A method and vectors for breeding brassica napus having multiple desirable traits
By constructing the 35S:BnaC06.WIP2-6HA overexpression vector in Brassica napus, the expression level of the BnaC06.WIP2 gene was increased, solving the problem of unknown function of the BnaC06.WIP2 gene. This resulted in rapeseed varieties with high leaf splitting degree and high salt tolerance, expanding the application potential of genetic engineering breeding.
Patent Information
- Application Number
- CN202310526515.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-10
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2043-05-10
AI Technical Summary
The function of the BnaC06.WIP2 gene in the existing technology is still unclear, which limits its application in the genetic engineering breeding of Brassica napus and makes it difficult to breed rapeseed varieties with high leaf splitting degree and high salt tolerance.
By constructing the 35S:BnaC06.WIP2-6HA overexpression vector, the expression level of the BnaC06.WIP2 gene in Brassica napus was increased, the transcription level of the negative regulatory gene for leaf splitting was downregulated, and the overexpression of the BnaC06.WIP2 gene was achieved, thereby obtaining Brassica napus with high leaf splitting degree and high salt tolerance.
This study achieved high leaf splitting degree and high salt tolerance in Brassica napus, providing excellent germplasm for genetic engineering breeding. It also revealed the function of the BnaC06.WIP2 gene in the leaf morphology development and stress resistance during seed germination of Brassica napus, laying a theoretical foundation for breeding.
Smart Images

Figure CN116640793B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering directional breeding technology, and relates to the directional breeding of Brassica napus, specifically to a breeding method and vector for Brassica napus with multiple excellent traits. Background Technology
[0002] As an allotetraploid crop, rapeseed (Brassica napus) has a complex genome with numerous homologous copies, often exhibiting gene redundancy between different homologous copies. Rapeseed is currently my country's most important oilseed crop. Rapeseed leaves are vital vegetative organs, providing the energy needed for growth and development through photosynthesis and respiration. Furthermore, leaf morphology is a crucial component of rapeseed morphogenesis. Compared to entire leaves, serrated and lobed leaves exhibit superior characteristics such as drought resistance, cold tolerance, heat tolerance, higher light utilization efficiency, and suitability for dense planting. Therefore, lobed leaves are one of the important indicators for rapeseed variety selection. Seeds are the most important yield and reproductive organs for rapeseed. The timing of seed germination determines when and under what conditions rapeseed begins a new life cycle, forming the foundation of agricultural production. Due to natural factors and human factors such as unreasonable cultivation practices, soil salinity in northern my country has gradually worsened. The salinized land area in the six western provinces (regions) of Shaanxi, Gansu, Ningxia, Qinghai, Inner Mongolia, and Xinjiang alone accounts for 69.03% of the national salinized land area. In recent years, with the continuous northward and westward expansion of winter rapeseed to higher latitudes and altitudes, the rapeseed production pattern in northern my country has undergone tremendous changes, with a further increase in planting area. Rapeseed has become an important oilseed crop and ecological crop in northern my country. Therefore, breeding salt-tolerant varieties is of paramount importance for ensuring my country's edible vegetable oil supply and for the rational utilization of saline-alkali land resources in northern China.
[0003] As an allotetraploid crop, rapeseed (Brassica napus) has a complex genome with numerous homologous copies, often exhibiting gene redundancy between different homologous copies. Developing high-yielding, stress-resistant, and densely planted rapeseed varieties using conventional mutation breeding methods is time-consuming. Furthermore, mutation breeding itself is inherently unpredictable and yields few beneficial variations. Coupled with the gradual decline in rapeseed varietal genetic diversity and the scarcity of superior germplasm resources, the bottleneck effect of conventional breeding techniques is becoming increasingly apparent. Transcription factors, often located upstream of numerous structural genes, regulate their expression, thereby modulating multiple plant traits. If transcription factors from rapeseed are used in genetic engineering breeding, it is hoped that rapeseed germplasm with multiple superior traits can be selectively bred. Research on the function of transcription factors in rapeseed is a prerequisite and foundation for targeted breeding using transcription factors.
[0004] AtWIP2 / NTT in Arabidopsis thaliana belongs to the C2H2 zinc finger protein family of transcription factors. Studies have shown that AtWIP2 is an essential gene for the development of carpel transport bundles in Arabidopsis thaliana. Mutations in AtWIP2 severely affect pollen tube development, resulting in mature fruits that are nearly 30% shorter and seed numbers reduced by nearly 60% compared to the wild type. Gain-of-function mutants of AtWIP2 and overexpression of AtWIP2 both inhibit silique dehiscence. AtWIP2 also interacts with the MADS-box transcription factor STK (SEEDSTICK), jointly targeting the KAWAK gene and regulating the expression of genes related to cell wall polysaccharides and lipid deposition, thereby determining the plant's reproductive capacity. Furthermore, studies have found that AtWIP2, along with AtWIP4 and AtWIP5, redundantly mediates auxin signaling to regulate the initiation of root tip meristems in Arabidopsis thaliana. The homolog of AtWIP2 in gerbera daisy, GhWIP2, acts as a transcriptional repressor, inhibiting cell expansion by regulating gibberellin, abscisic acid, and auxin signaling.
[0005] The homolog of AtWIP2 (i.e., the BnaWIP2 gene) exists in Brassica napus, but the role of this homolog in the development and stress resistance of Brassica napus is still unclear, thus limiting its application in genetic engineering breeding. Summary of the Invention
[0006] In view of the shortcomings of the existing technology, the purpose of this invention is to provide a breeding method and vector for rapeseed with multiple excellent traits, and to solve the technical problem that the function of the BnaC06.WIP2 gene is not clear in the existing technology, which restricts its genetic engineering application.
[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0008] A breeding method for Brassica napus, which obtains Brassica napus with two traits—high leaf splitting and high salt tolerance—by increasing the expression level of the BnaC06.WIP2 gene in Brassica napus.
[0009] The present invention also has the following technical features:
[0010] Specifically, the method for increasing the expression level of the BnaC06.WIP2 gene in Brassica napus is as follows: an overexpression vector is transformed into Brassica napus; the overexpression vector is named 35S:BnaC06.WIP2-6HA overexpression vector, and its nucleotide sequence is shown as sequence ID number 1 in the nucleotide or amino acid sequence listing.
[0011] Specifically, increasing the expression level of the BnaC06.WIP2 gene in Brassica napus can downregulate the transcription level of negative regulatory genes for leaf cleft formation; these negative regulatory genes include: BnaA01.TCP4, BnaA03.TCP4, BnaC03.TCP4, BnaA05.BOP1, and BnaC02.AS2.
[0012] Specifically, after overexpressing the BnaC06.WIP2 gene in Brassica napus, the Brassica napus in the seed germination stage was able to tolerate 120 mM sodium chloride.
[0013] The method specifically includes the following steps:
[0014] Step 1: Cloning of the BnaC06.WIP2 gene in Brassica napus:
[0015] Step 1.1, Design of specific primers and validation primers for the BnaC06.WIP2 gene:
[0016] The specific primers and their nucleotide sequences are as follows:
[0017] BnaC06.WIP2-6HA-Kpn IF: 5'-tctagaggatccccgggtaccatgactgatcctcattccaat-3'.
[0018] BnaC06.WIP2-6HA-Spe IR: 5'-gtatgggtaactagaactagttttggaccgccttgactcatg-3'.
[0019] The verification primer and its nucleotide sequence are: 5'-gtcactttattgtgaagatagtgg-3'.
[0020] Step 1.2, RNA extraction and cDNA synthesis.
[0021] Step 1.3, Cloning of the BnaC06.WIP2 gene.
[0022] Step 2, Construction of the overexpression vector:
[0023] Step 2.1, ligating the target gene fragment to the linear vector:
[0024] The overexpression vector p1300-35S-6HA and the BnaC06.WIP2 gene fragment obtained in step 1.3 were digested with enzymes overnight and purified. The purified gene fragment was then ligated with the vector to obtain the ligation product.
[0025] Step 2.2, Conversion of the Linkage Product:
[0026] The ligation product obtained in step 2.1 was transformed into competent cells, and then the competent cells containing the ligation product were plated on selection medium plates for culture.
[0027] Step 2.3, Monoclonal screening and identification:
[0028] Step 2.4, obtain the 35S:BnaC06.WIP2-6HA overexpression vector:
[0029] The single clones screened and identified in step 2.3 were expanded and cultured, and plasmids were extracted to obtain the 35S:BnaC06.WIP2-6HA overexpression vector;
[0030] Step 3: Genetic transformation, screening, and identification of Brassica napus:
[0031] Step 3.1: Construct Agrobacterium containing the 35S:BnaC06.WIP2-6HA overexpression vector.
[0032] Step 3.2: Transform Brassica napus into rapeseed using Agrobacterium-mediated transformation.
[0033] Step 3.3: Identification was performed using RT-qPCR primers for the BnaC06.WIP2 gene.
[0034] The RT-qPCR primers and their nucleotide sequences for the BnaC06.WIP2 gene are as follows:
[0035] BnaC06.WIP2-RT-qPCR-F: 5'-taatcacgatgaccatgaccatga-3'.
[0036] BnaC06.WIP2-RT-qPCR-R:5'-tcaccttcgtgatggtagtcg-3'.
[0037] Specifically, in step 2.1, the molar ratio of gene fragment to vector during ligation is 2:1, the temperature is 37℃, and the time is 30 minutes.
[0038] Specifically, in step 2.2, the transformation process is as follows: gently aspirate and mix, place on ice for 20 minutes, incubate in a 42°C water bath for 90 seconds, quickly place on ice for 2 minutes, add 700 μL of LB liquid medium, and incubate in a 37°C shaker for 30 minutes to obtain competent cells containing the ligation product.
[0039] Specifically, in step 2.2, the screening medium contains 50 μg / mL. -1LB solid medium for kanamycin.
[0040] Specifically, step 3.2 includes:
[0041] Two to three days before transformation, the Agrobacterium containing the 35S:BnaC06.WIP2-6HA overexpression vector obtained in step 3.1 was activated. The activated strain was then inoculated into the Agrobacterium suspension and shaken for 30 minutes. The cultured bacterial solution was then placed in a centrifuge tube, and the OD value of the Agrobacterium was measured using a spectrophotometer. 600 The value is 0.1-0.2; rapeseed explants that have been pre-cultured for 2-3 days are placed in Agrobacterium suspension for 10 minutes for infection; the infected rapeseed explants are placed on filter paper to dry and then placed on co-culture medium; two days later, the explants are transferred to screening medium for 7 days; effective callus tissue is selected and transferred to screening medium containing hygromycin for about 15 days, and the screening is repeated 2 to 3 times; the vigorous positive callus tissue is transferred to differentiation medium and waited for it to differentiate into seedlings. The differentiated seedlings are then transferred to rooting culture for 7-10 days to root.
[0042] The present invention also protects the overexpression vectors described above.
[0043] Compared with the prior art, the present invention has the following technical effects:
[0044] (I) This invention obtains a transgenic Brassica napus with two excellent traits, namely high leaf splitting degree and high salt tolerance, by overexpressing the BnaC06.WIP2 gene in Brassica napus. This transgenic Brassica napus can be used as an excellent germplasm for genetic engineering breeding.
[0045] (II) This invention reveals for the first time the function of the BnaC06.WIP2 gene in leaf morphology development and stress resistance during seed germination of Brassica napus, laying a theoretical foundation for the application of the BnaC06.WIP2 gene. Attached Figure Description
[0046] Figure 1 This is a schematic diagram showing the insertion location of the BnaC06.WIP2 gene in the overexpression vector p1300-35S-6HA. Figure 1 In the diagram: RB represents the right boundary, LB represents the left boundary, NOS-ter represents the terminator, Hygromycin represents the hygromycin resistance selection gene, and 35S-pro represents the 35S strong promoter.
[0047] Figure 2 This is a nucleic acid electrophoresis image used for PCR identification of the 35S:BnaC06.WIP2-6HA overexpression line. Figure 2In the Chinese text: Const represents the 35S:BnaC06.WIP2-6HA overexpression vector, which is the positive control; Westar represents the wild type, which is the negative control.
[0048] Figure 3 A bar chart to identify the expression level of the BnaC06.WIP2 gene in overexpression lines using RT-qPCR.
[0049] Figure 4 Macroscopic morphology of leaves of wild-type rapeseed and overexpression lines.
[0050] Figure 5 A bar chart showing the phenotypic data of wild-type rapeseed leaves and overexpression lines. Figure 5 In the diagram: A is a bar chart showing the number of serrations in wild-type rapeseed leaves and leaves of overexpression lines; B is a bar chart showing the leaf cleavage index in wild-type rapeseed leaves and leaves of overexpression lines; C is a bar chart showing the ratio of the number of serrations to the leaf perimeter in wild-type rapeseed leaves and leaves of overexpression lines; D is a bar chart showing the ratio of the serration area to the leaf area in wild-type rapeseed leaves and leaves of overexpression lines.
[0051] Figure 6 The photosynthetic efficiency of leaves of wild-type rapeseed and overexpression lines. Figure 6 In the table: A represents the net photosynthetic rate of wild-type rapeseed leaves and overexpression line leaves; B represents the stomatal conductance of wild-type rapeseed leaves and overexpression line leaves; C represents the intercellular CO2 concentration of wild-type rapeseed leaves and overexpression line leaves; and D represents the transpiration rate of wild-type rapeseed leaves and overexpression line leaves.
[0052] Figure 7 A bar chart showing the expression levels of leaf cracking-related genes in wild-type rapeseed leaves and overexpression lines detected by RT-qPCR.
[0053] Figure 8 The images show the germination status of wild-type rapeseed seeds and overexpression lines under normal conditions and salt stress. Figure 8 In Chinese: Control represents normal conditions, and 120mM NaCl represents 120mM sodium chloride.
[0054] Figure 9 Line graph showing the germination rates of wild-type rapeseed seeds and overexpression lines under normal conditions and salt stress.
[0055] The specific content of the present invention will be further explained in detail below with reference to the embodiments. Detailed Implementation
[0056] In previous research, the inventors used bioinformatics analysis to identify multiple homologous genes of AtWIP2 in Brassica napus. Based on their different chromosomal locations, these genes were named BnaA04.WIP2, BnaA07.WIP2, BnaA09.WIP2, BnaC04.WIP2, BnaC06.WIP2, and BnaC08.WIP2. Building upon this, this invention focuses on BnaC06.WIP2 and, for the first time, reveals the function of the BnaC06.WIP2 gene.
[0057] It should be noted that, unless otherwise specified, all reagents, kits, enzymes, and culture media used in this invention are those known in the art, such as:
[0058] The plant RNA extraction kit was purchased from Hunan Aikerui Biotechnology Co., Ltd., catalog number No. AG21019.
[0059] The reverse transcription kit was purchased from Beijing TransGen Biotech Co., Ltd., catalog number No. AE311.
[0060] High-fidelity DNA polymerase, purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd., product number No. R045Q.
[0061] DNA purification and recovery kit, purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number No. DP214.
[0062] Restriction endonucleases Kpn I and Spe I were produced by New England Biolabs.
[0063] The one-step cloning kit was purchased from Nanjing Novizan Biotechnology Co., Ltd., and its trade name is ClonExpressⅡOne Step Cloning Kit.
[0064] The plasmid extraction kit was manufactured by Omega Bio-Tek, Inc., USA.
[0065] Hygromycin, purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number S24059.
[0066] 1L of LB liquid medium contains the following components: 10g of tryptone, 5g of yeast extract, and 10g of NaCl; LB solid medium is based on the above formula with the addition of 15g of agar.
[0067] In this invention:
[0068] The rapeseed used is the "Westar" variety of rapeseed known in the existing technology.
[0069] The following are specific embodiments of the present invention. It should be noted that the present invention is not limited to the following specific embodiments. All equivalent modifications made based on the technical solutions of this application fall within the protection scope of the present invention.
[0070] Example 1:
[0071] This embodiment provides an overexpression vector, named 35S:BnaC06.WIP2-6HA overexpression vector, whose nucleotide sequence is shown as sequence ID Number 1 in the nucleotide or amino acid sequence listing.
[0072] Example 2:
[0073] This embodiment provides a breeding method for rapeseed with multiple excellent traits. The method involves transforming the 35S:BnaC06.WIP2-6HA overexpression vector from Example 1 into rapeseed to increase the expression level of the BnaC06.WIP2 gene in rapeseed, thereby obtaining rapeseed with two excellent traits: high leaf splitting degree and high salt tolerance.
[0074] The method specifically includes the following steps:
[0075] Step 1: Cloning of the BnaC06.WIP2 gene in Brassica napus:
[0076] Step 1.1, Design of specific primers for the BnaC06.WIP2 gene:
[0077] Bioinformatics analysis was used to obtain the nucleotide and protein sequences of BnaC06.WIP2. The nucleotide sequence of the BnaC06.WIP2 gene is shown as sequence ID Number 2 in the nucleotide or amino acid sequence listing, and the amino acid sequence encoded by the BnaC06.WIP2 gene is shown as sequence ID Number 3 in the nucleotide or amino acid sequence listing. The insertion site of the BnaC06.WIP2 gene in the vector was designed and determined, as follows: Figure 1 As shown in Table 1, specific primers (BnaC06.WIP2-6HA-Kpn IF and BnaC06.WIP2-6HA-Spe IR) were then designed using the Primer BLAST program in NCBI, and validation primers (P1300-F) were designed on the vector.
[0078] Table 1. Primer sequences for cloning the BnaC06.WIP2 gene
[0079]
[0080]
[0081] Step 1.2, RNA extraction and cDNA synthesis:
[0082] Total RNA was extracted from different tissues of the Brassica napus cultivar “Westar” using a plant RNA extraction kit. cDNA was synthesized using the total RNA as a template and a reverse transcription kit.
[0083] Step 1.3, Cloning of the BnaC06.WIP2 gene:
[0084] Using the specific primers designed in step 1.1, and the cDNA from the leaves of the Brassica napus variety "Westar" synthesized in step 1.2 as a template, the target gene was amplified by PCR using high-fidelity DNA polymerase. The reaction system consisted of: 2.5 μL of 10×PCR Buffer and Mg... 2+ 1 μL of dNTP, 1 μL of KOD-Plus, 1 μL each of forward and reverse primers, 1 μL of cDNA template, and sterile water to a final volume of 25 μL were added. PCR reaction conditions are shown in Table 2. After the PCR reaction, agarose gel electrophoresis was performed. The size of the target gene was determined based on the DNA marker, and the correctly sized bands were quickly excised from the gel. The target gene fragment was purified and recovered using a universal DNA purification and recovery kit.
[0085] Table 2. High-fidelity PCR reaction conditions
[0086]
[0087] Step 2, Construction of the overexpression vector:
[0088] Step 2.1, ligating the target gene fragment to the linear vector:
[0089] The overexpression vector p1300-35S-6HA was digested overnight using restriction endonucleases Kpn I and Spe I at a constant temperature of 37°C. The digestion products were purified and recovered using a DNA purification and recovery kit. A one-step cloning kit was used to ligate the purified target gene fragment with the digested vector at a 2:1 molar ratio, and the mixture was incubated at 37°C for 30 minutes to complete the ligation of the target gene fragment into the linear vector.
[0090] Step 2.2, Conversion of the Linkage Product:
[0091] The ligation product obtained in step 2.1 was added to E. coli competent cells DH5α, gently aspirated and mixed, and placed on ice for 20 minutes. The mixture was then incubated in a 42°C water bath for 90 seconds, immediately placed on ice for 2 minutes, and 700 μL of LB liquid medium was added. After incubation at 37°C with shaking for 30 minutes, the bacterial culture was spread onto a medium containing 50 μg / mL of LB liquid medium. -1 Incubate kanamycin on LB solid medium plates at 37°C, inverted overnight.
[0092] Step 2.3, Monoclonal screening and identification:
[0093] Ten single-clone colonies were picked from the overnight culture plate in step 2.2 and mixed thoroughly in 7 μL of ddH2O. Using 1 μL of the bacterial culture as a template, colony PCR was performed using the primers p1300-F and 35S:BnaC06.WIP2-6HA-Spe IR designed in step 2.1 for colony PCR verification. After the PCR reaction, the products were subjected to agarose gel electrophoresis. Two single-clone colonies with correct bands were selected and added to a solution containing 50 μg / mL of ddH2O. -1 Kanamycin was cultured in LB liquid medium at 28°C and 220 rpm for 20 hours.
[0094] The cultured bacterial solution was sequenced, and the sequencing results were identical to the target gene sequence, indicating that the BnaC06.WIP2 gene had been successfully cloned into the overexpression vector p1300-35S-6HA.
[0095] Step 2.4, obtain the 35S:BnaC06.WIP2-6HA overexpression vector:
[0096] The single clones screened and identified in step 2.3 were expanded and cultured. Then, plasmids were extracted according to the instructions of the plasmid extraction kit to obtain the 35S:BnaC06.WIP2-6HA overexpression vector.
[0097] Step 3: Genetic transformation, screening, and identification of Brassica napus:
[0098] Step 3.1: Construct Agrobacterium containing the 35S:BnaC06.WIP2-6HA overexpression vector:
[0099] The 35S:BnaC06.WIP2-6HA overexpression vector obtained in step 2.4 was transformed into Agrobacterium competent cells GV3101. Single colonies were picked, and colony PCR was performed using the primers p1300-F and 35S:BnaC06.WIP2-6HA-Spe IR designed in step 2.1 for verification. Positive single colonies were expanded and stored at -80°C for later use.
[0100] Step 3.2: Transformation of Brassica napus using Agrobacterium-mediated transformation:
[0101] Two to three days before transformation, the positive Agrobacterium strains obtained in step 3.1 were activated (i.e., streaked on a culture dish with a fine inoculation loop). The activated strains were then inoculated into the Agrobacterium suspension and placed in a shaker for 30 minutes. The cultured bacterial solution was then transferred to a centrifuge tube, and the OD value of the Agrobacterium was measured using a spectrophotometer. 600 The value is 0.1–0.2. Rapeseed explants pre-cultured for 2–3 days are placed in Agrobacterium suspension for 10 minutes for infection. The infected explants are then dried on filter paper and placed on co-culture medium. Two days later, the explants are transferred to screening medium and cultured for 7 days. Effective callus tissue is selected and transferred to selection medium containing hygromycin for screening for approximately 15 days, repeating the selection 2–3 times. Vigorously growing positive callus tissue is transferred to differentiation medium, and after differentiation into seedlings, the differentiated seedlings are transferred to rooting culture for 7–10 days.
[0102] Step 3.3: Identification was performed using RT-qPCR primers for the BnaC06.WIP2 gene.
[0103] Take a 0.5cm sample from the seedling that has already developed roots in step 3.2. 2 DNA was extracted from rapeseed leaves, and PCR amplification was performed using the primers p1300-F and 35S:BnaC06.WIP2-6HA-Spe IR designed in step 2.1. The results are as follows. Figure 2 As shown in Table 4, RT-qPCR primers for the BnaC06.WIP2 gene were designed. The primer sequences are shown in Table 4. Positive transgenic rapeseed was identified at the RNA level, and the results are as follows: Figure 3 As shown, the BnaC06.WIP2 gene was overexpressed in all positive plants.
[0104] Table 4. RT-qPCR primer sequences for the BnaC06.WIP2 gene
[0105] Primer name Primer sequence (5'→3') BnaC06.WIP2-RT-qPCR-F taatcacgatgaccatgaccatga BnaC06.WIP2-RT-qPCR-R tcaccttcgtgatggtagtcg
[0106] Verification of the effect of Example 2:
[0107] To examine the effect of the BnaC06.WIP2 gene on leaf dehiscence-related genes, RT-qPCR primers for leaf dehiscence-related genes were designed, and the RT-qPCR primers are shown in Table 5:
[0108] Table 5. RT-qPCR primers for leaf cracking-related genes
[0109] Primer name Primer sequence (5'→3') BnaA01.TCP4-RT-qPCR-F ttcgtttgggtacgatggct BnaA01.TCP4-RT-qPCR-R caagtactggctgaaacgacg BnaA03.TCP4-RT-qPCR-F gtcgtttttcccggtggttg BnaA03.TCP4-RT-qPCR-R tccggcggatgatgatgatg BnaC03.TCP4-RT-qPCR-F gcgccggagtaatgataacga BnaC03.TCP4-RT-qPCR-R accaccgggaaaaacgactt BnaA05.BOP1-RT-qPCR-F gctctcaagtgcaccagaac BnaA05.BOP1-RT-qPCR-R caccccacaagaggtacaca BnaC02.AS2-RT-qPCR-F gcctgcaaatttctccgtcg BnaC02.AS2-RT-qPCR-R aagggtgaagctcgttgagg
[0110] (A) Observations were made on the leaves of wild-type rapeseed (denoted as Westar) and overexpression lines 35S:BnaC06.WIP2-6HA#12 and 35S:BnaC06.WIP2-6HA#13 (denoted as OE#12 and OE#13), and the results are as follows: Figure 4 As shown. By Figure 4 It can be seen that, compared with wild-type rapeseed, the leaves of rapeseed overexpressing 35S:BnaC06.WIP2-6HA contain more serrations and deeper creases.
[0111] (B) The photosynthetic efficiency of leaves of wild-type rapeseed (Westar) and overexpression lines 35S:BnaWIP2-6HA#12 and 35S:BnaWIP2-6HA#13 (denoted as OE#12 and OE#13) was measured, and the results are as follows: Figure 6 As shown. By Figure 6 To date, overexpression of the BnaC06.WIP2 gene has not affected the photosynthetic efficiency of leaves.
[0112] (C) Wild-type rapeseed leaves and transgenic rapeseed leaves were selected, and the transcriptional levels of leaf-crack-related genes were detected using RT-qPCR. The results are as follows: Figure 7 As shown. By Figure 7 It can be seen that the expression levels of the negative regulatory genes for leaf cleft formation, BnaA01.TCP4, BnaA03.TCP4, BnaC03.TCP4, BnaA05.BOP1 and BnaC02.AS2, in the OE#12 and OE#13 lines were significantly lower than those in the wild type.
[0113] (D) Seed germination experiments were conducted on wild-type and overexpressing rapeseed seeds under 120 mM sodium chloride stress. The results are as follows: Figure 8 and Figure 9 As shown. By Figure 8 and Figure 9 It can be seen that under normal conditions, there is no significant difference in the germination rate between wild-type and overexpressing rapeseed seeds; however, under 120 mM sodium chloride stress, the germination rate of BnaC06.WIP2 overexpressing rapeseed seeds is significantly higher than that of wild-type.
[0114] (E) Based on the analyses in (A), (B), (C), and (D) above, it can be concluded that overexpression of the BnaC06.WIP2 gene in Brassica napus reduces the expression levels of negative regulatory genes for leaf cleft formation, including BnaA01.TCP4, BnaA03.TCP4, BnaA03.TCP4, BnaA05.BOP1, and BnaC02.AS2, thereby promoting leaf clefting in Brassica napus without affecting photosynthetic efficiency. Furthermore, it enhances the tolerance of Brassica napus seeds to salt stress during germination. Therefore, the BnaC06.WIP2 gene has significant application potential in breeding for superior leaf shape, high-density planting tolerance, and salt tolerance.
Claims
1. A breeding method for Brassica napus, characterized in that, This method improves BnaC06.WIP2 The expression level of the gene in Brassica napus was determined to obtain Brassica napus with two traits: high leaf splitting degree and high salt tolerance. The improvement BnaC06.WIP2 The gene was expressed in Brassica napus by transforming an overexpression vector into the Brassica napus. The overexpression vector was named 35S:BnaC06.WIP2-6HA overexpression vector, and its nucleotide sequence is shown as sequence ID number 1 in the nucleotide or amino acid sequence listing.
2. The breeding method for Brassica napus as described in claim 1, characterized in that, Will BnaC06.WIP2 After the gene was overexpressed in Brassica napus, the Brassica napus in the seed germination stage was able to tolerate 120 mM sodium chloride.
3. The breeding method for Brassica napus as described in claim 1, characterized in that, The method specifically includes the following steps: Step 1, Brassica napus BnaC06.WIP2 Gene cloning: Step 1.1, BnaC06.WIP2 Design of gene-specific primers and validation primers: The specific primers and their nucleotide sequences are as follows: BnaC06.WIP2-6HA-Kpn IF: 5'-tctagaggatccccgggtaccatgactgatcctcattccaat-3'; BnaC06.WIP2-6HA-Spe IR: 5'-gtatgggtaactagaactagttttggaccgccttgactcatg-3'; The verification primers and their nucleotide sequences are: 5'-gtcactttattgtgaagatagtgg-3'; Step 1.2, RNA extraction and cDNA synthesis; Step 1.3, BnaC06.WIP2 Gene cloning; Step 2, Construction of the overexpression vector: Step 2.1, ligating the target gene fragment to the linear vector: The overexpression vector p1300-35S-6HA and the one obtained in step 1.3 were used. BnaC06.WIP2 The gene fragment was digested overnight with enzymes and purified and recovered. Then, the purified gene fragment was ligated with a vector to obtain the ligation product. Step 2.2, Conversion of the Linkage Product: The ligation product obtained in step 2.1 was transformed into competent cells, and then the competent cells containing the ligation product were plated on selection medium plates for culture. Step 2.3, Monoclonal screening and identification: Step 2.4, obtain the 35S:BnaC06.WIP2-6HA overexpression vector: The single clones screened and identified in step 2.3 were expanded and cultured, and plasmids were extracted to obtain the 35S:BnaC06.WIP2-6HA overexpression vector; Step 3: Genetic transformation, screening, and identification of Brassica napus: Step 3.1: Construct Agrobacterium containing the 35S:BnaC06.WIP2-6HA overexpression vector; Step 3.2: Transformation of Brassica napus using Agrobacterium-mediated transformation; Step 3.3, using BnaC06.WIP2 Identification of the gene using RT-qPCR primers: The aforementioned BnaC06.WIP2 The RT-qPCR primers and their nucleotide sequences for the gene are as follows: BnaC06.WIP2-RT-qPCR-F: 5'-taatcacgatgaccatgaccatga-3'; BnaC06.WIP2-RT-qPCR-R:5'-tcaccttcgtgatggtagtcg-3'.
4. The breeding method for Brassica napus as described in claim 3, characterized in that, In step 2.1, the molar ratio of gene fragment to vector during ligation is 2:1, the temperature is 37℃, and the time is 30 minutes.
5. The breeding method for Brassica napus as described in claim 3, characterized in that, In step 2.2, the specific transformation process is as follows: gently aspirate and mix, place on ice for 20 minutes, incubate in a 42°C water bath for 90 seconds, quickly place on ice for 2 minutes, add 700 µL of LB liquid medium, and incubate in a shaker at 37°C for 30 minutes to obtain competent cells containing the ligation product.
6. The breeding method for Brassica napus as described in claim 3, characterized in that, In step 2.2, the screening medium contains 50 μg·mL⁻¹ -1 LB solid medium for kanamycin.
7. The breeding method for Brassica napus as described in claim 3, characterized in that, Step 3.2 includes: Two to three days before transformation, the Agrobacterium containing the 35S:BnaC06.WIP2-6HA overexpression vector obtained in step 3.1 was activated. The activated strain was then inoculated into the Agrobacterium suspension and shaken for 30 minutes. The cultured bacterial solution was then placed in a centrifuge tube, and the OD value of the Agrobacterium was measured using a spectrophotometer. 600 The value is 0.1-0.2; rapeseed explants that have been pre-cultured for 2-3 days are placed in Agrobacterium suspension for 10 minutes for infection; the infected rapeseed explants are placed on filter paper to dry and then placed on co-culture medium; two days later, the explants are transferred to screening medium for 7 days; effective callus tissue is selected and transferred to screening medium containing hygromycin for about 15 days, and the screening is repeated 2 to 3 times; the vigorous positive callus tissue is transferred to differentiation medium and waited for it to differentiate into seedlings. The differentiated seedlings are then transferred to rooting culture for 7-10 days to root.