Molecular marker for lung cancer diagnosis, chemotherapy or prognosis detection and application thereof

Abstract

This invention discloses molecular markers for lung cancer diagnosis, chemotherapy, or prognosis detection, and their applications, relating to the field of molecular diagnostics. The molecular markers include trypsin 3 splice variant 3 and the transcription factor bone marrow zinc finger gene 1 splice variant 2. By detecting the expression levels of the MZF1-V2 and PRSS3-V3 genes, lung cancer diagnosis, chemotherapy, or prognosis can be achieved. The introduction of these molecular markers has significant scientific and clinical value in personalized precision treatment applications that improve chemotherapy sensitivity. It not only provides effective molecular targets for personalized precision treatment of lung cancer patients but also provides new evidence for novel intervention strategies. Furthermore, the introduction of these molecular markers provides a more reliable means of lung cancer diagnosis and prognosis prediction.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics technology, and more specifically, to a molecular marker for lung cancer diagnosis, chemotherapy, or prognosis detection and its application. Background Technology

[0002] Lung cancer is a highly prevalent cancer worldwide, ranking first among malignant tumors in my country. In 2015, there were approximately 787,000 new cases of lung cancer in my country, accounting for 20.03% of all new malignant tumor cases, and approximately 631,000 deaths, accounting for 26.99% of all new malignant tumor cases. Among them, non-small cell lung cancer (NSCLC) is the most common histological type of lung cancer, accounting for about 85% of lung cancer patients (Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 2021, 71(3): 209-249.). Due to the insidious nature of early symptoms, easy metastasis, and lack of effective monitoring methods, most patients are diagnosed at an advanced stage, resulting in a low 5-year survival rate for lung cancer patients.

[0003] Genetic variations and epigenetic disorders leading to oncogene amplification or mutation and tumor suppressor gene silencing and loss of function play a crucial role in the development and progression of lung cancer. Compared with gene mutations, the progressive and reversible nature of epigenetic alterations in tumorigenesis is of great significance for the early detection and targeted therapy of lung cancer. Current research has clearly identified abnormal gene expression and functional disorders caused by abnormal changes in promoter region CpG island methylation and histone modifications. In particular, hypermethylation of tumor suppressor gene promoter regions has been used as an epigenetic marker and drug target in the molecular diagnosis, treatment, and prognostic assessment of diseases such as cancer (Oh JH, Jung SH, Hong SJ, and Rhyu MG, DNA Methylation as Surrogate Marker For Gastric Cancer. J Cancer Prev 20:172-178, 2015.).

[0004] Human trypsin plays an important role in various physiological and pathological processes and participates in cancer progression by regulating the specific functions of other proteins, thus becoming a novel molecular target. Several studies have focused on the link between the trypsin precursor molecule serine protease 3 (PRSS3) and tumors, and PRSS3 inhibitors have been developed to block its oncogenic effects (Hockla A, Miller E, Salameh Ma et al. PRSS3 / mesotrypsin is atherapeutic target for metastatic prostate cancer. Molecular cancer research: MCR 2012, 10(12): 1555-1566. Radisky ES. PRSS3 / mesotrypsin in prostate cancer progression: implications for translational medicine. Asian journal of andrology 2013, 15(4): 439-440.).

[0005] However, the biological function of PRSS3 in malignant tumors remains inconclusive, whether it acts as a pro-oncogene promoting tumor metastasis and recurrence or as a tumor suppressor inhibiting tumor growth. Even in the same type of tumor, such as non-small cell lung cancer, there are conflicting reports regarding PRSS3 expression and function. On the one hand, studies have shown that PRSS3 expression is increased in metastatic NSCLC cells, and increased PRSS3 expression is associated with poor patient prognosis. On the other hand, studies have shown that PRSS3 is epigenetically silenced in NSCLC and promotes cell proliferation and metastasis, thus having a potential tumor suppressor gene-like effect. This is also associated with abnormally high methylation of PRSS3 (Ma H, Hockla A, Mehner C, Coban M, Radisky ES. PRSS3 / Mesotrypsin and kallikrein-related peptidase 5 are associated with poor prognosis and contribute to tumor cell invasion and growth in lungadenocarcinoma. Scientific Reports 2019, 9(1): 1844. Marsit CJ, Chinedu O, Hadi D, Kelsey KT. Epigenetic silencing of the PRSS3 putative tumor suppressor gene in non-small cell lung cancer. Molecular Carcinogenesis 2010, 44(2): 146-150.).

[0006] These studies indicate that PRSS3 exhibits a controversial "two-way" role in tumorigenesis and development, with its expression patterns and functional phenotypes believed to be influenced by different tissue cell origins and tumor microenvironments leading to varying PRSS3 expression and signaling pathways. Due to the high sequence homogeneity of PRSS3 splice variants and the lack of specific antibodies and precise detection methods for each isoform, it is impossible to further determine the specific types of splice variants and isoforms of aberrantly expressed PRSS3 in tumors based on literature reports. This suggests that further in-depth and systematic research is needed on the expression, function, and molecular mechanisms of PRSS3 in tumorigenesis and development. Therefore, investigating the regulatory mechanism of PRSS3 genosome methylation on splice variants and identifying biomarkers relevant to the early diagnosis of lung cancer has significant scientific and clinical application value.

[0007] In view of this, the present invention is proposed. Summary of the Invention

[0008] The purpose of this invention is to provide a molecular marker for lung cancer diagnosis, chemotherapy, or prognosis detection and its application to solve the above-mentioned technical problems.

[0009] This invention is implemented as follows:

[0010] This invention provides a molecular marker for lung cancer diagnosis, chemotherapy, or prognosis detection. The molecular marker includes trypsin 3 splice variant 3 and transcription factor bone marrow zinc finger gene 1 splice variant 2. The nucleotide sequence of trypsin 3 splice variant 3 is shown in SEQ ID NO.1, and the nucleotide sequence of transcription factor bone marrow zinc finger gene 1 splice variant 2 is shown in SEQ ID NO.2.

[0011] The inventors discovered that the expression of trypsin 3 splice variant 3 (PRSS3-V3) and the transcription factor bone marrow zinc finger gene 1 splice variant 2 (MZF1-V2) was significantly reduced in lung cancer tissue cells. Multicolor immunohistochemical analysis showed that the differential expression of PRSS3 mRNA in lung cancer was caused by the abnormal expression of PRSS3-SVs; compared with adjacent normal tissues, the expression of PRSS3-V3 in tumor tissues was reduced. Knockout of the PRSS3 gene significantly slowed tumor cell proliferation, reduced colony formation, and weakened migration. Overexpression of different PRSS3 splice variants resulted in significantly different cell biological functions. Overexpression of the PRSS3-V3 gene significantly reduced tumor cell proliferation, colony formation, and the number of migrating cells, while overexpression of PRSS3-V1 or V2 significantly increased proliferation, colony formation, and migration compared to the control. In vivo tumorigenesis experiments in nude mice confirmed that PRSS3-V3 exhibits the function of a tumor suppressor gene. This indicates that the PRSS3-V3 gene can serve as a molecular marker for lung cancer diagnosis, chemotherapy, or prognostic detection.

[0012] Knockout experiments using MZF1 splice variants and chromatin immunoprecipitation assays showed that MZF1-V2 can specifically bind to the promoter region of the PRSS3-V3 gene, upregulating its expression. Therefore, detecting the expression levels of MZF1-V2 and PRSS3-V3 genes can be used for lung cancer diagnosis, chemotherapy, or prognosis.

[0013] The present invention also provides the application of a substance for detecting molecular markers in the preparation of lung cancer diagnostic drugs or prognostic test preparations.

[0014] In a preferred embodiment of the present invention, the above-mentioned substances are primers or reagents for detecting molecular markers. The detection primers or reagents are liquid solutions, lyophilized powders, or semi-solid formulations.

[0015] In one alternative embodiment, the above-mentioned substances also include buffer solutions or other aids and lyophilization protectants.

[0016] In a preferred embodiment of the present invention, the primer sequences for detecting trypsin 3 splice variant 3 are shown in SEQ ID NO. 3-4, and the primer sequences for detecting transcription factor bone marrow zinc finger gene 1 splice variant 2 are shown in SEQ ID NO. 5-6.

[0017] The reverse transcription amplification primers for PRSS3-V3 are as follows (NM_001197097.3, amplification size is 140bp, amplification product is shown in SEQ ID NO.24);

[0018] Upstream primer (SEQ ID NO.3): 5'-GTGCGCCATTGGTTTTCCAT-3';

[0019] Downstream primer (SEQ ID NO.4): 5'-GCAGAAGTGGGAGCCAGAAT-3'.

[0020] The reverse transcription amplification primers for MZF1-V2 are as follows (NM_198055.2, amplification size 339bp, amplification product as shown in SEQ ID NO.25):

[0021] Upstream primer (SEQ ID NO.5): 5'-GGGGGCATCTTCTCCCCA-3';

[0022] Downstream primer (SEQ ID NO.6): 5'-CACCTTGCCACATACATCGC-3'.

[0023] The reverse transcription amplification primers of MZF1-V2 were used to perform real-time PCR on the cDNA obtained by reverse transcription. The real-time PCR reaction conditions were as follows: 50℃ for 2 min, 95℃ for 10 min, 95℃ for 15 s; 60℃ for 1 min; 40 cycles, and fluorescence was collected; 95℃ for 15 s, 60℃ for 1 min, 95℃ for 15 s, 60℃ for 15 s.

[0024] In one alternative implementation, the reverse transcription amplification conditions for PRSS3-V3 are the same as those for MZF1-V2.

[0025] The present invention also provides the application of a substance for detecting the above-mentioned molecular markers in the preparation of a lung cancer diagnostic or prognostic test kit.

[0026] In a preferred embodiment of the present invention, the above-mentioned substances are primers or reagents for detecting molecular markers; the primer sequences for detecting trypsin 3 splice variant 3 are shown in SEQ ID NO. 3-4, and the primer sequences for detecting transcription factor bone marrow zinc finger gene 1 splice variant 2 are shown in SEQ ID NO. 5-6.

[0027] This invention also provides the application of a molecular marker as a drug target in lung cancer diagnosis, chemotherapy, and prognostic drugs: the transcription factor bone marrow zinc finger gene 1 splice variant 2 inhibits the progression of lung cancer by upregulating the expression of trypsin 3 splice variant 3.

[0028] Experimental results confirmed that PRSS3-V3 exhibits tumor suppressor gene activity, while MZF1-V2 can specifically bind to the promoter region of the PRSS3-V3 gene, upregulating its expression. This suggests that PRSS3-V3 and MZF1-V2 could serve as drug targets for lung cancer diagnosis or prognostic assessment.

[0029] In a preferred embodiment of the present invention, the lung cancer is non-small cell lung cancer, and the upregulated expression is the upregulation of trypsin 3 splice variant 3 expression in non-small cell lung cancer cell lines and tissues.

[0030] In a preferred embodiment of the present invention, the expression of trypsin 3 splice variant 3 and the transcription factor bone marrow zinc finger gene 1 splice variant 2 in lung cancer cells, relative to normal cells, both exhibit a gradually decreasing pattern (PRSS3-V3). Low / MZF1-V2 Low .

[0031] It should be noted that the aforementioned decrease in expression includes, but is not limited to, a slight or significant decrease in the expression levels of PRSS3-V3 and MZF1-V2 in lung cancer cells compared to normal cells. The percentage decrease in the expression levels of PRSS3-V3 and MZF1-V2 may be the same or different.

[0032] It has been verified that the transcription factor bone marrow zinc finger gene 1 splice variant 2 exerts its anti-cancer effect by upregulating the expression of trypsin 3 splice variant 3.

[0033] The present invention has the following beneficial effects:

[0034] This invention provides molecular markers for lung cancer diagnosis, chemotherapy, or prognosis. By detecting the expression levels of the MZF1-V2 and PRSS3-V3 genes, lung cancer diagnosis, chemotherapy, or prognosis can be achieved. The introduction of these molecular markers has significant scientific and clinical value in personalized precision treatment applications that improve chemotherapy sensitivity. They not only provide effective molecular targets for personalized precision treatment of lung cancer patients but also offer new evidence for novel intervention strategies. Furthermore, the molecular markers provide more reliable means for lung cancer diagnosis and prognosis prediction. Attached Figure Description

[0035] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0036] Figure 1 Figure showing the expression results of PRSS3 and its splicing variants in non-small cell lung cancer cell lines and tissues;

[0037] Figure 2 Figure showing the effects of knockout or overexpression of PRSS3 and its splicing variants on the function of non-small cell lung cancer cells.

[0038] Figure 3 Figure showing the experimental verification results of MZF1 promoting the activation of the PRSS3-V3 promoter region. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0040] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0041] Example 1

[0042] This embodiment detects the expression level of the PRSS3-V3 gene in lung cancer cells. Specifically, qPCR was used to detect the expression level.

[0043] I. Experimental Materials

[0044] Non-small cell lung cancer cells used in the test: A549, 801-D, NCI-H1299, NCI-H460.

[0045] All the cells mentioned above were purchased from the National Biomedical Experimental Cell Resource Bank and cultured and passaged under normal conditions in the applicant's laboratory.

[0046] Paraffin-embedded tissues used for testing (clinical tissue specimens of lung adenocarcinoma and corresponding paired adjacent normal tissues): 180 tissues, including 86 pairs of paired tissues and 8 individual tumor tissues, purchased from Shanghai Xinchao Biotechnology Co., Ltd., catalog number: HLugA180Su06.

[0047] II. Experimental Methods

[0048] 1. Cell RNA extraction and reverse transcription process

[0049] (1) Cell RNA extraction procedure: Select cells in good growth condition and add Trizol reagent (Invitrogen, USA, catalog number: 15596026) at a rate of 1 mL / 10⁶ cells. Tissue RNA extraction procedure: Remove frozen tissue from liquid nitrogen tank, cut approximately 200 mg, and grind the tissue sample in a cold mortar. Add 1 mL of Trizol reagent for every 100 mg of tissue sample.

[0050] (2) After 10 min at room temperature, the mixture was fully lysed and extracted with chloroform. 0.2 mL of chloroform was added to each 1 mL of Trizol. The mixture was shaken vigorously for 15 s, left to stand at room temperature for 5 min, and then centrifuged at 12000 g and 4 °C for 15 min.

[0051] (3) Transfer the colorless upper layer of the separated liquid to a new centrifuge tube, precipitate it with pre-cooled isopropanol (add 0.5 mL of isopropanol per 1 mL of Trizol), and place on ice for 20 min. Centrifuge at 12000 g, 4 °C for 10 min, and discard the supernatant.

[0052] (4) Wash the precipitate with pre-cooled 75% ethanol, add 1 mL of 75% ethanol to 1 mL of Trizol, centrifuge at 7500 g, 4 °C for 5 min, and discard the supernatant. After drying, dissolve in an appropriate amount of DEPC-H2O, confirm by 0.8% agarose gel electrophoresis, determine the RNA concentration by NanoDrop, and store at -80 °C.

[0053] (5) Take 1.0 μg of RNA and reverse transcribe it into cDNA. Use the TransScript II First-Strand cDNA Synthesis SuperMix kit (catalog number: AH301-02) produced by Beijing TransGen Biotech Co., Ltd.: Add 1 μL of Anchored Oligo(dT)20, 10 μL of 2×TS Reaction Mix and 1 μL of RT / RI Enzyme Mix to DEPC-H2O to a final volume of 20 μL. Reaction conditions: 42℃ for 30 min, 85℃ for 5 min. The cDNA obtained by reverse transcription is stored at -20℃.

[0054] 2. qPCR detection

[0055] (1) qPCR primer design reference Figure 1 As shown in A, the sequence is as follows:

[0056] Primer pair 1: PRSS3 mRNA common region primer (101 bp in size), a universal primer for PRSS3 designed based on the same exon sequence of the four splice variants of PRSS3.

[0057] Upstream primer (SEQ ID NO.7): 5'-ATTCTGGCTCCCACTTCTGC-3';

[0058] Downstream primer (SEQ ID NO.8): 5'-CTCTCCCAGTCTCACCTGGA-3'.

[0059] Primer pair 2: PRSS3-V1 mRNA primers (NM_007343.4, size 124bp)

[0060] Upstream primer (SEQ ID NO.9): 5'-CTGCGAGGCGCTGGG-3';

[0061] Downstream primer (SEQ ID NO.4): 5'-GCAGAAGTGGGAGCCAGAAT-3'.

[0062] Primer pair 3: PRSS3-V2 mRNA primers (NM_002771.4, size 129bp)

[0063] Upstream primer (SEQ ID NO.10): 5'-ATCCTTGCCTTTGTGGGAGC-3';

[0064] Downstream primer (SEQ ID NO.4): 5'-GCAGAAGTGGGAGCCAGAAT-3'.

[0065] Primer pair 4: PRSS3-V3 mRNA primers (NM_001197097.3, size 140bp)

[0066] Upstream primer (SEQ ID NO.3): 5'-GTGCGCCATTGGTTTTCCAT-3';

[0067] Downstream primer (SEQ ID NO.4): 5'-GCAGAAGTGGGAGCCAGAAT-3'.

[0068] Primer pair 5: PRSS3-V4 mRNA primers (NM_001197098.1, size 131bp)

[0069] Upstream primer (SEQ ID NO.11): 5'-CGACTCGCATGGGACCTG-3';

[0070] Downstream primer (SEQ ID NO.4):

[0071] 5'-GCAGAAGTGGGAGCCAGAAT-3'.

[0072] The internal reference primer used for homogenization is a primer with Beta-Aactin as the internal reference, and the upstream primer (SEQ ID NO.12) is as follows:

[0073] 5'-TTAGTTGCGTTACACCCTTTC-3';

[0074] Downstream primer (SEQ ID NO.13): 5'-ACCTTCACCGTTCCAGTTT-3'.

[0075] (2) The reaction system used for qPCR amplification is shown in Table 1.

[0076] Table 1. Reaction system for qPCR amplification.

[0077]

[0078] Note: 2×SYBR-Green: Zymo Research, USA, product number E2004.

[0079] (3) The PCR reaction conditions are as follows:

[0080] The fluorescence was collected after 40 cycles of 50℃ for 2 min, 95℃ for 10 min, 95℃ for 15 s, and 60℃ for 1 min. A melting curve was then constructed using the same cycle. The experimental results were analyzed using 2... -ΔΔCtThe analytical data and melting curves ensure the specificity of the product.

[0081] 3. Western blotting analysis

[0082] (1) Sample preparation

[0083] The lung squamous cell carcinoma cells were seeded into 10cm diameter culture dishes. When the cells grew to about 60-80%, 3-5 culture dishes were collected from each group.

[0084] (2) Collect and wash the samples

[0085] Wash cells 1-2 times with room temperature PBS, then treat with 1% formalin at 37°C for 10 min. Wash cells twice with ice-cold PBS, then transfer cells to 1 ml of ice-cold PBS using a cell scraper, centrifuge at 3,000 rpm for 2 min at 4°C, and discard the supernatant. Resuspend the cell pellet in 400 μl of lysis buffer and incubate on ice for 10 min.

[0086] (3) Western blotting

[0087] After quantification, calculate the sample loading volume at 30 μg / well and add the sample to 5×SDS gel loading buffer (Genstar, China, catalog number: E153-05). Heat at 100℃ for 10 min, add the sample sequentially, and perform SDS-PAGE electrophoresis at 120V. After electrophoresis, transfer the sample to a wet electrophoresis apparatus for membrane transfer. After transfer, remove the PVDF membrane (Millipore, USA, catalog number: IPVH00010). After blocking with 5% skim milk for 1 hour, the cells were incubated with primary antibodies: PRSS3 antibody (Thermo Fisher Scientific, USA, catalog number: PA5114077), PRSS3-V1 antibody (Wuhan Daian Biotechnology Co., Ltd., antigen immunization: RPGRVERGGAQRGGAG), PRSS3-V2 antibody (Wuhan Daian Biotechnology Co., Ltd., antigen immunization: NP_002762.2), PRSS3-V3 antibody (Wuhan Daian Biotechnology Co., Ltd., antigen immunization: TLKKGRSAPLVFHPPDA), and PRSS3-V4 antibody (Wuhan Daian Biotechnology Co., Ltd., immune fragment: GPAGEVAVP) at 4°C overnight. Secondary antibody labeled with anti-rabbit horseradish peroxidase (Abcam, UK, catalog number: ab6721) was added and incubated for 1 hour. A colorimetric reaction was then performed using an ECL chemiluminescence kit (Themo Fisher Scientific, USA, catalog number: 32132), and development was performed using a Smart Gel Image Analysis System.

[0088] 4. Multicolor immunohistochemical analysis

[0089] Multicolor immunohistochemical analysis of tissue arrays was performed using the Opal 7-color fluorescence immunohistochemistry kit (Akoya Biosciences, USA, catalog number: NEL797001KT). 4μm tissue sections were baked at 70°C for 1 hour. Dewaxing was performed twice with xylene, every 20 minutes. The sections were then hydrated sequentially with gradient ethanol solutions (100%, 95%, 80%) for 5 minutes each. The tissue sections were then placed in citric acid retrieval solution and subjected to high-temperature autoclaving. After cooling to room temperature, they were washed three times with 1×PBS for 5 minutes each time. Incubation with 3% hydrogen peroxide solution at room temperature for 15 minutes was performed, followed by rinsing with double-distilled water and washing three times with 1×PBS for 5 minutes each time. Blocking with 5% skim milk powder for 1 hour was completed, the milk was discarded, and the sections were washed three times with 1×PBS for 5 minutes each time. Primary antibodies were incubated overnight at 4°C. The following antibodies were used: CK antibody (Suzhou Baidao Medical Technology Co., Ltd., catalog number: PA125), PRSS3 antibody (Thermo Fisher Scientific, USA, catalog number: PA5114077), PRSS3-V1 antibody (Wuhan Daian Biotechnology Co., Ltd., antigen immunization: RPGRVERGGAQRGGAG), PRSS3-V2 antibody (Wuhan Daian Biotechnology Co., Ltd., antigen immunization: NP_002762.2), PRSS3-V3 antibody (Wuhan Daian Biotechnology Co., Ltd., antigen immunization: TLKKGRSAPLVFHPPDA), and PRSS3-V4 antibody (Wuhan Daian Biotechnology Co., Ltd., immune fragment: GPAGEVAVP). The next day, the incubation was carried out at room temperature for half an hour, followed by washing three times with 1×PBS for 5 minutes each time. Secondary antibodies were then added, and the incubation was continued at room temperature for 30 minutes, followed by washing three times with 1×PBS for 5 minutes each time. Multicolor fluorescence images were acquired using the TissueFAXS Spectra S system (tissuegnostic, USA), and protein expression was quantitatively analyzed using an automated quantitative analysis system (tissuegnostic, USA, software version: StrataQuest 7.0.1.165).

[0090] III. Results and Analysis

[0091] The results show:

[0092] We examined the expression level of PRSS3 in four NSCLC cell lines (A549, 801-D, NCI-H1299, and NCI-H460). The results showed that in PRSS3High and PRSS3Low lung cancer cells, V1 and V2 were the two major splicing variants that promoted PRSS3 expression. Figure 1 (As shown in AC in the figure). Further evidence confirmed high expression of PRSS3-V1 / V2, low expression of PRSS3-V3, and no expression of PRSS3-V4 in tumor tissue. Figure 1D) The results showed that the differential expression of PRSS3 mRNA in lung cancer was caused by the abnormal expression of PRSS3-SVs. Figure 1 Figures B and C in the diagram represent the RT-qPCR expression analysis of PRSS3 and splice variants in NSCLC cells, respectively. Figure 1 Figure D shows the results of RT-qPCR detection of PRSS3 and splice variant mRNA expression levels in NSCLC tumor tissues and their paired normal control tissues (n=13). In this embodiment, antibodies against the PRSS3 common region were used to analyze PRSS3, and protein isoform-specific antibodies were used to analyze PRSS3 V1-V4 splice variants.

[0093] To assess the expression of PRSS3 protein isoforms, Western blotting was performed using an antibody targeting the conserved region of PRSS3. Multiple bands were detected in lysed samples of A549 and 801-D cells, and PRSS3 expression was also detected in the collected cell culture supernatant. Figure 1 E). Further, we used antibodies targeting various PRSS3 isoforms for detection, finding PRSS3-V1 to V3 protein isoforms in A549 cells. PRSS3-V2 was present in both cell lysates and supernatants, while in 801-D cells, PRSS3-V1 and V2 were only detected in cell lysates. Figure 1 F). Immunofluorescence was performed using antibodies against various PRSS3 protein isoforms. The results showed that PRSS3-V1 was localized in the cytoplasm, PRSS3-V2 could be secreted extracellularly, PRSS3-V3 was expressed in both the cytoplasm and nucleus, and PRSS3-V4 was localized in the cytoplasm (F). Figure 1 G).

[0094] Figure 1 E and F in the middle section represent the Western Blot expression analysis of PRSS3 (E) and splice variant (F) in NSCLC cell lysate and culture supernatant, respectively; Figure 1 The figure in G shows the results of immunofluorescence detection of the expression and localization of the PRSS3 splice variant in A549 cells.

[0095] We performed multiplex immunohistochemical assays using antibodies targeting various PRSS3 protein isoforms and cytokeratin (CK). In 180 tissue samples, PRSS3-V1, V2, and V4 were located in CK-positive (CK+) tissue regions, while PRSS3-V3 was located in CK-negative (CK-) tissue regions. Figure 1(H). Quantitative fluorescence analysis showed that compared with adjacent normal tissue, PRSS3-V1 / V2 expression was increased and PRSS3-V3 expression was decreased in tumor tissue. Furthermore, PRSS3-V1 / V2 expression was increased in the CK+ region, while PRSS3-V3 expression was increased in the CK- region. Figure 1 I). Figure 1 Figures H and I show the expression levels of PRSS3 protein isoforms in 86 paired tumor and adjacent normal tissues and 8 tumor tissues detected by multiplex immunohistochemistry (mIHC), respectively (H). Quantitative fluorescence analysis of PRSS3 protein isoforms in tumor and normal tissues was performed (upper half of Figure I). Quantitative fluorescence analysis of PRSS3 splice variants in tumor tissues (CK+) and tumor stroma (CK-) was performed (lower half of Figure I). *p<0.05, **p<0.01.

[0096] These results indicate that the various splicing variants of PRSS3 exhibit differential expression at both the mRNA and protein levels. Among them, PRSS3-V3 is specifically highly expressed in the tumor stroma (CK-) and adjacent normal tissues. This differential expression also suggests the functional differences between PRSS3-V3 and other splicing variants.

[0097] Example 2

[0098] This embodiment examines the biological function of PRSS3 splicing variants in lung cancer cells.

[0099] I. Experimental Materials

[0100] Non-small cell lung cancer cells used in the test: A549, 801-D, NCI-H1299, NCI-H460.

[0101] All the cells mentioned above were purchased from the National Biomedical Experimental Cell Resource Bank and cultured and passaged under normal conditions in the applicant's laboratory.

[0102] II. Experimental Methods

[0103] 1. Knockout of PRSS3 gene expression in A549 cells and overexpression in NCI-H460 and NCI-H1299 cells

[0104] The CRISPR / CAS9 dual-vector lentivirus system was developed by Shanghai Jikai Gene.

[0105] PRSS3 knockout sequence (sgRNA)

[0106] 5'-GGCACTGAGTGCCTCATCTC-3';

[0107] The universal empty vector plasmid was purchased from GeneCopoeia, Inc., USA, catalog number: EX-NEG-M35.

[0108] The PRSS3-V1 plasmid, NM_007343.3, was synthesized by Shanghai Jikai Gene.

[0109] PRSS3-V2 plasmid, purchased from GeneCopoeia, catalog number: EX-F0190-M35

[0110] PRSS3-V3 plasmid, purchased from GeneCopoeia, catalog number: EX-A3595-M35

[0111] PRSS3-V4 plasmid, purchased from GeneCopoeia, catalog number: EX-Z9306-M35

[0112] The non-small cell lung cancer cell line A549 was selected for stable lentiviral infection. Target cells in the logarithmic growth phase were trypsinized to prepare a cell suspension. The cell suspension (approximately 5 × 10⁶ cells) was then... 4 Cells were seeded in 6-well plates and incubated at 37°C with 5% CO2 until cell confluence reached approximately 30%. Based on the cell MOI, an appropriate amount of virus was added. The culture medium was changed after 24 hours of further incubation. Three days after infection, a suitable concentration of Puromycin (ApexBio Technology, catalog number A3740) was added for selection for 3 days. Afterward, low concentrations of Puromycin were maintained for continued incubation, and cells were repeatedly infected with sgRNA lentivirus. Cells successfully infected with sgRNA were sorted by fluorescence and detected by RT-qPCR.

[0113] Non-small cell lung cancer cell lines A549 and BEAS-2B were selected for stable transfection. Cells were seeded in 6-well cell culture plates. When the cells reached 60% confluence, 200 μL of DMEM was added to both the 20 nM expression plasmid and the empty vector plasmid, respectively. After mixing, the mixture was incubated at room temperature for 5 min. Then, 200 μL of DMEM was added to 6 μL of Lipofectamine 2000, respectively. After mixing, the mixture was incubated at room temperature for 5 min. 200 mL of Lipofectamine 2000 (Thermo Fisher Scientific, catalog number: 11668019) dilution was added to 200 μL of the expression plasmid, and the mixture was incubated at room temperature for 20 min. 400 μL of the mixture was added to the cell culture plates and cultured at 37°C for 8 h without serum. After incubation, the mixture was replaced with 10% FBS DMEM and incubated at 37°C for 24 h. Detection was then performed by RT-qPCR.

[0114] 2. Cell biological functional experiments

[0115] (1) MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide) experiment: Cell lines in the logarithmic growth phase and with good growth were digested and counted. Cell suspensions containing empty vectors, knockout A549 cells, and cells overexpressing PRSS3 gene in NCI-H460 and NCI-H1299 were constructed in step one. The concentration of cell suspension was adjusted, and 100 μL was added to each well in a 96-well cell culture plate. 2000 cells were seeded in each well and 8 replicates were set up. The cells were observed for 4 consecutive days. 10 μL of MTT (Sigma-Aldrich, USA, catalog number: M2128) was added to each well every day to make the final concentration 5 μg / mL. After 4 h of co-culture, the culture medium was discarded. Four days later, 150 μL of dimethyl sulfoxide (DMSO, Sigma-Aldrich, USA, catalog number: D2650) was added to each well. After shaking gently in the dark for 10 minutes, the absorbance of each well was measured at OD 490 nm using an ELISA reader, and the obtained data were analyzed.

[0116] (2) Cell clone formation experiment

[0117] Cell lines in logarithmic growth phase containing empty vectors, A549 knockout cells, and cells overexpressing the PRSS3 gene in NCI-H460 and NCI-H1299 were digested, counted, and seeded into 6-well cell culture plates at 100 cells per well. The culture medium was changed every three days. Once the cell clones reached a visible size, the culture medium was aspirated, and the cells were washed twice with 1×PBS. The cells were fixed with 4% paraformaldehyde for 30 min, washed twice with 1×PBS, stained with 0.5% crystal violet for 30 min, rinsed, air-dried, photographed, and the number of clones was counted.

[0118] (3) Transfer Experiment

[0119] In step one, the cell lines containing empty vectors, A549 cells with knockout, and cells overexpressing the PRSS3 gene in NCI-H460 and NCI-H1299 were digested and counted. The cells were then added to the upper chamber of an 8.0 μm pore size Transwell chamber (Corning, Inc., catalog number: CLS3422). 200 μL of serum-free cell suspension was added to each upper chamber, with 2 × 10⁴ cells per well. 600 μL of complete culture medium was added to the lower chamber. Cells were cultured at 37°C for 24 h, then carefully washed several times with 1×PBS. The cells were fixed with 4% paraformaldehyde for 30 min, washed three times with 1×PBS, stained with 0.5% crystal violet for 30 min, and rinsed until the wash buffer was colorless. The cells in the upper chamber were carefully removed with a cotton swab, and the number of migrating cells was counted under a microscope (100×).

[0120] 3. Tumor formation experiment in nude mice

[0121] Stable transfection of NCI-H460 cells with PRSS3 splice variants or empty vector was performed, and the cells were counted. Cells were centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the cells were washed three times with PBS and stored on ice for later use. Four SPF-grade 4-week-old female Balb / c nude mice were selected each time, and cells (cell concentration 1×10⁻⁶) were subcutaneously injected into the rump of the mice. 6 / 0.1mL), bilaterally inoculated. Nude mice were observed every 4 days, and the tumor volume was measured and recorded.

[0122] 4. Statistical Analysis

[0123] All experiments were repeated at least three times. Results were presented using two-tailed t-tests and are expressed as mean ± standard deviation. *p<0.05 indicates a statistically significant difference, and **p<0.01 indicates an extremely statistically significant difference.

[0124] III. Results and Analysis

[0125] The results showed that we established a functional screening model to clarify the molecular basis of the role of PRSS3 splicing variants in NSCLC. The PRSS3 gene was knocked out in A549 cells with high PRSS3 expression using CRISPR / Cas9 technology. Figure 2 A) MTT assay, colony formation assay, and Transwell assay results showed that, compared with control cells transfected with the empty vector, knockout of the PRSS3 gene significantly slowed the proliferation of A549 cells (p<0.01), significantly reduced colony formation (p<0.01), and significantly weakened migration ability (p<0.01). We further stably transfected plasmids overexpressing PRSS3-V1–V4 into NCI-H460 and NCI-H1299 cells with low PRSS3 expression, respectively. Figure 2 B). In NCI-H460 and NCI-H1299 cells that exogenously overexpressed PRSS3 splice variants, cell biological functions showed significant differences: cell overexpression of PRSS3-V1 or V2 significantly increased proliferation, colony formation, and migration compared to the control (p<0.01); while tumor cells overexpressing PRSS3-V3 significantly decreased proliferation, colony formation, and migration (p<0.01); and tumor cells overexpressing PRSS3-V4 had no significant effect on proliferation, colony formation, and migration.

[0126] Figure 2Figure A shows the knockout of the PRSS3 gene in the A549 lung cancer cell line, which highly expresses PRSS3, using CRISPR / Cas9 dual-vector lentiviral infection. The effects of PRSS3 knockout on cell proliferation and invasion in A549 cells were detected by MTT assay, colony formation assay, and Transwell assay. Quantitative data are shown in the upper half of Figure A, and representative images are shown in the lower half of Figure A. Figure B shows the effects of PRSS3 knockout on cell proliferation and invasion in the NCI-H460 and NCI-H1299 lung cancer cell lines that express low PRSS3 splice variants, respectively. Quantitative data are shown in the upper half of Figure B, and representative images are shown in the lower half of Figure B.

[0127] We compared the tumorigenicity of NCI-H460 cells after overexpression of the PRSS3 splice variant using in vivo nude mouse tumorigenesis experiments. The tumor growth curves in nude mice showed that, compared to the control group, overexpression of PRSS3-V1 or V2 significantly increased tumor volume (p<0.01), while overexpression of PRSS3-V3 significantly decreased tumor volume (p<0.01). Overexpression of PRSS3-V4 had no significant effect on tumor bearing in nude mice. Figure 2 C). Sixteen days after cell seeding, when growth was terminated, tumor weight measurements showed that, compared to no effect from PRSS3-V4 overexpression, tumor cells overexpressing PRSS3-V1 or V2 had significantly increased tumor weight, while those overexpressing PRSS3-V3 had significantly decreased tumor weight. These results preliminarily indicate that different PRSS3 splice variants have different cellular biological functions in lung cancer cells, with PRSS3-V1 or V2 promoting tumor growth, while PRSS3-V3 exhibits a tumor suppressor gene-like function.

[0128] Figure 2 The middle section (C) shows the tumorigenicity of NCI-H460 cells overexpressing the PRSS3 splice variant in nude mice. NCI-H460 cells (1 × 10⁻⁶) were subcutaneously injected into nude mice. 6 The mice were divided into a control group transfected with an empty vector and a group transfected with the PRSS3 splice variant. Left panel: Tumor growth curves in nude mice; tumor volume was measured four days after cell inoculation and every four days. Middle panel: Tumor detachment in nude mice. Right panel: Comparison of detached tumor weight.

[0129] Example 3

[0130] This embodiment verifies that the transcription factor MZF1 binds to the PRSS3 gene body region and upregulates the expression of PRSS3-V3.

[0131] I. Experimental Materials

[0132] The tested non-small cell lung cancer cells were A549 and NCI-H460.

[0133] All the cells mentioned above were purchased from the National Biomedical Experimental Cell Resource Bank and cultured and passaged under normal conditions in the applicant's laboratory.

[0134] II. Experimental Methods

[0135] 1. Knockout of MZF1 gene expression in A549 cells and subsequent overexpression of various MZF1 splicing variants.

[0136] The CRISPR / CAS9 dual-vector lentivirus system was developed by Shanghai Jikai Gene.

[0137] MZF1 knockout sequence (sgRNA)

[0138] 5'-AGGGCTCCATCTTCTCTGAT-3';

[0139] The universal empty vector plasmid was purchased from GeneCopoeia, Inc., USA, catalog number: EX-NEG-M02.

[0140] The MZF1-V2 plasmid was purchased from GeneCopoeia, catalog number: EX-T3148-M02-5.

[0141] The MZF1-V3 plasmid, NM_001267033.2, was synthesized by Shanghai Jikai Gene.

[0142] The non-small cell lung cancer cell line A549 was selected for stable lentiviral infection. Target cells in logarithmic growth phase were trypsinized to prepare a cell suspension. The cell suspension (approximately 5 × 10⁴ cells) was seeded into 6-well plates and incubated at 37°C in a 5% CO₂ incubator until cell confluence reached approximately 30%. Based on the cell MOI value, an appropriate amount of virus was added. The culture medium was changed after 24 hours of further incubation. Three days after infection, a suitable concentration of Puromycin (ApexBio Technology, catalog number A3740) was added for selection for 3 days. Afterward, the cells were cultured at a low concentration of Puromycin and continued to be infected with sgRNA lentivirus. Cells successfully infected with sgRNA were sorted by fluorescence and detected by RT-qPCR.

[0143] The A549 non-small cell lung cancer cell line with the MZF1 gene knocked out was selected for stable transfection. Cells were seeded in 6-well cell culture plates. When the cells reached 60% confluence, 200 μL of DMEM was added to both the 20 nM expression plasmid and the empty vector plasmid, mixed, and incubated at room temperature for 5 min. Then, 200 μL of DMEM was added to 6 μL of Lipofectamine 2000, mixed, and incubated at room temperature for 5 min. 200 mL of Lipofectamine 2000 dilution (Thermo Fisher Scientific, catalog number: 11668019) was added to 200 μL of the expression plasmid, mixed, and incubated at room temperature for 20 min. 400 μL of the mixture was added to the cell culture plates and cultured at 37°C for 8 h in serum-free conditions. The culture was then replaced with 10% FBS DMEM and incubated at 37°C for 24 h. Detection was performed by RT-qPCR and immunofluorescence.

[0144] qPCR detection

[0145] (1) The qPCR primer sequences are as follows:

[0146] The PRSS3 primers are shown in primer pairs 1-5 in Example 1.

[0147] Primer pair 6: MZF1 mRNA common region primer (162bp in size)

[0148] Upstream primer (SEQ ID NO.14): 5'-ATGCAGGAATCACCACTGGG-3';

[0149] Downstream primer (SEQ ID NO.15): 5'-AAAGATCTGGTCCAGCACGG-3'.

[0150] Primer pair 7: MZF1-V2 mRNA primers (NM_198055.2, size 339bp)

[0151] Upstream primer (SEQ ID NO.5): 5'-GGGGGCATCTTCTCCCCA-3';

[0152] Downstream primer (SEQ ID NO.6): 5'-CACCTTGCCACATACATCGC-3'.

[0153] Primer pair 8: MZF1-V3 mRNA primers (NM_001267033.2, size 116bp)

[0154] Upstream primer (SEQ ID NO.16): 5'-CCGTGCTGGACCAGATCTTT-3';

[0155] Downstream primer (SEQ ID NO.17): 5'-GGCCCCTGGGGAGAAGA-3'.

[0156] The internal reference primer used for homogenization is a primer with Beta-Aactin as the internal reference.

[0157] Upstream primer (SEQ ID NO.18):

[0158] 5'-TTAGTTGCGTTACACCCTTTC-3';

[0159] Downstream primer (SEQ ID NO.19): 5'-ACCTTCACCGTTCCAGTTT-3'.

[0160] (2) The reaction system used for qPCR amplification is shown in Table 2.

[0161] Table 2. Reaction system for qPCR amplification

[0162]

[0163] Note: 2×SYBR-Green: Zymo Research, USA, product number E2004.

[0164] (3) The PCR reaction conditions are as follows:

[0165] The fluorescence was collected after 40 cycles of 50℃ for 2 min, 95℃ for 10 min, 95℃ for 15 s, and 60℃ for 1 min. A melting curve was then constructed using the same cycle. The experimental results were analyzed using 2... -ΔΔCt The analytical data and melting curves ensure the specificity of the product.

[0166] Immunofluorescence staining detection:

[0167] The cells in each of the above groups were then subjected to immunofluorescence staining. The specific steps are as follows:

[0168] Cells in good growth condition were dropped onto coverslips and cultured in 6-well cell culture plates for 24 hours. After washing with 1×PBS, the cells were fixed with 4% paraformaldehyde for 10 minutes. After washing three times with 1×PBS, 0.5% Triton X-100 was added and the cells were incubated at room temperature for 5 minutes. After washing three times with 1×PBS for 5 minutes each time, an appropriate volume of 5% BSA was added for blocking at room temperature for 1 hour. Primary antibody: Anti-MZF1 (Nanjing Baode Biotechnology Co., Ltd., catalog number: BS5810, dilution ratio: 1:100) was incubated overnight at 4°C. After washing three times with 1×PBS for 5 minutes each time, secondary antibody: goat anti-rabbit IgG-FITC (Proteintech, China, catalog number: SA00013-4, dilution ratio: 1:100) was added and incubated at room temperature for 1 hour. After washing three times with 1×PBS for 5 minutes each time, DAPI (Sigma-Arich, USA, catalog number: D9542) was stained for 2 minutes, followed by washing three times with 1×PBS for 5 minutes each time. After washing with ddH2O for 2 min, the slides were mounted with 90% glycerol and the localization of protein molecules in cells was observed using a Vectra 3 flow cytometer (PerkinElmer, USA).

[0169] 2. MZF1 promotes the activation of the PRSS3-V3 promoter region.

[0170] (1) Construction of dual-fluorescent reporter gene expression vector:

[0171] The dual-fluorescent reporter gene vector used was pGL-3-basic (Promega, USA, catalog number: E1751), and pRL-TK (Promega, USA, catalog number: E2241) was used as a negative control. Kpn I and Xho I were selected as the 5' and 3' restriction enzyme sites, respectively. The MZF1 binding site in the PRSS3-V1 / V3 gene promoter region was predicted using JASPAR.

[0172] Binding site 1: GGAGGGGATA;

[0173] Binding site 2: CTAGGGGAGG;

[0174] Binding site 3: TCCCACCGCC;

[0175] Binding site 4: TGAGGGGAAG.

[0176] Insert fragments with binding sites were obtained through chemical synthesis:

[0177] pGL3-FA (SEQ ID NO.20)

[0178] GGGGTACCCCGGGGGAGGGTACGCGGACAGGGAGGGGATACCGACTGGGAGGGGCTCAGGGACAGGGATGGAGGCTCCTCTAGGGGAGGACGGGAGGGGATGGAGGGCCCTGGTGTCGCAGAAGCCCACCTGGGGCCCCCTCCGGGCTGCGGCACCGATGCGCACACTACTCCCACCGCCCCCGAGTGCCTATGTCCGGCTGGCCGCGGCCCTGGAATGAATATTGCTCAGTCCCCCGCGAGTCAGGTCTGCCGCGTTGCAGGGTGAGGGGAAGCCGCTCGAGCGG。

[0179] pGL3-FB(SEQ ID NO.21)

[0180] GGGGTACCCCCTAGGGGAGGACGGGAGGGGATGGAGGGCCCTGGTGTCGCAGAAGCCCACCTGGGGCCCCCTCCGGGCTGCGGCACCGATGCGCACACTACTCCCACCGCCCCCGAGTGCCTATGTCCGGCTGGCCGCGGCCCTGGAATGAATATTGCTCAGTCCCCCGCGAGTCAGGTCTGCCGCGTTGCAGGGTGAGGGGAAGCCGCTCGAGCGG。

[0181] pGL3-FC(SEQ ID NO.22)

[0182] GGGGTACCCCTCCCACCGCCCCCGAGTGCCTATGTCCGGCTGGCCGCGGCCCTGGAATGAATATTGCTCAGTCCCCCGCGAGTCAGGTCTGCCGCGTTGCAGGGTGAGGGGAAGCCGCTCGAGCGG。

[0183] pGL3-FD(SEQ ID NO.23)

[0184] GGGGTACCCCTGAGGGGAAG CCGCTCGAGCGG。

[0185] The binding site sequence was inserted into the reporter gene. We double-digested the target fragment and the cloning vector using Kpn I (NEB, UK, catalog number: R0142L) and Xho I (NEB, UK, catalog number: R0146L), respectively. Following the instructions of the agarose gel DNA recovery kit (TransGen Biotech, Beijing, catalog number: EG101-02), the DNA was recovered from the gel. The target fragment and the vector were ligated to obtain the recombinant plasmid, which was then identified by enzyme digestion.

[0186] Add the ligation product to 50 μl of freshly thawed DH-5α competent cells (TransGen Biotech, Beijing, catalog number: CD201-01), mix well, and incubate on ice for 30 min. Incubate at 42℃ for 90 s, then immediately incubate on ice for 2 min. Add 250 μl of antibiotic-free LB liquid medium to a 1.5 ml centrifuge tube and incubate at 37℃ for 1 h at 200 rpm. Add 8 μl of 500 mM IPTG (TransGen Biotech, Beijing, catalog number: GF101-01) and 40 μl of 20 mg / ml X-gal (TransGen Biotech, Beijing, catalog number: GF201-01) to an ampicillin-resistant LB culture plate, spread evenly, and invert the plate at 37℃ for 30 min. Remove the bacterial culture, centrifuge at 4000 rpm for 1 min, discard the supernatant, retain 150 μl of the liquid, add it to the culture plate, spread evenly, and incubate inverted position for 14 h. Large, white clones were picked up using a pipette tip and placed in LB liquid medium containing 0.1% ampicillin, incubated at 37°C for 14 hours. Plasmid extraction was performed according to the instruction manual of the plasmid extraction kit (Beijing TransGen Biotech Co., Ltd., catalog number: EM101-01). The extracted plasmids were sequenced, and after successful identification, they were expanded into larger cultures.

[0187] (2) Dual-luciferase reporter assay

[0188] NCI-H460 cells were transiently transfected 48 hours before the test. The transfection groups were as follows: (1) pGL3-basic, pGL3-FA~FD and PRSS3-V1 co-transfected; (2) pGL3-basic, pGL3-FA~FD and PRSS3-V3 co-transfected. The cell culture medium was aspirated and the cells were washed with PBS. The prepared cell lysis buffer CLB was added to fully lyse the cells and the cells were placed at room temperature for 10-20 minutes before detection. 100 μl of Luciferase Assay Reagent was added to the bottom of the test tube, followed by 20 μl of sample. After mixing, the tube was placed in the instrument for detection. 100 μl of diluted Stop Reagent was added to the test tube, mixed, and then placed in the instrument for detection. The data from the two groups were summarized and analyzed according to the instructions of the Promega Dual Fluorescent Reporter Enzyme Assay Kit (Promega, USA, catalog number: E1910).

[0189] 3. Detection of MZF1-V2 binding site in the PRSS3 gene promoter region

[0190] Specific PRSS3 gene sequences were selected from the PRSS3 gene sequences presented by NCBI, and the target sequences covered the PRSS3 gene transcription start site from +341bp to +541bp (201bp).

[0191] The specific primer sequences are as follows:

[0192] Upstream primer: 5'-CTGTGATGGAGAGGGGGTTC-3',

[0193] Downstream primer: 5'-GAGTAGTGTGCGCATCGGT-3'. All primers were synthesized by BGI Genomics (Beijing).

[0194] ChIP-qPCR analysis

[0195] Test cells: Cells that overexpressed various splice variants of MZF1 after MZF1 gene expression in the knockout A549 cells prepared above.

[0196] 1. Sample preparation

[0197] The cells to be tested were seeded in culture dishes with a diameter of 10 cm. When the cells grew to about 60-80%, physiological saline was added to the negative control group. 3-5 culture dishes were collected from each group.

[0198] 2. Collect and wash the samples.

[0199] Wash cells 1-2 times with room temperature PBS, then treat with 1% formalin at 37°C for 10 min. Wash cells twice with ice-cold PBS, then transfer cells to 1 ml of ice-cold PBS using a cell scraper, centrifuge at 3,000 rpm for 2 min at 4°C, and discard the supernatant. Resuspend the cell pellet in 400 μl of lysis buffer and incubate on ice for 10 min.

[0200] 3. Chromatin DNA was fragmented by sonication. The mixture was sonicated 16 times for 2 seconds each time, centrifuged at 14,000g for 15 minutes at 4°C, and the supernatant was collected.

[0201] 4. Immunoprecipitation:

[0202] Follow the instructions in the QIAGEN EpiTech ChIPOneDay kit protocol (Germany, QIAGEN, catalog number 334471). Take 100 μl of sample, add 900 μl of IP Buffer A and 50 μl of Protein A Beads, and incubate at 4°C, rotating vertically at 360° for 50 min. Centrifuge at 4°C, 5000 rpm for 1 min, and place on ice for 1 min. Transfer the supernatant to a new centrifuge tube and aspirate 10 μl as input. Incubate with primary antibodies: for the negative control group, add 4 μg of Control IgG; for the positive control group, add 4 μg of anti-RNA Polymerase II antibody; for the experimental groups, add 4 μg of anti-MZF1 antibody. Incubate overnight at 4°C, rotating vertically at 360°. Add 60 μl of Protein A Beads, and incubate at 4°C, rotating vertically at 360° for 1 h. Centrifuge at 4°C, 5000 rpm for 1 min, and place on ice for 1 min. Discard the supernatant. Add 1 ml of IP Wash Buffer I, IP Wash Buffer II, IP Wash Buffer III, and IP Wash Buffer IV sequentially. After adding each buffer solution, rotate the sample vertically at 4°C, 360° for 4 min. Centrifuge at 4°C, 5000 rpm for 1 min, place on ice for 1 min, discard the supernatant, and add the next buffer solution. Add 30 μl of Elution Buffer and 2 μl of ChIP-Grade Proteinase K, incubate at 45°C for 30 min. Add 100 μl of DNA Extraction Beads, vortex for 10 s, incubate at 95°C for 10 min. Centrifuge at 12000 rpm for 1 min, and transfer the supernatant to a new centrifuge tube.

[0203] 5. Nucleic acid extraction

[0204] The elution buffer was placed in a 65°C water bath for 6 hours to separate the protein and DNA from the immune complex. Nucleic acid purification was performed according to the instructions of the QIAquick PCR Purification Kit (QIAGEN, Germany, catalog number 28004). The product was stored at 20°C. The nucleic acid product was then subjected to further semi-quantitative and real-time quantitative PCR, as described below.

[0205] 6. PCR amplification:

[0206] Target gene: Primer pair for the promoter binding region of the PRSS3 gene

[0207] Quantitative PCR amplification was performed using the prepared PRSS3 gene promoter region-specific primers (the results below correspond to primer pair 1).

[0208] Reagent: 2×SYBR-Green: Thermo Fisher Scientific, USA, catalog number 4334973

[0209] Amplification instrument: AB7500 Fast

[0210] Amplification conditions: 95℃ for 10 min; 95℃ for 15 s, 60℃ for 1 min (40 cycles).

[0211] Data results through 2 -△△Ct The method is used for calculation.

[0212] Normalization of precipitation in test or control samples:

[0213] First, calculate the amount of MZF1 antibody (Ab) or control IgG (IgG) in each sample relative to the sample input:

[0214] ΔC t"标准化样品沉淀" =C t[样品沉淀] -(C t[样品投入控制] -Log2 (投入稀释因子) )

[0215] Among them, C t[样品沉淀] This is for the precipitation of samples containing anti-MZF1 antibody or IgG samples. When C t[样品沉淀] When adding anti-MZF1 antibody to precipitate a sample, ΔC t"标准化样品沉淀" To standardize the sample precipitation by adding anti-MZF1 antibody; when C t[样品沉淀] When IgG is added to a sample for precipitation, ΔC t"标准化样品沉淀" Standardized sample precipitation for the addition of IgG.

[0216] When the sample input is controlled at 1% of the immunoprecipitated sample, the dilution factor is 6.6.

[0217] Calculate the precipitation of the sample = 2 (-ΔCt"标准化样品沉淀") ×100%.

[0218] ΔCt "标准化样品沉淀" Standardized sample precipitation for adding anti-MZF1 antibody or IgG sample.

[0219] Each sample was treated simultaneously with anti-MZF1 antibody and IgG. IgG served as a non-specific binding control. When calculating the effective precipitation of a sample, the non-specific precipitation of the control IgG was subtracted from the precipitation of the MZF1 antibody in that sample.

[0220] Effective precipitation of sample (% of input) = 2 (-ΔCt"标准化样品沉淀"(Ab)) ×100%-2 (-ΔCt"标准化样品沉淀"(IgG)) ×100%.

[0221] III. Results and Analysis

[0222] The results show:

[0223] When we used the JASPAR database to predict potential transcription factor binding sites on the PRSS3 gene, we found that the highest-scoring regions within 1000 nt upstream to 1000 nt downstream of its first exon were transcription factor MZF1 binding motifs, totaling four, named FA, FB, FC, and FD. Figure 3 (A)

[0224] Three known splicing variants of MZF1 (MZF1-V1, -V2, and -V3) exist. MZF1-V1 and -V2 have different 5'-UTRs and TSSs, but share the same coding region, encoding the complete isoform 1. This isoform 1 contains functional domains including an acidic domain, a SCAN domain, a TAD domain, and a DNA-binding domain consisting of 13 zinc fingers. The core sequence recognized by this C2H2-type zinc domain is rich in G sites, suggesting potential influence from CpG methylation modification. MZF1-V3 encodes the truncated isoform 2, which only possesses the acidic domain and SCAN domain at the N-terminus of the amino group, lacking the C-terminus. Therefore, it resembles the truncated DNA-binding domain model of MZF1. Figure 3 B). Therefore, we investigate the effect of the MZF1 isoform on the expression regulation of PRSS3 splicing variants.

[0225] First, MZF1 was knocked out in A549 cells using CRISPR / Cas9 technology, and then MZF1-V2 or -V3 was stably overexpressed, respectively. Figure 3C). The results showed no significant effect on PRSS3-V1 expression; knockout increased PRSS3-V2 expression, and re-expression of MZF1-V2 or -V3 significantly reduced PRSS3-V2 expression, suggesting that MZF1 inhibits PRSS3-V2 expression; while knockout decreased PRSS3-V3 expression, and re-expression of MZF1-V2 significantly upregulated PRSS3-V3 expression, and re-expression of MZF1-V3 had no effect. Figure 3 D and 3E) suggest that MZF1 can upregulate PRSS3-V3 expression, which may be related to its zinc finger domain.

[0226] To this end, we constructed four plasmids with truncated binding motifs: pGL3-FA, pGL3-FB, pGL3-FC, and pGL3-FD. Figure 3 F) The plasmids pGL3-V1 and pGL3-FC were co-transfected into NCI-H460 cells, respectively. Compared with cells transfected with the control plasmid, the luciferase activity of cells co-transfected with pGL3-V3 and pGL3-FB, pGL3-FC was significantly increased, while other activities showed no significant changes. These preliminary results suggest that MZF1 binds to the PRSS3 gene body and specifically upregulates PRSS3-V3 expression. This suggests that MZF1 upregulation of PRSS3-V3 expression may be achieved through the binding of its zinc finger domain to the MZF1 binding motifs FB and FC on the PRSS3 gene body, and that the regions containing FB and FC are the core DMR regions for PRSS3-V3 methylation regulation.

[0227] Finally, we performed chromatin immunoprecipitation to determine the PRSS3-V3 binding site in the PRSS3 gene promoter region. Quantitative PCR results are shown below. Figure 3 G. ChIP-qPCR analysis of the specific enrichment status of MZF1 protein in the PRSS3 promoter region. MZF1-V2 was specifically expressed after MZF1 knockout in A549 cells. Chromatin was precipitated using MZF1 antibody or control IgG antibody. qPCR analysis of the precipitated DNA fragments indicated specific enrichment of MZF1 in the PRSS3 promoter region. Results are expressed as a percentage of input (% of INPUT).

[0228] In summary, experimental results demonstrate that PRSS3-V3 exhibits tumor suppressor gene activity, while MZF1-V2 can specifically bind to the promoter region of the PRSS3-V3 gene, upregulating its expression. This suggests that PRSS3-V3 and MZF1-V2 could serve as drug targets for lung cancer diagnosis or prognostic assessment.

[0229] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention. SEQUENCE LISTING <110> Beijing Chest Hospital, Capital Medical University Beijing Tuberculosis and Thoracic Tumor Research Institute <120> A molecular marker for lung cancer diagnosis, chemotherapy, or prognosis and its application <160> 25 <170> PatentIn version 3.5 <210> 1 <211> 932 <212> DNA <213> Artificial sequence <400> 1 acttggcgag cggcgcggga tgcagacggc tgcgaggcgc tgggcacagg ttgccaggac 60 aaccgtgagg ctgcataaaa agaacctatg acaggatgca catgagagag acaagtggct 120 tcacattgaa gaaggggagg agtgcgccat tggttttcca tcctccagat gcactgattg 180 ctgtcccctt tgacgatgat gacaagattg ttgggggcta cacctgtgag gagaattctc 240 tcccctacca ggtgtccctg aattctggct cccacttctg cggtggctcc ctcatcagcg 300 aacagtgggt ggtatcagca gctcactgct acaagacccg catccaggtg agactggggag 360 agcacaacat caaagtcctg gaggggaatg agcagttcat caatgcggcc aagatcatcc 420 gccaccctaa atacaacagg gacactctgg acaatgacat catgctgatc aaactctcct 480 cacctgccgt catcaatgcc cgcgtgtcca ccatctctct gcccaccacc cctccagctg 540 ctggcactga gtgcctcatc tccggctggg gcaacactct gagctttggt gctgactacc 600 cagacgagct gaagtgcctg gatgctccgg tgctgaccca ggctgagtgt aaagcctcct 660 accctggaaa gattaccaac agcatgttct gtgtgggctt ccttgaggga ggcaaggatt 720 cctgccagcg tgactctggt ggccctgtgg tctgcaacgg acagctccaa ggagttgtct 780 cctggggcca tggctgtgcc tggaagaaca ggcctggagt ctacaccaag gtctacaact 840 atgtggactg gattaaggac accatcgctg ccaacagcta aagcccccgg tccctctgca 900 gtctctatac caataaagtg gccctgctct ca 932 <210> 2 <211> 2666 <212> DNA <213> Artificial Sequence <400> 2 aggcggtgct gccgtctgtt gtacctgaga ggcttgcgca tgccgacgca cggattcgag 60 gcggggagca tgggaagaag cggccaggag tatgacctga tcattgcgac caccgctagg 120 ggaagggagg agagggtgta gaaacgggga cgagggtggg ggaagggcaa ggaggcgctc 180 gagctggtgc gcggagcatc ctgggagacg tagtccagcg ggagggggaa gtcgaagact 240 gcgcgtgctc aggagcgcgg agcggcccgc tgagcgcaga ggggcagaca ctggcctcag 300 atacctgacc tggtaccctc tatgaggcct gcggtgctgg gctccccaga ccgagcaccc 360 ccagaagatg aggggcctgt catggtgaag ctagaggact ctgaggagga gggtgaggct 420 gccttatggg acccaggccc tgaagctgca cgcctgcgtt tccggtgctt ccgctatgag 480 gaggccacag ggccccaaga ggccctggcc cagctccgag agctgtgtcg ccagtggctg 540 cgtccagagg tacgctccaa ggagcagatg ctggagctgt tggtgctgga gcagttcctg 600 ggcgcactgc cccctgagat ccaggcccgt gtgcaggggc agcggccagg cagccccgag 660 gaggctgctg ccctagtaga tgggctgcgc cgggagccgg gcggaccccg gagatgggtc 720 acagtccagg tgcagggcca ggaggtccta tcagagaaga tggagccctc cagtttccag 780 cccctacctg aaactgagcc tccaactcca gagcctgggc ccaagacacc tcctaggact 840 atgcaggaat caccactggg cctgcaggtg aaagaggagt cagaggttac agaggactca 900 gatttcctgg agtctgggcc tctagctgcc acccaggagt ctgtacccac cctcctgcct 960 gaggaggccc agagatgtgg gaccgtgctg gaccagatct ttccccacag caagactggg 1020 cctgagggtc cctcatggag ggagcacccc agggccctgt ggcatgagga agctgggggc 1080 atcttctccc cagggttcgc gctgcagcta ggcagcatct ccgcaggtcc aggtagtgta 1140 agccctcacc tccacgtccc ctgggacctc ggcatggctg gcctttctgg ccagatccaa 1200 tcaccctccc gcgaaggtgg ctttgcgcat gcgcttctgc tccccagcga tctgaggagt 1260 gaacaggacc ccacggacga ggatccctgc cggggtgtgg gccctgctct gatcaccacc 1320 cgctggcgct cccccagggg ccggagccgg ggccgcccca gcactggggg cggggtggtt 1380 aggggcggcc gttgcgatgt atgtggcaag gtgttcagcc aacgcagcaa cctgctgagg 1440 caccagaaga tccacacggg tgagcgacca ttcgtgtgca gcgagtgcgg ccgcagcttc 1500 agccgcagct cgcacctgct gcgccaccag cttacgcaca ccgaggagcg gccgttcgtg 1560 tgcggcgact gtggccaggg cttcgtgcgc agcgcgcgcc tggaagagca tcggagagtg 1620 cacacgggcg aacagccttt ccgttgcgct gagtgcggcc agagcttccg gcagcgctcc 1680 aatctgctgc agcaccagcg catccacggc gatcccccgg gccctggcgc taagcccccg 1740 gcccctcctg gtgcgcccga gcctcccggc ccctttccgt gcagcgagtg ccgcgagagc 1800 ttcgcgcggc gcgccgtgct gctggagcac caggcggtac acacgggcga caagtccttt 1860 ggctgcgtcg agtgcggcga gcgcttcggc cgccgctcag tgctgctgca gcaccggcgc 1920 gtgcacagtg gcgagcggcc cttcgcctgt gccgagtgcg gccagagctt ccggcagcgc 1980 tccaacctga cgcagcaccg gcgcatccac accggggagc ggcccttcgc ctgcgccgag 2040 tgtggcaagg ccttccgcca gcggcctacg ctcacgcagc atctccgcgt acacacgggc 2100 gagaaaccct ttgcctgccc cgagtgtggc cagcgcttca gccagcgcct caagctcacg 2160 cgtcatcaga ggacacacac cggcgaaaag ccctaccact gcggtgagtg cggcctgggc 2220 ttcacgcagg tctcgcggct caccgagcac cagcgcatcc acacgggcga acggcccttc 2280 gcctgccccg agtgcggcca gagctttcgg cagcacgcca acctcaccca gcaccggcgc 2340 atccacacgg gtgaacggcc ctacgcatgc cctgagtgtg gcaaggcctt ccgccagcgg 2400 cccacgctca cgcagcatct gcgcacccac cgacgagaga agcccttcgc ctgccaggac 2460 tgtggccgcc gcttccacca gagcaccaag ctcattcagc accagcgcgt ccacagcgcc 2520 gagtagctcc agccgggacg cactgtgtcc gccatggtca gaacacctac ctcccctggt 2580 tattgtgagg ctggcgatta cataagtata agcaggtccg cccagggctt ggctactgta 2640 ggtgtccaat aaacagtaga tggaaa 2666 <210> 3 <211> 2(0 <212> DNA <213> Artificial Sequence [ <400> 3 gtgcgccatt ggttttccat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gcagaagtgg gagccagaat 20 <210> 5<00(0603><211> 18 <212> DNA <213> Artificial Sequence <400> 5 gggggcatct tctcccca 18<00006o8><210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 caccttgcca catacatcgc 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 attctggctc ccacttctgc 20 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <400> 8 ctctcccagt ctcacctgga 20 <210> 9 <211> 15 <212> DNA <213> Artificial sequence <400> 9 ctgcgaggcg ctggg 15 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <400> 10 atccttgcct ttgtgggagc 20 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <400> 11 cgactcgcat gggacctg 18 <210> 12 <211> twenty one <212> DNA <213> Artificial sequence <400> 12 ttagttgcgt tacacccttt c 21 <210> 13 <211> 19 <212> DNA <213> Artificial sequence <400> 13 accttcaccg ttccagttt 19 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <400> 14 atgcaggaat caccactggg 20 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <400> 15 aaagatctgg tccagcacgg 20 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <400> 16 ccgtgctgga ccagatcttt 20 <210> 17 <211> 17 <212> DNA <213> Artificial sequence <400> 17 ggcccctggg gagaaga 17 <210> 18 <211> twenty one <212> DNA <213> Artificial sequence <400> 18 ttagttgcgt tacacccttt c 21 <210> 19 <211> 19 <212> DNA <213> Artificial sequence <400> 19 accttcaccg ttccagttt 19 <210> 20 <211> 286 <212> DNA <213> Artificial sequence <400> 20 ggggtacccc gggggagggt acgcggacag ggaggggata ccgactggga ggggctcagg 60 gacagggatg gaggctcctc taggggagga cgggagggga tggagggccc tggtgtcgca 120 gaagcccacc tggggccccc tccgggctgc ggcaccgatg cgcacactac tcccaccgcc 180 cccgagtgcc tatgtccggc tggccgcggc cctggaatga atattgctca gtcccccgcg 240 agtcaggtct gccgcgttgc agggtgaggg gaagccgctc gagcgg 286 <210> 21 <211> 217 <212> DNA <213> Artificial sequence <400> 21 ggggtacccc ctaggggagg acgggagggg atggagggcc ctggtgtcgc agaagcccac 60 ctggggcccc ctccgggctg cggcaccgat gcgcacacta ctcccaccgc ccccgagtgc 120 ctatgtccgg ctggccgcgg ccctggaatg aatattgctc agtcccccgc gagtcaggtc 180 tgccgcgttg cagggtgagg ggaagccgct cgagcgg 217 <210> 22 <211> 126 <212> DNA <213> Artificial sequence <400> 22<ggggtacccc tcccaccgcc cccgagtgcc tatgtccggc tggccgcggc cctggaatga 60 atattgctca gtcccccgcg agtcaggtct gccgcgttgc agggtgaggg gaagccgctc 120 gagcgg 126 <210> 23 <211> 32 <212> DNA <213> Artificial sequence <400> 23 ggggtacccc tgaggggaag ccgctcgagc gg 32 <210> 24 <211> 140 <212> DNA <213> Artificial sequence <400> 24 gtgcgccatt ggttttccat cctccagatg cactgattgc tgtccccttt gacgatgatg 60 acaagattgt tgggggctac acctgtgagg agaattctct cccctaccag gtgtccctga 120 attctggctc ccacttctgc 140 <210> 25 [[ID=,36]]<211> 339 <212> DNA <213> Artificial sequence <400> 25 gggggcatct tctccccagg gttcgcgctg cagctaggca gcatctccgc aggtccaggt 60 agtgtaagcc ctcacctcca cgtcccctgg gacctcggca tggctggcct ttctggccag 120 [[ID=4,8]]atccaatcac cctcccgcga aggtggcttt gcgcatgcgc ttctgctccc cagcgatctg 180 aggagtgaac aggaccccac ggacgaggat ccctgccggg gtgtgggccc tgctctgatc 240 accacccgct ggcgctcccc caggggccgg agccggggcc gccccagcac tgggggcggg 300 gtggttaggg gcggccgttg cgatgtatgt ggcaaggtg 339

Claims

1. The application of a substance for detecting molecular markers in the preparation of diagnostic reagents for non-small cell lung cancer, characterized in that, The molecular markers include trypsin 3 splice variant 3 and transcription factor bone marrow zinc finger gene 1 splice variant 2. The nucleotide sequence of trypsin 3 splice variant 3 is shown in SEQ ID NO.1, and the nucleotide sequence of transcription factor bone marrow zinc finger gene 1 splice variant 2 is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The substance is a primer or reagent for detecting the molecular marker.

3. The application according to claim 2, characterized in that, The primer sequences for detecting trypsin 3 splice variant 3 are shown in SEQ ID NO. 3-4, and the primer sequences for detecting the transcription factor bone marrow zinc finger gene 1 splice variant 2 are shown in SEQ ID NO. 5-6.

4. The application of a substance for detecting molecular markers in the preparation of a diagnostic kit for non-small cell lung cancer, characterized in that, The molecular markers include trypsin 3 splice variant 3 and transcription factor bone marrow zinc finger gene 1 splice variant 2. The nucleotide sequence of trypsin 3 splice variant 3 is shown in SEQ ID NO.1, and the nucleotide sequence of transcription factor bone marrow zinc finger gene 1 splice variant 2 is shown in SEQ ID NO.

2.

5. The application according to claim 4, characterized in that, The substance is a primer or reagent for detecting the molecular marker; the primer sequence for detecting trypsin 3 splice variant 3 is shown in SEQ ID NO. 3-4, and the primer sequence for detecting the transcription factor bone marrow zinc finger gene 1 splice variant 2 is shown in SEQ ID NO. 5-6.

Images