18, 20, 22, 25, 27, 32, and 34 after tumor cell inoculation, up to 81 days after the first drug administration. The results are as follows: Figure 5 and Figure 6 As shown.

[0176] G1 consisted of 6 mice that had never been injected with the three components of IL-12, IL-7, and IFN-α; G2 consisted of 6 mice that had been injected with the three components of IL-12, IL-7, and IFN-α in combination with anti-PD-1 antibody and whose tumors had regressed; G3 consisted of 6 mice that had been injected with the three components of IL-12, IL-7, and IFN-α alone and whose tumors had regressed.

[0177] G1 is divided into G1-1 and G1-2. G1-1 is inoculated only with mouse colon cancer cells CT26, while G1-2 is inoculated with mouse colon cancer cells CT26 and injected with three components IL-12, IL-7 and IFN-α on day 15.

[0178] The results showed that: 1) In G1-1 mice that were not injected with any of the three components of IL-12, IL-7, and IFN-α, the tumor volume reached 111.84 ± 1.86 mm after 11 days. 3 At the end of the experiment, the tumor volume reached 2702.94±485.22 mm. 3 ;

[0179] 2) G1-2 mice injected with IL-12, IL-7, and IFN-α on day 15 showed a tumor volume of 99.71 ± 8.26 mm after 11 days. 3 At the end of the experiment, the tumor volume reached 249.38±162.09 mm. 3 ;

[0180] 3) In G2 and G3 mice where tumor cells were re-inoculated after tumor regression, no tumor growth was observed until the end of the experiment.

[0181] The results above indicate that the injection of IL-12, IL-7, and IFN-α can induce tumor regression. Furthermore, re-inoculation of tumor cells after tumor regression can also inhibit tumor growth, suggesting that long-term immune memory can be formed in animals after the injection of IL-12, IL-7, and IFN-α.

[0182] Example 6

[0183] This embodiment examines the proportion of leukocytes infiltrating the tumor when three components (mouse IL-12, mouse IL-7, and mouse IFN-α) are simultaneously injected into the tumor site (nucleotide sequences are shown in SEQ ID NO.14, SEQ ID NO.15, and SEQ ID NO.13).

[0184] In this embodiment, wild-type BALB / c mice were selected and inoculated with mouse colon cancer cells CT26. The formulation containing the aforementioned three components (G3 group and G4 group) was injected intratumorally twice, at 10 days and 17 days after tumor cell inoculation, respectively. This was compared with an mPD-1 positive control (G2 group), which was administered intraperitoneally at 10 days, 14 days, and 17 days after tumor cell inoculation. G3 group consisted of the three-component formulation prepared according to the method described in Example 8, and G4 group consisted of the three-component formulation prepared according to the method described in Example 7. The results are as follows: Figure 7 As shown, when the three components of IL-12, IL-7, and IFN-α were formulated as drugs, the number of T cells, NK cells, gMDSCs, mMDSCs, macrophages, CD4+T cells, and CD25+CD4+ cells infiltrating the tumor were significantly different from those in the saline injection group. From the above results, it can be concluded that the proportion of leukocytes infiltrating the tumor in the G3 and G4 groups (IL-12, IL-7, and IFN-α) showed an increasing trend compared to the G1 (saline) and G2 (mPD-1 positive drug) groups. The proportion of T cell infiltration (including CD4+ helper T cells and CD8+ cytotoxic T cells) in the tumors of the G3 and G4 groups increased significantly, which is consistent with the tumor inhibition results in the efficacy experiment; and the results of the G3 and G4 groups in the efficacy experiment were also quite consistent.

[0185] To evaluate the efficacy of intratumoral injection of a three-component mixture of mRNA (IL-12+IL-7+IFN-α) in various cancer types, five xenograft mouse models were established as previously described: KM12 (CRC), Cal27 (head and neck cancer), NCI-N87 (gastric cancer), A375 (melanoma), and NCI-H1975 (NSCLC). Mice with tumors of KM12 (CRC), Cal27 (head and neck cancer), NCI-N87 (gastric cancer), A375 (melanoma), and NCI-H1975 (NSCLC) were given a three-component mixture of mRNA (IL-12+IL-7+IFN-α (nucleotide sequences shown in SEQ ID NO.19, SEQ ID NO.22, and SEQ ID NO.26)). The results showed that the number of T cells, NK cells, gMDSCs, mMDSCs, macrophages, CD4+T cells, and CD25+CD4+ cells infiltrating the tumors in each tumor model mouse group was significantly different from that in the saline injection group.

[0186] Example 7

[0187] This embodiment provides a method for preparing lipid nanoparticles that simultaneously encapsulate mRNA encoding three peptides: IL-12p35 and p40 subunits, IL-7 peptide, and IFN-α peptide. The lipid components of the lipid nanoparticles, by molar percentage, comprise 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0188] The specific preparation method is as follows:

[0189] (a) The mRNA encoding IL-12p35 and p40 subunit peptides, the mRNA encoding IL-7 peptide, and the mRNA encoding IFN-α peptide were dissolved in citrate buffer at pH 4 at a mass ratio of 1:1:1, and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0190] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0191] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and the ethanol component in the solution was removed by tangential flow filtration (TFF). The mixture was then concentrated to a mRNA concentration of 100 μg / mL to obtain lipid nanoparticles containing RNA encoding IL-12 peptide, RNA encoding IL-7 peptide, and RNA encoding IFN-α peptide.

[0192] Example 8

[0193] This embodiment provides a method for preparing lipid nanoparticles that encapsulate mRNA encoding three peptides: IL-12p35 and p40 subunits, IL-7 peptide, and IFN-α peptide. The lipid components of the lipid nanoparticles, by molar percentage, comprise 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0194] The specific preparation method is as follows:

[0195] (1) Lipid nanoparticles encoding RNA of IL-12 polypeptide

[0196] (a) The mRNA encoding the IL-12p35 and p40 subunit peptides was dissolved in citrate buffer at pH 4 and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0197] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0198] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and ethanol was removed from the solution using tangential flow filtration (TFF). The mixture was then concentrated until the concentration of mRNA in the system was 100 μg / ml to obtain lipid nanoparticles containing RNA encoding the IL-12 polypeptide.

[0199] (2) Prepare lipid nanoparticles encoding RNA of IL-7 polypeptide and lipid nanoparticles encoding RNA of IFN-α polypeptide according to step (1) of this embodiment.

[0200] (3) The RNA lipid nanoparticles encoding the three polypeptides were mixed in a mass ratio of 1:1:1 to obtain lipid nanoparticles containing RNA encoding IL-12 polypeptide, RNA encoding IL-7 polypeptide, and RNA encoding IFN-α polypeptide.

[0201] Example 9

[0202] This embodiment provides a method for preparing lipid nanoparticles that simultaneously encapsulate DNA plasmids encoding three peptides: IL-12p35 and p40 subunits, IL-7 peptide, and IFN-α peptide. The DNA encoding each peptide is integrated into three different plasmids. The lipid components of the lipid nanoparticles, by molar percentage, include 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0203] The specific preparation method is as follows:

[0204] (a) The DNA plasmids encoding IL-12p35 and p40 subunit peptides, the DNA plasmid encoding IL-7 peptide, and the DNA plasmid encoding IFN-α peptide were dissolved in citrate buffer at pH 4 at a mass ratio of 1:1:1, and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0205] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0206] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and the ethanol was removed from the solution using tangential flow filtration (TFF). The mixture was then concentrated to a mRNA concentration of 100 μg / mL to obtain lipid nanoparticles containing DNA plasmids encoding IL-12, IL-7, and IFN-α peptides.

[0207] Example 10

[0208] This embodiment provides a therapeutic fusion nucleic acid molecule.

[0209] Structure of fusion RNA molecules: Fusion RNA molecules include regions encoding IL-12 and IL-7, as well as, but are not limited to, untranslated regions (UTRs, such as 5'UTRs or 3'UTRs), 5' cap regions, poly-A tail regions, start regions, stop regions, signal sequence regions, linker sequences, and combinations thereof.

[0210] The linker sequence encodes a protein cleavage signal containing at least one protein cleavage site. The encoded protein cleavage signal may include, but is not limited to, protein precursor convertase (or hormone precursor convertase), thrombin, and / or factor Xa protein cleavage signals, for example, using a furin cleavage site (FCS) (see US7374930B2). One advantage of choosing an FCS is that furin is widely distributed in most cell types, and the fusion RNA of this invention can efficiently express active peptides in almost any cell type in vivo.

[0211] The DNA sequence of the Furin cleavage site is CGTCAACGTCGT (SEQ ID NO.30); the RNA sequence of the Furin cleavage site in the fusion RNA is CGUCAACGUCGU (SEQ ID NO.31).

[0212] Taking the structure of a fusion RNA including portions encoding IL-12 and IL-7 polypeptides as an example: 5' cap – 5' UTR – start region – RNA encoding IL-12 – linker – RNA encoding IL-7 – 3' UTR – stop region – 3' polyA tail.

[0213] The linker can be, for example, a cleavable linker or a protease-sensitive linker. The linker is selected from the group consisting of cleavable linkers F2A linker (with the amino acid sequence GSGVKQTLNFDLLKLAGDVESNPGP, SEQ ID NO.32), P2A linker (with the amino acid sequence GSGATNFSLLKQAGDVEENPGP, SEQ ID NO.33), T2A linker (with the amino acid sequence GSGEGRGGSLLTCGDVEENPGP, SEQ ID NO.34), E2A linker (e.g., with the amino acid sequence GSGQCTNYALLKLAGDVESNPGP, SEQ ID NO.35), and combinations thereof.

[0214] Self-cleaving peptides can be, but are not limited to, 2A peptides. Known 2A peptides in the art include, for example, the 2A peptide of foot-and-mouth disease virus (FMDV), the 2A peptide of equine rhinitis A virus, the 2A peptide of the tussock moth virus, and the 2A peptide of porcine cephalovirus-1. Several viruses use 2A peptides to produce two proteins from a single transcript via ribosome jumping, resulting in the weakening of the normal peptide bond at the 2A peptide sequence, leading to the production of two discontinuous proteins from a single translation event. Polynucleotide sequences encoding 2A peptides include, but are not limited to, the following sequences (the polynucleotide sequences of 2A peptides can be modified or codon-optimized by methods described herein and / or known in the art): (1)

[0216] GGAAGCGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCU (SEQ ID NO. 36);

[0217] Or, (2)

[0218] UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAACAAACUCUUAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAUCCAGGTCCACUC (SEQ ID NO. 37).

[0219] The structure of the therapeutic fusion nucleic acid molecule in the following examples is as follows: 5' cap – 5' UTR – start region – RNA encoding IL-12 – linker – RNA encoding IL-7 – 3' UTR – stop region – 3' polyA tail; wherein the 5' cap region is m7Gppp(5')(2'-OMeA)pG (7-methylguanosine triphosphate-2-methoxyguanosine monophosphate cap analog; CAP1-GAG); the 5' UTR sequence is shown in SEQ ID No. 38; the start region sequence is the promoter sequence, specifically AUG; the RNA encoding IL-12 is shown in SEQ ID No. 19; the linker RNA is shown in SEQ ID No. 31; the RNA encoding IL-7 is shown in SEQ ID No. 22; the 3' UTR sequence is shown in SEQ ID No. 10; the stop region sequence is the stop sequence, specifically UAA; the polyA tail region is also called poly(A), and its length is 100 Å.

[0220] In the fusion RNA molecule, the nucleic acid fragment (B) (i.e., the RNA encoding IL-12) can be located near the 5' end, as shown above; or it can be located near the 3' end. The specific structure is: 5' cap ' - 5' UTR - start region - RNA encoding IL-7 - linker - RNA encoding IL-12 - 3' UTR - stop region - 3' polyA tail.

[0221] Example 11

[0222] This embodiment provides a therapeutic fusion nucleic acid molecule. The only difference from Example 10 is the structure of the fusion RNA molecule. The fusion RNA molecule of this embodiment includes portions encoding IL-12, IL-7, and IFN-α polypeptides, and also includes, but is not limited to, untranslated regions (UTRs, such as 5'UTRs or 3'UTRs), 5' cap regions, poly-A tail regions, start regions, stop regions, signal sequence regions, linker sequences, and combinations thereof.

[0223] The structure of the therapeutic fusion nucleic acid molecule is as follows: 5' cap – 5' UTR – start region – RNA encoding IL-12 – linker – RNA encoding IL-7 – linker – RNA encoding IFN-α – 3' UTR – stop region – 3' polyA tail; wherein the 5' cap region is m7Gppp(5')(2'-OMeA)pG (7-methylguanosine triphosphate-2-methoxyguanosine monophosphate cap analog; CAP1-GAG); the 5' UTR sequence is shown in SEQ ID No. 38; the start region sequence is the promoter sequence, specifically AUG; the RNA encoding IL-12 is shown in SEQ ID No. 19; the linker RNA is shown in SEQ ID No. 31; the RNA encoding IL-7 is shown in SEQ ID No. 22; the RNA encoding IFN-α is shown in SEQ ID No. 26; the 3' UTR sequence is shown in SEQ ID No. 10; the stop region sequence is the stop sequence, specifically UAA; the polyA tail region is also called poly(A), and its length is 100 Å.

[0224] The relative order of nucleic acid fragments (A), (B), and (C) in the fusion RNA molecule can be interchanged. For example, it could be: 5' cap – 5' UTR – start region – RNA encoding IL-12 – linker – RNA encoding IFN-α – linker – RNA encoding IL-7 – 3' UTR – stop region – 3' polyA tail; 5' cap – 5' UTR – start region – RNA encoding IL-12 – linker – RNA encoding IL-7 – linker – RNA encoding IFN-α – 3' UTR – stop region – 3' polyA tail; 5' cap – 5' UTR – start region – RNA encoding IL-7 – linker – RNA encoding IFN-α – linker – RNA encoding IL-12 – 3' UTR – stop region – 3' polyA tail; 5' cap – 5' UTR – start region – RNA encoding IL-12 ... IL-12 – linker – linker – IL-12 – linker – linker – IL-12 – linker – linker – IL-12 – linker – linker – IL-12 – linker – linker – linker – IL-12 – linker – linker – linker – IL-12 – linker – linker – linker – IL-12 – linker – linker – linker – IL-12 – linker – linker – linker – linker – IL-12 – linker – linker – linker – linker – IL-12 – linker – linker – linker – linker – linker – IL-12 – linker – linker – linker – linker – linker – linker – IL-12 – linker – linker – linker – linker – linker – linker – linker L-7 RNA linker — IL-12 RNA linker — IFN-α RNA linker — 3'UTR — Termination region — 3' polyA tail, 5' cap — 5'UTR — Start region — IFN-α RNA linker — IL-7 RNA linker — IL-12 RNA linker — 3'UTR — Termination region — 3' polyA tail, 5' cap — 5'UTR — Start region — IL-7 RNA linker — IL-12 RNA linker — IFN-α RNA linker — 3'UTR — Termination region — 3' polyA tail, 5' cap — 5'UTR — Start region — IFN-α RNA linker — IL-12 RNA linker — IL-7 RNA linker — 3'UTR — Termination region — 3' polyA tail.

[0225] Example 12

[0226] This embodiment provides a therapeutic LNP formulation of a fusion nucleic acid molecule, prepared as follows: The fusion nucleic acid molecule mRNA encodes IL-12 p35 and p40 subunits and an IL-7 polypeptide. The structure of the fusion nucleic acid molecule mRNA is as described in Example 10. The lipid components of the lipid nanoparticles, by molar percentage, comprise 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0227] The specific preparation method is as follows:

[0228] (a) The therapeutic fusion nucleic acid molecule mRNA was dissolved in citrate buffer at pH 4 and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0229] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0230] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and ethanol was removed from the solution using tangential flow filtration (TFF). The mixture was then concentrated until the concentration of mRNA in the system was 100 μg / ml to obtain lipid nanoparticles containing therapeutic fusion nucleic acid mRNA.

[0231] Example 13

[0232] This embodiment provides an LNP formulation of a therapeutic fusion nucleic acid molecule, which differs from Example 12 only in that the fusion nucleic acid molecule mRNA encodes IL-12p35 and p40 subunits, IL-7 polypeptide, and IFN-α polypeptide.

[0233] Example 14

[0234] The lipid nanoparticles containing therapeutic fusion nucleic acid mRNA prepared in Example 13 were mixed with the lipid nanoparticles containing DNA plasmids encoding IL-12 polypeptide, IL-7 polypeptide, and IFN-α polypeptide prepared in Example 9 at a mass ratio of 1:1 to obtain a second therapeutic nucleic acid molecule composition.

[0235] Example 15

[0236] This embodiment provides a method for preparing lipid nanoparticles that encapsulate mRNA encoding two peptides, namely IL-12p35 and p40 subunits and IL-7 peptide. The lipid components of the lipid nanoparticles, by molar percentage, include 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0237] The specific preparation method is as follows:

[0238] (1) Lipid nanoparticles encoding RNA of IL-12 polypeptide

[0239] (a) The mRNA encoding the IL-12p35 and p40 subunit peptides was dissolved in citrate buffer at pH 4 and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0240] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0241] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and ethanol was removed from the solution using tangential flow filtration (TFF). The mixture was then concentrated until the concentration of mRNA in the system was 100 μg / ml to obtain lipid nanoparticles containing RNA encoding the IL-12 polypeptide.

[0242] (2) Prepare lipid nanoparticles encoding IL-7 polypeptides according to step (1) of this embodiment;

[0243] (3) The RNA lipid nanoparticles encoding the two polypeptides were mixed at a mass ratio of 1:1 to obtain lipid nanoparticles containing RNA encoding IL-12 polypeptide and RNA encoding IL-7 polypeptide.

[0244] Example 16

[0245] This embodiment provides a method for preparing lipid nanoparticles that simultaneously encapsulate mRNA encoding two peptides, namely, IL-12p35 and p40 subunits and IL-7 peptide. The lipid components of the lipid nanoparticles, by molar percentage, comprise 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0246] The specific preparation method is as follows:

[0247] (a) The mRNA encoding the IL-12p35 and p40 subunit peptides and the mRNA encoding the IL-7 peptide were dissolved in citrate buffer at pH 4 at a mass ratio of 1:1, and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0248] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0249] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and the ethanol component in the solution was removed by tangential flow filtration (TFF). The mixture was then concentrated to a mRNA concentration of 100 μg / mL to obtain lipid nanoparticles containing RNA encoding IL-12 and RNA encoding IL-7 peptides.

[0250] Example 17

[0251] This embodiment provides a method for preparing lipid nanoparticles that simultaneously encapsulate DNA encoding two peptides, namely IL-12p35 and p40 subunits and IL-7 peptide, with the DNA encoding each peptide integrated into two different plasmids. The lipid components of the lipid nanoparticles, by molar percentage, include 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0252] The specific preparation method is as follows:

[0253] (a) The DNA plasmids encoding the IL-12p35 and p40 subunit peptides and the DNA plasmid encoding the IL-7 peptide were dissolved in citrate buffer at pH 4 at a mass ratio of 1:1, and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0254] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0255] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and the ethanol was removed from the solution using tangential flow filtration (TFF). The mixture was then concentrated to a DNA concentration of 100 μg / mL to obtain lipid nanoparticles containing DNA plasmids encoding IL-12 and IL-7 peptides.

[0256] Example 18

[0257] This embodiment investigates the effect of different combinations of mRNAs encoding different peptides on tumor inhibition rate. Each combination contains mRNAs encoding two peptides, and the mRNA mixtures of groups G1 to G5 are prepared according to the method of Example 15.

[0258] Using the aforementioned mouse CT26 tumor model as the experimental model, six groups of experiments were conducted, with six mice in each group:

[0259] Group F1 was given a mixture of luciferase mRNA at a dose of 0.06 mpk.

[0260] Group F2 consisted of a mixture of mRNAs encoding the murine IL-12 p35 and p40 subunits (nucleotide sequences as shown in SEQ ID NO.14), administered at a dose of 0.04 mpk per animal.

[0261] Group F3 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14) and mRNA encoding the murine IL-7 (nucleotide sequence as shown in SEQ ID NO.15), and the dosage is 0.02 mpk of IL-12 per animal + 0.02 mpk of IL-7 per animal;

[0262] Group F4 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14) and mRNA encoding the murine IL-15 (nucleotide sequence as shown in SEQ ID NO.11), and the dosage is 0.02 mpk of IL-12 per animal + 0.02 mpk of IL-15 per animal;

[0263] Group F5 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14) and mRNA encoding the murine IL2 (nucleotide sequence as shown in SEQ ID NO.12), administered at a dose of 0.02 mpk IL-12 per animal + 0.02 mpk IL2 per animal.

[0264] Group F6 contains PD-1 antibody, administered at a dose of 10 mpk.

[0265] The mRNA mixture was administered weekly for 3 weeks, with all six groups of mice receiving the drug via orthotopic injection. The experimental endpoint was set at 21 days post-grouping, and the effects of the six groups on tumors were tested.

[0266] Verified by the above calculation method, at the experimental endpoint, the relative tumor inhibition rate (TGI) of PD-1 antibody (F6 group) was [data missing]. TV The relative tumor inhibition rate (TGI) of IL-12 (F2 group) was 76.22%; TV The relative tumor inhibition rate (TGI) of IL-12+IL7 (F3 group) was 32.66%; TV The relative tumor inhibition rate (TGI) of IL-12+IL15 (F4 group) was 54.38%;TV The relative tumor inhibition rate (TGI) of IL-12+IL2 (F5 group) was 49.70%; TV The tumor volume change curves of each experimental group over the number of days after injection were -3.36%. Figure 8 As shown, the tumor volume changes in each mouse in each experimental group are as follows: Figure 9 As shown.

[0267] Example 19

[0268] This example was provided to investigate whether mice with tumor regression could develop immune memory after injection of an LNP preparation containing both IL-12 and IL-7. In this example, mice with tumor regression were re-inoculated with mouse colon cancer cells CT26 (5×10^5 / 100μL / mouse) 47 days after the initial administration (0.04mpk each of IL-12 and IL-7). Tumor size was observed on days 61, 68, 71, 75, and 77 after the re-inoculation, and the results are shown in the figure.

[0269] G1 consisted of 6 mice that had never been injected with either IL-12 or IL-7; G2 consisted of 2 mice that had been injected with either mouse-derived IL-12 (nucleotide sequence as shown in SEQ ID No. 14) or mouse-derived IL-7 (nucleotide sequence as shown in SEQ ID No. 13) and whose tumors had regressed.

[0270] The results showed that: 1) In G1 mice that were not injected with either IL-12 or IL-7, the tumor volume reached 462.44 ± 86.92 mm at the end of the experiment. 3 ;

[0271] 2) In G2 mice where tumors regressed and tumor cells were re-inoculated, no tumor growth was observed until the end of the experiment.

[0272] The results above indicate that injection of both IL-12 and IL-7 can induce tumor regression. Furthermore, re-inoculation of tumor cells after tumor regression also inhibits tumor growth, demonstrating that IL-12 and IL-7 injection can create long-term immune memory in animals. The tumor volume change curves for each experimental group are shown in the figure below. Figure 10 As shown.

[0273] Example 20

[0274] This embodiment investigates the effect of different combinations of mRNA encoding mouse peptides on tumor inhibition rate. The mRNA mixtures of groups G1 to G8 were prepared according to the methods described in Example 8 or Example 15.

[0275] Nine experimental groups were conducted using the aforementioned mouse CT26 tumor model, with six mice in each group.

[0276] Group G1 was administered luciferase mRNA at a dose of 0.06 mpk.

[0277] Group G2 contains mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.14), and the dosage is 0.02 mpk per animal.

[0278] Group G3 contains mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.14), and the dosage is 0.04 mpk per animal.

[0279] Group G4 consists of a mixture of mRNAs encoding the murine IL-12 p35 and p40 subunits (nucleotide sequences as shown in SEQ ID NO.14), administered at a dose of 0.08 mpk per animal.

[0280] Group G5 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14) and mRNA encoding the murine IL-7 (nucleotide sequence as shown in SEQ ID NO.15), and the dosage is 0.02 mpk of IL-12 per animal + 0.02 mpk of IL-7 per animal;

[0281] Group G6 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14), mRNA encoding the murine IL-7 (nucleotide sequence as shown in SEQ ID NO.15), and mRNA encoding the murine IFN-α (nucleotide sequence as shown in SEQ ID NO.13), administered at a dose of 0.02 mpk per animal of IL-12 + 0.02 mpk per animal of IL-7 + 0.02 mpk per animal of IFN-α.

[0282] Group G7 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14), mRNA encoding the murine IL7 (nucleotide sequence as shown in SEQ ID NO.15), and mRNA encoding the murine IL15 (nucleotide sequence as shown in SEQ ID NO.11), administered at a dose of 0.02 mpk per animal of IL-12 + 0.02 mpk per animal of IL7 + 0.02 mpk per animal of IL15.

[0283] Group G8 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14), mRNA encoding the murine IL-7 (nucleotide sequence as shown in SEQ ID NO.15), and mRNA encoding the murine IL-2 (nucleotide sequence as shown in SEQ ID NO.12), administered at a dose of 0.02 mpk per mouse of IL-12 + 0.02 mpk per mouse of IL-7 + 0.02 mpk per mouse of IL-2.

[0284] Group G9 contains PD-1 antibody, administered at a dose of 10 mpk.

[0285] The mRNA mixture was administered weekly for 3 weeks, with all nine groups of mice receiving the drug via orthotopic injection. The experimental endpoint was set at 21 days post-grouping, and the effects of the nine groups on tumors were tested.

[0286] Verified by the above calculation method, at the experimental endpoint, the relative tumor inhibition rate (TGI) of PD-1 antibody (G9 group) was [data missing]. TV The relative tumor inhibition rate (TGI) of IL-12+IL7+IFN-α (G6 group) was 76.22%; TV The relative tumor inhibition rate (TGI) of IL-12+IL7 (G5 group), G4 group, and IL-12+IL7+IL15 (G8 group) was 72.27%. TV The relative tumor inhibition rates (TGI) of the three groups were 54.38%, 54.41%, and 56.22%, respectively; the relative tumor inhibition rates of the other groups (TGI) were... TV All were below 40%. The relative tumor inhibition rate (TGI) of each experimental group was... TV (The curve is as follows) Figure 11 As shown; the results of the tumor volume change curves of each experimental group with the number of days after injection are as follows. Figure 12 As shown in the figure. The changes in tumor volume in each mouse in each experimental group are as follows. Figure 13A and Figure 13B As shown.

[0287] Example 21

[0288] This embodiment investigates the effect of different combinations of mRNA encoding mouse peptides on tumor inhibition rate. The mRNA mixtures of groups F3 to F6 were prepared according to the method in Example 15.

[0289] Using the aforementioned mouse CT26 tumor model as the experimental model, six groups of experiments were conducted, with six mice in each group:

[0290] Group F1 was given normal saline;

[0291] Group F2 consisted of mPD1 Ab, administered at a dose of 10 mpk;

[0292] Group F3 contains mRNA encoding mouse IL7 (nucleotide sequence shown in SEQ ID NO.15), and the dosage is 1.2 mpk of IL7 per mouse.

[0293] Group F4 contains mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence shown in SEQ ID NO.14), and the dosage is 1.2 mpk per animal.

[0294] Group F5 contains mRNA encoding mouse IFN-α (nucleotide sequence shown in SEQ ID NO.13), and the dosage is 1.2 mpk per mouse.

[0295] Group F6 consists of a mixture of mRNA encoding the murine IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID NO.14), mRNA encoding the murine IL-7 (nucleotide sequence as shown in SEQ ID NO.15), and mRNA encoding the murine IFN-α (nucleotide sequence as shown in SEQ ID NO.13), administered at a dose of 1.2 mpk per animal of IL-12 + 1.2 mpk per animal of IL-7 + 1.2 mpk per animal of IFN-α.

[0296] The mRNA mixture was administered weekly for 3 weeks, with all six groups of mice receiving the drug via orthotopic injection. The experimental endpoint was set at 20 days post-grouping, and the effects of the six groups on tumors were tested.

[0297] Verified by the above calculation method, at the experimental endpoint, the relative tumor inhibition rate (TGI) of mPD1 Ab (F2 group) was [data missing]. TV The relative tumor inhibition rate (TGI) of IL7 (F3 group) was 41.49%; TV The tumor inhibition rate (TGI) of IL-12 (F4 group) was 9.32%; TV The relative tumor inhibition rate (TGI) of IFN-α (F5 group) was 95.01%; TV The relative tumor inhibition rate (TGI) of IL-12+IL7+IFN-α (F6 group) was 55.88%; TV The tumor volume rate was 94.78%. The results of the tumor volume change curves with the number of days after injection for each experimental group are as follows: Figure 14 As shown.

[0298] Example 22

[0299] This embodiment examines the effect of different dosages on tumor suppression.

[0300] Using the aforementioned mouse MDA-MB-231 tumor model as the experimental model, on day 16 after model construction (14.8 weeks after immune reconstitution), 30 humanized tumor-bearing mice were randomly divided into 7 groups of 6 mice each based on tumor volume. The day of grouping was defined as day D0, and drug administration began on day D0. The remaining mice in each group were euthanized.

[0301] Group G1 dosing regimen: a mixture of luciferase mRNA, administered at a dose of 0.06 mpk;

[0302] Group G2 dosing regimen: mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19), administered at a dose of 0.04 mpk per animal;

[0303] Group G3 dosing regimen: a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19), mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 22), and mRNA encoding human IFN-α (nucleotide sequence as shown in SEQ ID No. 26), with the weight ratio of the three RNAs in the mixture being 1:1:1, and the dosage being 0.022 mpk per animal;

[0304] Group G4 dosing regimen: a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19), mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 22), and mRNA encoding human IFN-α (nucleotide sequence as shown in SEQ ID No. 26), with the weight ratio of the three RNAs in the mixture being 1:1:1, and the dosage being 0.067 mpk per animal;

[0305] Group G5 dosing regimen: a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19), mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 22), and mRNA encoding human IFN-α (nucleotide sequence as shown in SEQ ID No. 26), with the weight ratio of the three RNAs in the mixture being 1:1:1, and the dosage being 0.2 mpk per animal;

[0306] Group G6 administration regimen: 10 mpk Tecentriq (positive control). Tumor volume changes in mice from G1 to G6 are as follows: Figure 15 As shown.

[0307] Based on statistical analysis of tumor volume data at the time of drug discontinuation, compared with the control group: G2 group IL-12 (TGITV =35.67%) significantly inhibited tumor growth (P<0.05*); the low-dose (TGI) group in G3 significantly inhibited tumor growth (P<0.05*); TV =58.50%), G4 group (TGI) TV =61.39%) and G5 group (TGI) TV =82.34%) can significantly inhibit tumor growth (P<0.05*).

[0308] This study evaluated the pharmacodynamic effects of different doses of the three-component mixture of the test substance mRNA and the positive control drug Tecentriq in a huHSC-NCG-hIL15 mouse subcutaneous loading MDA-MB-231 breast cancer tumor model. The experimental data show that, under the current testing system, low, medium, and high doses of the three-component mixture of the test substance mRNA all exhibited significant tumor-inhibiting effects compared to the control group G1.

[0309] Example 23

[0310] Experimental Methods: This example investigates the effect of mixtures of mRNAs encoding polypeptides prepared using different processes on tumor inhibition rates. The mRNA mixtures in group T1 were prepared according to the method described in Example 12; the mRNA mixtures in group T2 were prepared according to the method described in Example 16; and the mRNA mixtures in groups T3 and T4 were prepared according to the method described in Example 15.

[0311] Using the aforementioned mouse MDA-MB-231 tumor model as the experimental model, four groups of experiments were conducted, with six mice in each group.

[0312] Group 2.1 (T1) is the mRNA encoding the fusion protein of human IL-12 and humanized IL-7 (the nucleotide sequence of the open reading frame is shown in SEQ ID No. 19 and SEQ ID No. 22), and the dosage is 0.04 mpk;

[0313] Group 2.2 (T2) is a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19) and mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 22), with a dosage of 0.02 mpk of IL-12 mRNA and 0.02 mpk of IL-7 mRNA per animal;

[0314] Group 2.3 (T3) is a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19) and mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 22), administered at a dose of 0.02 mpk of IL-12 per animal + 0.02 mpk of IL-7 per animal;

[0315] Group 2.4 (T4) was administered luciferase mRNA at a dose of 0.48 mpk.

[0316] The mRNA mixture was administered weekly for 3 weeks, with all six groups of mice receiving the drug via orthotopic injection. The experimental endpoint was set at 33 days post-grouping, and the effects of the six groups on tumors were tested.

[0317] Verified by the above calculation method, at the experimental endpoint, the relative tumor inhibition rate (TGI) of the T1 group was [data missing]. TV The relative tumor inhibition rate (TGI) of the T2 group was 53.21%; TV The relative tumor inhibition rate (TGI) of the T3 group was 54.78%; TV The figure was 54.34%.

[0318] Example 24

[0319] Experimental Methods: This example investigates the effect of different combinations of mRNAs encoding different peptides on tumor inhibition rate. The mRNA mixtures in groups P2, P3, and P4 were prepared according to the method described in Example 15.

[0320] Four groups of experiments were conducted using the aforementioned mouse MDA-MB-231 tumor model, with six mice in each group.

[0321] Group P1 was given a mixture of luciferase mRNA at a dose of 0.48 mpk.

[0322] Group P2 consists of a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19) and mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 22), administered at a dose of 0.02 mpk per animal of IL-12 + 0.02 mpk per animal of IL-7.

[0323] Group P3 consists of a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19) and mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 23), administered at a dose of 0.02 mpk IL-12 per animal + 0.02 mpk IL-7 per animal.

[0324] Group P4 consists of a mixture of mRNA encoding human IL-12 p35 and p40 subunits (nucleotide sequence as shown in SEQ ID No. 19) and mRNA encoding human IL-7 (nucleotide sequence as shown in SEQ ID No. 24), administered at a dose of 0.024 mpk IL-12 per animal + 0.024 mpk IL-7 per animal.

[0325] The mRNA mixture was administered weekly for 3 weeks, with all five groups of mice receiving the drug via orthotopic injection. The experimental endpoint was set at 33 days post-grouping, to test the effects of the five groups on tumors.

[0326] Verified by the above calculation method, at the experimental endpoint, the relative tumor inhibition rate (TGI) of group P2 was [data missing]. TV The relative tumor inhibition rate (TGI) of the P3 group was 54.38%; TV The relative tumor inhibition rate (TGI) of the P4 group was 50.23%; TV The figure was 55.01%.

[0327] This invention uses any one of the three IL-7 mRNA sequences as the ORF for IL-12+IL-7 mRNA. When adjusting the drug dosage based on the expression levels of IL-7 mRNA in each sequence, it does not affect tumor regression or the relative tumor inhibition rate (TGI). TV Effects such as: The ORF for IL-12 mRNA in IL-12+IL-7 uses any one of the three sequences of IL-12 mRNA (as shown in SEQ ID No. 19-21). When adjusting the dosage based on the IL-12 expression level of each sequence, it does not affect tumor regression or the relative tumor inhibition rate (TGI). TV Effects such as )

[0328] Example 25

[0329] This embodiment provides a pharmaceutical composition comprising the following components:

[0330]

[0331] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A mixture of nucleic acid molecules, characterized in that, The nucleic acid molecule mixture consists of the following components: Nucleic acid fragment (A), wherein the nucleic acid fragment (A) encodes the IL-7 protein, the amino acid sequence of which is shown in SEQ ID NO.42; Nucleic acid fragment (B), wherein the nucleic acid fragment (B) encodes the p35 and p40 subunits of interleukin IL-12, wherein the amino acid sequence of the p35 subunit is shown in SEQ ID NO.39 and the amino acid sequence of the p40 subunit is shown in SEQ ID NO.40; And, nucleic acid molecular fragment (C), said nucleic acid molecular fragment (C) encoding IFN-α, said IFN-α having the amino acid sequence shown in SEQ ID NO.

43.

2. The nucleic acid molecule mixture according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid fragment (A) is selected from any one of SEQ ID NO.22~24 and SEQ ID NO.47~49; or, selected from any one of nucleotide sequences that are at least 70% identical to SEQ ID NO.22~24 and SEQ ID NO.47~49.

3. The nucleic acid molecule mixture according to claim 1, characterized in that, The p35 and p40 subunits of IL-12 encoded by the nucleic acid fragment (B) are linked by a linker with the amino acid sequence shown in SEQ ID NO.

41.

4. The nucleic acid molecule mixture according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid fragment (B) is selected from any one of SEQ ID NO.19~21 and SEQ ID NO.44~46; or, selected from any one of nucleotide sequences that are at least 70% identical to SEQ ID NO.19~21 and SEQ ID NO.44~46.

5. The nucleic acid molecule mixture according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid fragment (C) is selected from any one of SEQ ID NO.26~28 and SEQ ID NO.50~52, or from any one of nucleotide sequences that are at least 70% identical to SEQ ID NO.26~28 and SEQ ID NO.50~52.

6. The nucleic acid molecule mixture according to any one of claims 1 to 5, characterized in that, The nucleic acid molecules include DNA molecules and / or RNA molecules.

7. The nucleic acid molecule mixture according to claim 6, characterized in that, The DNA molecules include chain-like DNA molecules.

8. The nucleic acid molecule mixture according to claim 6, characterized in that, The RNA molecule includes mRNA.

9. The nucleic acid molecule mixture according to claim 6, characterized in that, The nucleic acid molecule fragment has a modification group at its 5' end and / or 3' end. The nucleic acid molecule fragment is an mRNA fragment. The 5' end modification group of the mRNA fragment is selected from ARCA, m7G(5'')ppp(5'')(2''OMeA)pG, m7G(5'')ppp(5'')(2''OMeG)pG, m7(3''OMeG)(5'')ppp(5'')(2''OMeG)pG, m7(3''OMeG)(5'')ppp(5'')(2''OMeA)pG, mCAP, tmCAP, or dmCAP. The 3' end protective modification group of the mRNA fragment is poly(A), and the poly(A) is 50~200 in length.

10. The nucleic acid molecule mixture according to claim 9, characterized in that, The length of the poly(A) is 80~200.

11. The nucleic acid molecule mixture according to claim 8, characterized in that, The mRNA fragment also contains a 5'UTR.

12. The nucleic acid molecule mixture according to claim 11, characterized in that, The 5'UTR is 10 to 200 nucleotides in length.

13. The nucleic acid molecule mixture according to claim 12, characterized in that, The 5'UTR is 15 to 100 nucleotides in length.

14. The nucleic acid molecule mixture according to claim 11, characterized in that, The 5'UTR includes the KOZAK sequence or the DNAH2 5'UTR.

15. The nucleic acid molecule mixture according to claim 14, characterized in that, The nucleotide sequence of the KOZAK sequence is shown in SEQ ID NO.

16.

16. The nucleic acid molecule mixture according to claim 14, characterized in that, The nucleotide sequence of DNAH2 5'UTR is shown in SEQ ID NO.

38.

17. The nucleic acid molecule mixture according to claim 8, characterized in that, The mRNA fragment also contains a 3'UTR.

18. The nucleic acid molecule mixture according to claim 17, characterized in that, The 3'UTR sequence is shown in SEQ ID.NO.1~10.

19. The nucleic acid molecule mixture according to claim 8, characterized in that, The mRNA consists of a 5' cap, 5' UTR, ORF, 3' UTR, and 3' poly(A) tail, from the 5' end to the 3' end.

20. The use of the nucleic acid molecule mixture according to any one of claims 1 to 19 in the preparation of a medicament for treating solid tumors, wherein the solid tumor is selected from colorectal tumors, melanomas, lung tumors, breast cancers, gastrointestinal tumors, or head and neck cancers.

21. A nucleic acid molecular drug for treating solid tumors, characterized in that, The nucleic acid molecular drug comprises nucleic acid molecular components and a carrier encapsulating the nucleic acid molecular components; the nucleic acid molecular components are selected from the nucleic acid molecular mixtures described in any one of claims 1 to 19.

22. The nucleic acid molecular drug according to claim 21, characterized in that, The mass ratio of each free nucleic acid fragment is 10:1 to 1:

10.

23. The nucleic acid molecular drug according to claim 21, characterized in that, The carrier comprises liposome nanoparticles.

24. The nucleic acid molecular drug according to claim 23, characterized in that, Each free nucleic acid molecule fragment in the nucleic acid molecular components is individually encapsulated by liposome nanoparticles.

25. The nucleic acid molecular drug according to claim 23, characterized in that, At least two free nucleic acid fragments were independently encapsulated by liposome nanoparticles.

26. The nucleic acid molecular drug according to claim 23, characterized in that, At least two free nucleic acid fragments were co-encapsulated by liposome nanoparticles.

27. The nucleic acid molecular drug according to claim 23, characterized in that, The liposome nanoparticles comprise, by molar percentage, 20%–50% cationic lipids, 20%–50% DOPG, 5%–20% cholesterol, and 1%–5% PEG-DMG.

28. The nucleic acid molecular drug according to claim 23, characterized in that, The liposome nanoparticles comprise, by molar percentage, 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

29. The method for preparing the nucleic acid molecular drug according to any one of claims 21 to 28, characterized in that, Each free nucleic acid molecule fragment in the nucleic acid molecule mixture is dissolved in a buffer solution to obtain an aqueous phase. Each component encapsulating the carrier is measured and dissolved in an organic solvent to obtain an organic phase. The aqueous and organic phases are mixed, and the organic phase is removed to obtain the nucleic acid molecule drug.

30. The preparation method according to claim 29, characterized in that, The volume ratio of the aqueous phase to the organic phase is 1:2~4.

31. The preparation method according to claim 30, characterized in that, The volume ratio of the aqueous phase to the organic phase is 1:

3.

32. The preparation method according to claim 29, characterized in that, The buffer solution includes citrate buffer or sodium acetate.

33. The preparation method according to claim 32, characterized in that, The buffer solution is a citrate buffer.

34. The preparation method according to claim 29, characterized in that, The pH of the buffer solution is 3 to 7.

35. The preparation method according to claim 34, characterized in that, The pH of the buffer solution is 4.

36. The preparation method according to claim 29, characterized in that, The concentration of free nucleic acid fragments in the aqueous phase is 0.05 mg / mL to 0.5 mg / mL.

37. The preparation method according to claim 36, characterized in that, The concentration of free nucleic acid fragments in the aqueous phase was 0.1 mg / mL.

38. The preparation method according to claim 29, characterized in that, The organic solvent is selected from C1 to C4 low alcohols.

39. The preparation method according to claim 38, characterized in that, The organic solvent is anhydrous ethanol.

40. The preparation method according to claim 38, characterized in that, The concentration of the lipid component in the organic phase is 5 mg / mL to 7 mg / mL.

41. The preparation method according to claim 40, characterized in that, The concentration of the lipid component in the organic phase is 6 mg / mL.

42. The preparation method according to claim 29, characterized in that, Microfluidic mixing of aqueous and organic phases was used, and organic solvents were filtered by tangential flow.

43. The preparation method according to claim 42, characterized in that, The flow rate of the microfluidic system is >3 ml / min.

44. The preparation method according to claim 43, characterized in that, The flow rate of the microfluidic system is 12 mL / min.

45. The preparation method according to claim 29, characterized in that, The mixture also includes a concentration step, which brings the final concentration of the free nucleic acid fragments to 50 μg / mL to 200 μg / mL.

46. ​​The preparation method according to claim 45, characterized in that, The concentration step brings the final concentration of the free nucleic acid fragments to 100 μg / mL.

47. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the nucleic acid molecular drug according to any one of claims 21 to 28 or the nucleic acid molecular drug prepared by any one of claims 29 to 46.

48. The pharmaceutical composition according to claim 47, characterized in that, The pharmaceutical composition further includes a protein drug selected from at least one of anti-PD-1 antibody and anti-PD-L1 antibody.

49. The pharmaceutical composition according to claim 47, characterized in that, The pharmaceutical composition also includes at least one of atezolizumab, nivolumab, patumumab, pidilizumab, and durvalumab.

Citation Information

Patent Citations

  • Method of polymerization

    IL150236A

  • GLP-1 gene delivery for the treatment of type 2 diabetes

    US7374930B2

  • Cytokine combination

    WO2018184484A1

  • Compositions containing a pathogenic antigen and an immune stimulator

    WO2021178661A1