A probe, kit and application for detecting prmt5

By constructing a homogeneous immunoassay kit for antibody-DNA conjugate probes, and utilizing the ortho effect and chemiluminescence to detect PRMT5, the problems of complex equipment and high cost in existing technologies are solved, achieving high sensitivity and high specificity for PRMT5 detection, which is suitable for basic medicine and clinical diagnosis.

CN116660535BActive Publication Date: 2026-05-08JIANGSU LAISEN BIOTECHNOLOGY RES INST CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU LAISEN BIOTECHNOLOGY RES INST CO LTD
Filing Date
2023-05-13
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

In the existing technology, the heterogeneous chemiluminescence method for detecting PRMT5 requires complex washing steps and expensive equipment, while the homogeneous chemiluminescence method has high equipment requirements and the labeling material is not easy to obtain stably, making it difficult to achieve high sensitivity and high specificity detection.

Method used

Two antibody-DNA conjugates were used as probes to generate signals through ortho-effect hybridization. A homogeneous immunoassay kit was constructed, and the concentration of PRMT5 was detected by DNA hybridization signal. Chemiluminescence detection was performed by combining graphene oxide and acrid ester.

Benefits of technology

It achieves high sensitivity and high specificity for PRMT5 detection, simplifies the operation process, reduces costs, and is suitable for basic medical research and clinical diagnosis. The detection range is 0.10 to 100,000 pg/mL, and the detection limit is 0.08 pg/mL.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116660535B_ABST
    Figure CN116660535B_ABST
Patent Text Reader

Abstract

The application provides a probe, a kit and an application for detecting PRMT5, and belongs to the technical field of biological medicine; two antibody-DNA conjugates, DNA1-Ab1 and DNA2-Ab2, are first constructed, and the two antibody-DNA conjugates are used as probes for detecting PRMT5; the two antibody-DNA conjugates are assembled into a homogeneous immunoassay kit for detecting PRMT5; when the homogeneous immunoassay kit is used for detecting PRMT5, the DNA connected on the two PRMT5 antibody-DNA conjugates is close, a neighboring effect is generated and hybridization is generated, and then the concentration of the target protein PRMT5 is determined by detecting the signal generated by DNA hybridization; the homogeneous immunoassay kit has high sensitivity and high specificity, and has good application in the detection of PRMT5.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a probe, reagent kit, and application for detecting PRMT5. Background Technology

[0002] Chemiluminescence immunoassay combines highly sensitive chemiluminescence assays with highly specific immunoreactions to analyze various antibodies, antigens, haptens, small molecules, and drugs. Homogeneous chemiluminescence immunoassay, with its advantages of being wash-free and easily automated, along with its high specificity and sensitivity, has become a hot topic in immunoassay research in recent years.

[0003] Currently, heterogeneous chemiluminescence immunoassay is the dominant method in the domestic and international in vitro diagnostic testing field. This method relies on physical separation and typically requires lengthy and cumbersome washing steps. Therefore, the entire analytical process of heterogeneous chemiluminescence immunoassay involves many steps, large equipment, high failure rate, long detection time, complex operation, and high cost. In contrast, homogeneous chemiluminescence immunoassay eliminates the need for separation and washing steps, performing chemiluminescence detection directly under pure liquid phase conditions. It has fewer equipment modules, a low failure rate, and is simple and rapid to operate. Existing mature homogeneous chemiluminescence immunoassay technology is based on photo-induced chemiluminescence technology, and is currently mainly monopolized by two foreign companies, Siemens and PerkinElmer. However, this method requires laser excitation, has high equipment requirements, and uses special labeling materials that are not easily obtained stably.

[0004] The protein arginine methyltransferase (PRMT) family acts as post-translational modifications by methylating arginine residues. PRMT5 is a type II PRMT and is the most active of the only two PRMTs that catalyze the formation of sDMA. PRMT5 functions as a transcriptional co-repressor through histone methylation and has been shown to be crucial for RNA splicing, methylating Sm proteins to facilitate their proper assembly into small nucleoribonucleoproteins (SnRNPs). PRMT5 regulates or interferes with the expression of various oncogenic or tumor-suppressive proteins, including TP53, FOXP1, FOXP3, SLC7A11, c-Myc, BCL6, BAX, EGFR, and TDP1. PRMT5 expression is epigenetically upregulated, and increased expression is directly associated with poor prognosis in many malignancies, including lung cancer, breast cancer, hepatocellular carcinoma, and glioblastoma multiforme. Its association with lymph node metastasis has been confirmed in lung cancer, breast cancer, gastric cancer, head and neck cancer, colorectal cancer, epithelial ovarian cancer, and urothelial carcinoma of the bladder. Furthermore, PRMT5 expression has been shown to promote drug resistance. In addition, in various hematologic malignancies, PRMT5, through MYC splicing regulation, increases the expression of mutant FLT3, thereby promoting tumor progression.

[0005] Neighbor-induced DNA dynamic assembly immunoassay is an emerging homogeneous analytical method for protein detection using DNA-assisted techniques. This method is simple and rapid; it transforms protein detection into DNA detection, and combined with DNA signal amplification technology, it achieves extremely high detection sensitivity. Therefore, there is a need to develop a homogeneous immunoassay kit for detecting PRMT5 based on the neighbor effect. Summary of the Invention

[0006] To address some shortcomings in existing technologies, this invention provides a probe, kit, and application for detecting PRMT5. First, two antibody-DNA conjugates—DNA1-Ab1 and DNA2-Ab2—are constructed and used as probes for detecting PRMT5. Furthermore, the two antibody-DNA conjugates are assembled into a homogeneous immunoassay kit for detecting PRMT5. When this kit is used to detect PRMT5, the DNA molecules linked to the two PRMT5 antibody-DNA conjugates approach each other, resulting in an orthotopic effect and hybridization. The concentration of the target protein PRMT5 is then determined by detecting the signal generated by DNA hybridization. This homogeneous immunoassay kit exhibits high sensitivity and specificity, making it highly effective for detecting PRMT5.

[0007] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0008] The present invention first provides a probe for detecting PRMT5, the probe comprising a PRMT5 antibody and DNA linked to the PRMT5 antibody;

[0009] The DNA includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2:

[0010] SEQ ID NO.1:

[0011] 5′-GCTTGGTCCGTCCGGGCGAGCACCCGCGCCCCGGGTTTCAAACGGTAGGCT-SH-3′;

[0012] SEQ ID NO.2:

[0013] 5′-SH-TCAACGAACCCCCGGGAATCCAATAGCCAGCTCGGGGCCCTCACCGAGGT-3′.

[0014] When the DNA is DNA1, the probe for detecting PRMT5 is a DNA1-Ab1 conjugate (hereinafter referred to as DNA1-Ab1);

[0015] When the DNA is DNA2, the probe for detecting PRMT5 is a DNA2-Ab2 conjugate (hereinafter referred to as DNA2-Ab2).

[0016] The present invention also provides the application of the above probe in the detection of PRMT5, or in the preparation of a homogeneous immunoassay kit for the detection of PRMT5.

[0017] The present invention also provides a homogeneous immunoassay kit for detecting PRMT5, the homogeneous immunoassay kit comprising DNA1-Ab1 and DNA2-Ab2.

[0018] Preferably, the homogeneous immunoassay kit further includes DNA3 labeled with acridinium ester and graphene oxide coupled with an antioxidant (GO-AT);

[0019] The nucleotide sequence of the acridinium ester-labeled DNA3 is: 5′-SA-NH2C6-GGAATCAAGAGGGCCGGACGTTAATGAG-3′ (SEQ ID NO.3).

[0020] Preferably, the acridine ester comprises N,N'-dimethyl-9,9'-diacrylidine dinitrate.

[0021] Preferably, the antioxidant in the graphene oxide coupled antioxidant includes glutathione, benzyl aniline, or 2-hydroxybenzyl aniline.

[0022] Preferably, in the homogeneous immunoassay kit, the concentration of probe DNA1-Ab1 for detecting PRMT5 is 0.1-50 nM;

[0023] The concentration of probe DNA2-Ab2 used to detect PRMT5 is 0.1-50 nM;

[0024] The concentration of acridine ester-labeled DNA3 was 0.01–1.0 μM;

[0025] The concentration of GO-AT was 15 μg / mL.

[0026] Preferably, in the homogeneous immunoassay kit: the concentration of probe DNA1-Ab1 used to detect PRMT5 is 5 nM;

[0027] The concentration of probe DNA2-Ab2 used to detect PRMT5 was 5 nM;

[0028] The concentration of DNA3 was 0.2 μM;

[0029] The concentration of GO-AT was 15 μg / mL.

[0030] The present invention also provides a method for detecting PRMT5, wherein the detection method utilizes the probe for detecting PRMT5 described above or the homogeneous immunoassay kit for detecting PRMT5 for in vitro detection.

[0031] Preferably, the detection process is as follows:

[0032] The PRMT5 antibody on the probe used for PRMT5 detection specifically binds to the target protein PRMT5. Then, DNA1 and DNA2 exhibit an ortho-hybridization effect and hybridize with DNA3. The concentration of the target protein PRMT5 is determined by detecting the chemiluminescent signal. The detection principle of this invention is as follows:

[0033] DNA3 has six bases that are complementary to DNA1 and DNA2. In the absence of the target antigen, DNA3 adsorbs onto the GO surface via π-π stacking. The SA terminator at its ends cannot oxidize and emit light due to the presence of antioxidants on the GO. Even the small amount of chemiluminescence is quenched by chemiluminescence resonance energy transfer. In the presence of the target protein, the antibodies on the two DNA-Ab conjugates form a double-antibody sandwich, bringing DNA1 and DNA2 close enough to undergo an ortho-position effect and hybridize with DNA3. The conjugates are hardly adsorbed by GO, and the AT conjugated to graphene has almost no effect on the luminescence of the SA terminator on the conjugates.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0035] The homogeneous immunoassay kit of this invention detects PRMT5 based on the ortho-click effect and chemiluminescence. In actual detection, two PRMT5 antibodies (i.e., antibody-DNA conjugates) linked to single-stranded DNA serve as affinity probes. The antibodies specifically bind to the target protein PRMT5, and the DNA linked to the two antibodies approaches each other, resulting in an ortho-click effect and hybridization. The concentration of the target protein PRMT5 is determined by detecting the signal generated by DNA hybridization. This homogeneous immunoassay kit can be applied to basic medical research or as an immunoassay tool for detecting PRMT5 protein in clinical settings, and further applied to tumor identification and diagnosis.

[0036] The homogeneous immunoassay kit of this invention can detect proteins by directly mixing the sample and the detection solution, without the need for solid biorecognition carriers and complex washing and separation steps. It is simple to operate and low in cost. This method detects target proteins by stimulating the ortho-position effect through immunorecognition and generating a signal. By using the corresponding DNA-antibody conjugate, this method can be universally applied to the detection of a variety of proteins.

[0037] The homogeneous immunoassay kit described in this invention has high detection sensitivity, with a detection range of 0.10 to 100,000 pg / mL and a detection limit of 0.08 pg / mL. The kit is convenient to use, employing homogeneous chemiluminescence immunoassay to detect PRMT5 concentration, and can be directly used for clinical serum sample testing. Attached Figure Description

[0038] Figure 1 This is the PAGE analysis result of the DNA-antibody conjugate; in the figure, band 1 is DNA1, band 2 is Ab1, band 3 is DNA1+Ab1, and band 4 is DNA1-Ab1.

[0039] Figure 2 This is the result of Coomassie Brilliant Blue staining of DNA-antibody conjugates; in the figure, band 1 is DNA1, band 2 is Ab1, band 3 is DNA1+Ab1, and band 4 is DNA1-Ab1.

[0040] Figure 3 This is the standard curve for testing PRMT5. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0042] In the following examples, some of the materials and reagents used were sourced as follows: nucleotides DNA1, DNA2, and DNA3 were synthesized by Shanghai Sangon Biotech and purified by HPLC and conjugated with diacillin dinitrate; antibody Ab1... PRMT5 and Ab2 PRMT5 All chemicals were prepared and purified by our company. Coomassie Brilliant Blue, 3-maleimide benzoate succinimide (MBS), tris(2-carboxyethyl)phosphonic acid hydrochloride (TCEP), diacillin dinitrate, and graphene oxide were purchased from Sigma-Aldrich Chemical Company. Ultrafiltration tubes were purchased from Milpore. Common chemical reagents were purchased from Sinopharm.

[0043] Unless otherwise specified in the examples, all conditions were performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products. Unless otherwise specified, all techniques employed in this invention are prior art in the field.

[0044] The following examples involve the following nucleotide sequences:

[0045] DNA1: 5′-GCTTGGTCCGTCCGGGCGAGCACCCGCGCCCCGGGTTTCAAACGGTAGG CT-SH-3′ (SEQ ID NO. 1);

[0046] DNA2:5′-SH-TCAACGAACCCCCGGGAATCCAATAGCCAGCTCGGGGCCCTCACCGA GGT-3′(SEQID NO.2);

[0047] DNA labeled with acridinium ester: 5′-SA-NH2C6-GGAATCAAGAGGGCCGGACGTTAATGAG-3′ (SEQ ID NO. 3).

[0048] Example 1: Preparation of a probe for detecting PRMT5

[0049] Taking DNA1 as an example, a probe for detecting PRMT5 was prepared using 3-maleimide benzoate succinimide (MBS) as a bifunctional linker. The specific preparation process is as follows:

[0050] (1) 20 μL of 2 mg / mL PRMT5 antibody and 6.4 mM MBS (dissolved in DMSO) at a concentration 40 times that of the antibody were reacted in 10 mM PBS at pH 7.2 at room temperature for 2 hours. After the reaction was completed, the excess MBS was removed by centrifugation at 10,000 rpm using a 100 KD ultrafiltration tube to obtain the antibody-MBS conjugate.

[0051] (2) 24 μL of 100 μM sulfhydryl DNA1 and 150 times the amount of DNA1 TCEP were added to 10 mM PBS at pH 5.5. The reduction reaction was carried out at room temperature for 2 h. Then the excess TCEP was removed by centrifugation at 10,000 rpm using a 10 KD ultrafiltration tube to obtain the reduced sulfhydryl DNA1.

[0052] (3) Mix the reduced sulfhydryl DNA1 from step (2) with the antibody-MBS conjugate from step (1) and react at room temperature for 2 hours. Remove the unreacted sulfhydryl DNA1 by centrifugation at 10,000 rpm using a 100 KD ultrafiltration tube to obtain the purified DNA-antibody conjugate, which is the probe for detecting PRMT5. It is denoted as DNA1-Ab1 conjugate (hereinafter referred to as DNA1-Ab1) and stored in 66 μL of PBS with a pH of 7.2 and a concentration of 10 mM for later use.

[0053] In this embodiment, polyacrylamide gel electrophoresis (PAGE) and Coomassie brilliant blue staining analysis were also used to verify the formation of DNA1-Ab1. The specific steps are as follows:

[0054] A 12% polyacrylamide gel was prepared using Tris-borate-EDTA (TBE) buffer. A mixture of 3.0 μL DNA1-Ab1, 1.0 μL dye, and 1.0 μL 5× buffer was used as the sample carrier. The gel was incubated for 3 minutes before loading to ensure tight binding between the dye and DNA. The gel was then run at 100 V for 80 minutes, irradiated with UV light, and analyzed using a molecular gel imaging system. The results are shown below. Figure 1 As shown.

[0055] After the analysis, the gel was stained with a staining solution containing 0.025% (w / v) Coomassie Brilliant Blue R-250 for 1 hour, and then destained with a destaining solution containing methanol and acetic acid for 5 hours. The destained gel was photographed. The staining results are as follows. Figure 2 As shown.

[0056] Figure 1 This is the PAGE analysis result of the DNA-antibody conjugate. In the figure, band 1 is DNA1, band 2 is Ab1, band 3 is DNA1+Ab1 (ab1 and DNA1 directly mixed), and band 4 is DNA1-Ab1. As can be seen from the figure, the simple mixture of Ab1 and DNA1 (band 3) only shows a bright band in the same position as DNA1 (band 1), proving that DNA1 and Ab1 cannot connect to form a DNA1-Ab1 conjugate in the absence of the binding agent MBS. The DNA1-Ab1 band (band 4) is near the injection port; this is because the molecular weight of DNA increases significantly after being linked to the antibody, resulting in extremely slow migration.

[0057] Figure 2 This is the Coomassie Brilliant Blue staining result for DNA-antibody conjugates; in the figure, band 1 is DNA1, band 2 is Ab1, band 3 is DNA1+Ab1 (Ab1 and DNA1 directly mixed), and band 4 is DNA1-Ab1. As can be seen from the figure... Figure 1 The DNA1-Ab1 conjugate shown in the image (band 4) is related to... Figure 2 The antibody bands shown on the Coomassie Brilliant Blue stained gel were at the same location, confirming the successful synthesis of the DNA1-Ab1 conjugate. Based on the absorbance of the conjugate at 260 nm and 280 nm, it can be calculated that approximately 6.05 ± 0.14 DNA1 molecules were bound to each antibody.

[0058] DNA2-Ab2 can be obtained using the same method.

[0059] Example 2: Preparation of a homogeneous immunoassay kit for detecting PRMT5

[0060] (1) Preparation of graphene oxide (GO) coupled with antioxidant (AT):

[0061] According to existing methods, the carboxyl groups on graphene oxide are combined with the hydroxyl groups on AT via a sulfoxide condensing agent. Then, the carboxyl groups on graphene oxide are activated by 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and combined with the amino groups on AT to obtain graphene oxide coupled with AT, denoted as GO-AT, for later use.

[0062] (2) Optimization of conditions for homogeneous immunoassay kit:

[0063] The homogeneous immunoassay kit includes DNA1-Ab1, DNA2-Ab2, acridinium-labeled DNA3 (hereinafter referred to as DNA3), and GO-AT, wherein the final concentrations of DNA1-Ab1, DNA2-Ab2, DNA3, and GO-AT are 0.1-50 nM, 0.1-50 nM, 0.01-1.0 μM, and 15 μg / mL, respectively.

[0064] The reaction concentrations of DNA1-Ab1 and DNA2-Ab2 shown in Table 1 were mixed with 0.2 μM DNA3 and 15 μg / mL GO-AT to obtain homogeneous immunoassay kits containing different concentrations of DNA1-Ab1 and DNA2-Ab2. The concentrations of DNA1-Ab1 and DNA2-Ab2 were optimized by detecting PRMT5 using these homogeneous immunoassay kits. The specific steps are as follows:

[0065] Mix 50 μL of PRMT5 solution of different concentrations or clinical serum samples containing PRMT5 with 200 μL of homogeneous immunoassay kit containing DNA1-Ab1 and DNA2-Ab2 of different concentrations. Incubate the mixture at 37°C for 5-10 minutes on a Synergy H4 detector. Add the chemiluminescent substrates hydrogen peroxide and sodium hydroxide to generate a chemiluminescent signal. The detection results are shown in Table 1.

[0066] Table 1. Optimization results of DNA1-Ab1 and DNA2-Ab2 reaction concentrations

[0067] DNA1-Ab1(nM) 0.1 1 5 10 25 50 DNA2-Ab2(nM) 0.1 1 5 10 25 50 DNA3 0.2 0.2 0.2 0.2 0.2 0.2 GO-AT (μg / mL) 15 15 15 15 15 15 Standard (pg / mL) 10 10 10 10 10 10 Luminous value 83941 154678 874562 864812 871289 854121 Signal-to-noise ratio 54.2 98.3 374.5 312.1 301.4 148.7

[0068] As can be seen from Table 1, the luminescence value and signal-to-noise ratio reach their highest values ​​when the addition concentration of DNA1-Ab1 and DNA2-Ab2 is 5 nM. Therefore, the optimal detection concentration of DNA1-Ab1 and DNA2-Ab2 is 5 nM.

[0069] 5 nM DNA1-Ab1, 5 nM DNA2-Ab2, and 15 μg / mL GO-AT were mixed with DNA3 at concentrations shown in Table 2 to obtain homogeneous immunoassay kits containing different concentrations of DNA3. The concentration of DNA3 was optimized by detecting PRMT5 using these homogeneous immunoassay kits containing different concentrations of DNA3. The specific steps are as follows:

[0070] Mix 50 μL of PRMT5 solution of different concentrations or clinical serum samples containing PRMT5 with 200 μL of homogeneous immunoassay kit containing DNA3 of different concentrations, incubate at 37°C for 5-10 minutes on a Synergy H4 detector, add chemiluminescent substrates hydrogen peroxide and sodium hydroxide to generate chemiluminescent signals, and the detection results are shown in Table 2.

[0071] Table 2. Results of DNA3 reaction concentration optimization

[0072] DNA1-Ab1(nM) 5 5 5 5 5 5 DNA2-Ab2(nM) 5 5 5 5 5 5 DNA3 0.01 0.05 0.1 0.2 0.4 1 GO-AT (μg / mL) 15 15 15 15 15 15 Standard (pg / mL) 10 10 10 10 10 10 Luminous value 94571 195417 543541 864511 847854 874597 Signal-to-noise ratio 84.2 102.2 218.2 384.3 157.1 78.9

[0073] As can be seen from Table 2, the luminescence value and signal-to-noise ratio of DNA3 reach their highest values ​​when the concentration is 0.2 μM. Therefore, the optimal detection concentration of DNA3 is 0.2 μM.

[0074] In summary, the optimal final detection concentrations of each component in the homogeneous immunoassay kit of the present invention are 5 nM DNA1-Ab1, 5 nM DNA2-Ab2, 0.2 μM DNA3, and 15 μg / ml GO-AT.

[0075] Example 3: Application of homogeneous immunoassay kit in the detection of PRMT5

[0076] (1) Plotting the standard curve:

[0077] The homogeneous immunoassay kits with the optimal final detection concentration prepared in Example 2 were used to detect the chemiluminescence intensity of standards with logarithmic concentrations ranging from 0.1 to 100,000 pg / mL. The detection process was as follows:

[0078] Mix 50 μL of PRMT5 solution of different concentrations or clinical serum sample containing PRMT5 with 200 μL of homogeneous immunoassay kit, incubate at 37°C for 5-10 minutes on a Synergy H4 detector, add chemiluminescent substrates hydrogen peroxide and sodium hydroxide to generate chemiluminescent signal.

[0079] A standard curve was plotted based on the detected chemiluminescence intensity. The plotted standard curve is shown below. Figure 3 As shown. From Figure 3As can be seen, the logarithm of the chemiluminescence intensity and the standard concentration is linear in the range of 0.10 to 100,000 pg / mL, with a detection limit of 0.08 pg / mL and a correlation coefficient R. 2 =0.998.

[0080] (2) Detection of PRMT5 in complex biological environments using a homogeneous immunoassay kit:

[0081] To evaluate the ability of the homogeneous immunoassay kit prepared in this invention to accurately detect target proteins in complex biological environments, this embodiment analyzed PRMT5 in clinical serum samples and compared the results with existing ELISA kit detection methods. The results are shown in Table 3.

[0082] Table 3. Results of clinical serum sample analysis

[0083]

[0084]

[0085] Table 3 shows the results of the clinical serum sample analysis. As can be seen from Table 3, the relative deviation of the analysis results for the five serum samples was less than 9.08%, indicating that the method is accurate and reliable. Furthermore, this invention detected three samples that could not be detected by the ELISA kit, demonstrating that the homogeneous immunoassay kit prepared in this invention has excellent specificity and sensitivity.

[0086] In summary, the homogeneous immunoassay kit of this invention can detect proteins by directly mixing the sample and the detection solution, without the need for solid biorecognition carriers and complex washing and separation steps. It is simple to operate and low in cost. This method detects target proteins by stimulating the ortho-position effect through immunorecognition and generating a signal. By using appropriate DNA-antibody conjugates, this method can be universally applied to the detection of a variety of proteins.

[0087] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A homogeneous immunoassay kit for detecting PRMT5, characterized in that, The homogeneous immunoassay kit includes a probe for detecting PRMT5; the homogeneous immunoassay kit also includes DNA3 labeled with acridinium ester and graphene oxide coupled with an antioxidant (GO-AT); The probes are two antibody-DNA conjugates—DNA1-Ab1 and DNA2-Ab2; The nucleotide sequence of DNA1 is shown in SEQ ID NO.1: 5´-GCTTGGTCCGTCCGGGCGAGCACCCGCGCCCCGGGTTTCAAACGGTAGGCT-SH-3', The nucleotide sequence of the DNA2 is shown in SEQ ID NO.2: 5´-SH-TCAACGAACCCCCGGGAATCCAATAGCCAGCTCGGGGCCCTCACCGAGGT-3'; The nucleotide sequence of the acridinium ester-labeled DNA3 is shown in SEQ ID NO.3: SEQ ID NO.3: 5´-SA-NH2C6-GGAATCAAGAGGGCCGGACGTTAATGAG-3'; Acridine esters include N,N'-dimethyl-9,9'-diacrylidine dinitrate; the antioxidants in the graphene oxide coupled antioxidants include glutathione, benzyl aniline, or 2-hydroxybenzyl aniline; The homogeneous immunoassay kit contains DNA1-Ab1 and DNA2-Ab2 at concentrations of 0.1-50 nM, acridine ester-labeled DNA3 at concentrations of 0.01-1.0 μM, and GO-AT at concentrations of 15 μg / mL.

2. The homogeneous immunoassay kit according to claim 1, characterized in that, The concentrations of DNA1-Ab1 and DNA2-Ab2 in the homogeneous immunoassay kit are both 5 nM, and the concentration of DNA3 labeled with acridinium ester is 0.2 μM.

3. A method for detecting PRMT5, characterized in that, The detection method described in any one of claims 1 to 2 uses the homogeneous immunoassay kit for detecting PRMT5 for in vitro detection for non-therapeutic and diagnostic purposes.

4. The PRMT5 detection method according to claim 3, characterized in that, The detection process is as follows: The PRMT5 antibody on the probe used to detect PRMT5 specifically binds to the target protein PRMT5. Then, DNA1 and DNA2 generate an ortho-hybridize with DNA3, and the concentration of the target protein PRMT5 is determined by detecting the chemiluminescent signal.

Citation Information

Patent Citations

  • Application of PRMT5 gene serving as marker for predicting, diagnosing and treating acute myocardial infarction

    CN107058554A

  • Kit for detecting canine pancreatic lipase based on homogeneous chemiluminescence immunoassay method

    CN110836967A

  • Kit for detecting cat pancreas specific lipase by homogeneous chemiluminescence method

    CN115343466A