Use of SNP molecular marker A08-12266524 in identifying resistance to clubroot disease in chinese cabbage

By using the SNP molecular marker A08-12266524 and the detection primer set Crr5-funK3, efficient identification and breeding of clubroot resistance in Chinese cabbage were achieved, solving the problem of low screening efficiency in existing technologies and improving breeding efficiency.

CN116676414BActive Publication Date: 2025-12-19河南省农业科学院园艺研究所
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310760897.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-26
Publication Date
2025-12-19
Estimated Expiration
2043-06-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently screening SNP molecular markers associated with clubroot resistance in Chinese cabbage, resulting in low efficiency in disease-resistant breeding.

Method used

Using the SNP molecular marker A08-12266524 and its detection primer set Crr5-funK3, competitive allele-specific PCR amplification and endpoint fluorescence signal reading were used to identify and breed resistance to clubroot disease in Chinese cabbage.

Benefits of technology

This method enables rapid and accurate screening of individuals containing the clubroot resistance gene Crr5 at the molecular level, improving the efficiency of disease-resistant breeding and reducing the workload of field selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116676414B_ABST
    Figure CN116676414B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular marker assisted breeding, and relates to application of a SNP molecular marker A08-12266524 in identifying resistance to Chinese cabbage clubroot and / or breeding Chinese cabbage resistant to clubroot. The application provides application of a SNP molecular marker A08-12266524 in identifying resistance to Chinese cabbage clubroot and / or breeding Chinese cabbage resistant to clubroot, wherein the sequence of the SNP molecular marker A08-12266524 is shown as SEQ ID NO. 1, and the 70th base from the 5' end of the sequence shown as SEQ ID NO. 1 is a SNP site, and the base is A or G. The SNP molecular marker A08-12266524 can identify Chinese cabbage resistant to clubroot, and is used for screening and breeding Chinese cabbage resistant to clubroot.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular marker assisted breeding, and particularly relates to application of a SNP molecular marker A08-12266524 in identifying resistance to clubroot of Chinese cabbage and / or breeding of Chinese cabbage resistant to clubroot. BACKGROUND

[0002] Clubroot, also known as "root cancer", is a worldwide soil-borne disease caused by Plasmodiophora brassicae Woron. infection, and mainly infects Brassica chinensis, Brassica parachinensis, Brassica oleracea, radish, cauliflower, mustard, rape, etc. After infection of the Plasmodiophora brassicae, abnormal cell proliferation occurs in the root, forming a tumor, thereby affecting the transportation of water and nutrients, causing the aboveground part of the plant to lack nutrients and wither, and even leading to the death of the whole plant. Breeding of disease-resistant varieties using the clubroot resistance gene has the characteristics of safety, high efficiency and economy, and is one of the important ways to fundamentally solve the problem of clubroot. By finding molecular markers closely linked to the clubroot resistance gene, the efficiency of disease-resistant breeding can be greatly improved through marker-assisted selection. Therefore, screening more SNPs related to the clubroot resistance gene of Chinese cabbage and applying them to the selection of disease-resistant materials and the breeding of disease-resistant varieties are of great significance in improving the yield and quality of Chinese cabbage. SUMMARY

[0003] The application aims to provide application of a SNP molecular marker A08-12266524 in identifying resistance to clubroot of Chinese cabbage and / or breeding of Chinese cabbage resistant to clubroot. The SNP molecular marker A08-12266524 can be used to identify Chinese cabbage resistant to clubroot and to screen Chinese cabbage resistant to clubroot.

[0004] The application provides application of a SNP molecular marker A08-12266524 in identifying resistance to clubroot of Chinese cabbage and / or breeding of Chinese cabbage resistant to clubroot, wherein the sequence of the SNP molecular marker A08-12266524 is shown as SEQ ID NO. 1, and the 70th base from the 5' end of the sequence shown as SEQ ID NO. 1 is a SNP site, and the base is A or G.

[0005] The application further provides a reagent for detecting the SNP molecular marker A08-12266524 in the application.

[0006] Preferably, the reagent comprises a primer set Crr5-funK3, the primer set Crr5-funK3 comprising Crr5-funK3Ra, Crr5-funK3Rb and Crr5-funK3F; the nucleotide sequence of Crr5-funK3Ra is shown as SEQ ID NO. 2; the nucleotide sequence of Crr5-funK3Rb is shown as SEQ ID NO. 3; and the nucleotide sequence of Crr5-funK3F is shown as SEQ ID NO. 4.

[0007] Preferably, Crr5-funK3Ra and Crr5-funK3Rb are respectively labeled with different color fluorescent groups.

[0008] Preferably, the fluorescent group comprises FAM and HEX.

[0009] The application also provides a kit for detecting the SNP molecular marker A08-12266524 in the application, comprising the reagent and the reaction solution.

[0010] The application also provides the application of the reagent or the kit in identifying resistance to clubroot of Chinese cabbage and / or breeding of clubroot-resistant Chinese cabbage.

[0011] The application also provides a method for identifying resistance to clubroot of Chinese cabbage, comprising the following steps:

[0012] The genomic DNA of Chinese cabbage is subjected to competitive allele-specific PCR amplification by using the reagent or the kit, and finally the KASP amplification product is subjected to end-point fluorescence signal reading to obtain the genotyping result; when the genotype is AA or AG, the Chinese cabbage is identified as clubroot-resistant Chinese cabbage; and when the genotype is GG, the Chinese cabbage is identified as clubroot-susceptible Chinese cabbage.

[0013] Preferably, the reaction system of the PCR amplification is 8 μL, comprising 1.5 μL of genomic DNA, 4 μL of KASP Mastermix (2x), 0.14 μL of primer set Crr5-funK3 and the balance of water.

[0014] Preferably, the reaction procedure of the PCR amplification comprises: 94℃ 15min; 94℃ 20s, 61℃ 60s, a total of 10 cycles, from the second cycle, each cycle is reduced by 0.6℃; 94℃ 20s, 55℃ 60s, a total of 26 cycles; 37℃ 1min.

[0015] The application provides application of a SNP molecular marker A08-12266524 in identifying resistance to clubroot of Chinese cabbage and / or breeding of Chinese cabbage resistant to clubroot. The SNP molecular marker A08-12266524 can realize identification of Chinese cabbage resistant to clubroot and is used for screening and breeding of Chinese cabbage resistant to clubroot. Specifically, detection of the reagent for detecting the SNP molecular marker A08-12266524 can realize identification of Chinese cabbage resistant to clubroot and susceptible to clubroot, and can rapidly screen individuals containing the clubroot-resistant gene Crr5 in a Chinese cabbage offspring population at a molecular level, has high accuracy and can greatly improve the efficiency of disease-resistant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present application or in the prior art, the drawings needed to be used in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0017] Figure 1 A KASP gene typing result map of a F2 population using the marker Crr5-funK3 is provided for the present application.

[0018] Figure 2 A KASP gene typing result map of a natural population using the marker Crr5-funK3 is provided for the present application. DETAILED DESCRIPTION

[0019] This invention provides the application of the SNP molecular marker A08-12266524 in identifying clubroot resistance in Chinese cabbage and / or in breeding resistant Chinese cabbage. The sequence of the SNP molecular marker A08-12266524 is shown in SEQ ID NO.1 (TAACACACATACTGCAAAATGCGAAATGTTTCTTCAGTTTCCATCAACATGAGAGAGCTAAGCTTTCTARAGGACGTAGCCCGCATTCTTTAATCTCCCCGTTTTTTTTTTCGAACCTGAACTCAAAGACTAATTCGGG, R = A / G). The 70th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP site, and its base is A or G. The SNP molecular marker A08-12266524 of this invention is the SNP molecular marker of the clubroot resistance-related gene Crr5 in Chinese cabbage. This invention discloses for the first time the SNP molecular marker A08-12266524 associated with the clubroot resistance gene Crr5 in Chinese cabbage. Using reagents to detect the SNP molecular marker A08-12266524, it is possible to distinguish between clubroot-resistant and clubroot-susceptible Chinese cabbage materials. This allows for rapid screening at the molecular level of individuals in the Chinese cabbage progeny population containing the clubroot resistance gene Crr5, with high accuracy, significantly improving the efficiency of disease-resistant breeding.

[0020] This invention also provides a reagent for detecting the SNP molecular marker A08-12266524 in the application described in the above technical solution. In this invention, the primers preferably include KASP (Kompetitive Allele Specific PCR) primers. In this invention, the reagent preferably includes primer set Crr5-funK3, wherein primer set Crr5-funK3 includes Crr5-funK3Ra, Crr5-funK3Rb, and Crr5-funK3F; the nucleotide sequence of Crr5-funK3Ra is shown in SEQ ID NO.2 (5'-). GAAGGTGACCAAGTTCATGCT AGAATGCGGGCTACGTCCTT-3'; The nucleotide sequence of the Crr5-funK3Rb is shown in SEQ ID NO.3 5'- GAAGGTCGGAGTCAACGGATTGAATGCGGACTACGTCCTC-3'; the nucleotide sequence of the Crr5-funK3F is shown as SEQ ID NO. 4: 5'-CATCAACATGAGAGAGCTAAGC-3'. In the present application, the Crr5-funK3Ra and Crr5-funK3Rb preferably label different colors of fluorescent groups. In the present application, the fluorescent groups preferably include FAM and HEX. In the present application, the Crr5-funK3Ra preferably labels FAM, and the Crr5-funK3Rb preferably labels HEX. The present application discloses for the first time the detection primer group Crr5-funK3 of the SNP molecular marker A08-12266524 related to the Chinese cabbage resistance to clubroot, which comprises three primers. By performing PCR amplification on the DNA of the DH lines of the resistant and susceptible Chinese cabbage and the segregation population of the F2 generation produced after hybridization of the two, and using the KASP gene analysis system for detection, it is found that Crr5-funK3 can obviously distinguish the resistant and susceptible materials to clubroot, and rapidly screen the individuals containing the Crr5 gene resistant to clubroot in the Chinese cabbage offspring population at the molecular level.

[0021] The present application also provides a kit for detecting the SNP molecular marker A08-12266524 in the application of the above technical solution, which comprises the reagent and the reaction solution of the above technical solution. In the present application, the reaction solution preferably comprises KASP Mastermix (2x).

[0022] The present application also provides the application of the reagent or the kit of the above technical solution in identifying the resistance of Chinese cabbage to clubroot and / or breeding of the Chinese cabbage resistant to clubroot.

[0023] The present application also provides a method for identifying the resistance of Chinese cabbage to clubroot, comprising the following steps:

[0024] The genomic DNA of Chinese cabbage is subjected to competitive allele-specific PCR amplification by using the reagent or the kit of the above technical solution, and finally the KASP amplification product is subjected to end-point fluorescence signal reading to obtain the genotyping result. When the genotype is AA or AG, the Chinese cabbage is identified as the Chinese cabbage resistant to clubroot, and when the genotype is GG, the Chinese cabbage is identified as the Chinese cabbage susceptible to clubroot.

[0025] In the present application, the reaction system of the PCR amplification is 8 μL, preferably including 1.5 μL of genomic DNA, 4 μL of 2xKASP Mastermix, 0.14 μL of primer group Crr5-funK3, and the rest of water. In the present application, the concentration of each primer in the primer group Crr5-funK3 is preferably 100 μmol / L. In the present application, the mixed volume ratio of Crr5-funK3Ra, Crr5-funK3Rb, and Crr5-funK3F, and ddH2O in the primer group Crr5-funK3 is preferably 12:12:30:46. The present application does not have special limitations on the method for extracting the genomic DNA of Brassica rapa, and a conventional genomic DNA extraction method known to those skilled in the art can be used. In the present application, the reaction program of the PCR amplification preferably includes: 94℃ for 15 min; 94℃ for 20 s, 61℃ for 60 s, for a total of 10 cycles, starting from the second cycle, reducing 0.6℃ for each cycle; 94℃ for 20 s, 55℃ for 60 s, for a total of 26 cycles; 37℃ for 1 min.

[0026] After obtaining the KASP amplification product, the present application performs end-point fluorescence signal reading to obtain the genotyping result: when the genotype is AA or AG, the Brassica rapa is identified as a resistant Brassica rapa to the clubroot disease, and when the genotype is GG, the Brassica rapa is identified as a susceptible Brassica rapa to the clubroot disease.

[0027] In the present application, the end-point fluorescence signal reading is preferably performed by using the Roche fluorescence quantitative PCR instrument LightCycler480 Instrument II (LC480II). The SNP genotyping result is analyzed by using LC480 software v1.5.1: the signal point of the homozygous resistant material is blue, the primer with the 5' end connected to the FAM fluorescent tag sequence competes for amplification, and is aggregated near the X axis; the signal point of the homozygous susceptible material is green, the primer with the 5' end connected to the HEX fluorescent tag sequence competes for amplification, and is aggregated near the Y axis; the signal point of the heterozygous resistant material is red, and is aggregated near the diagonal line.

[0028] In order to further illustrate the present application, the application of the SNP molecular marker A08-12266524 provided by the present application in identifying the resistance of Brassica rapa to the clubroot disease and / or breeding a resistant Brassica rapa to the clubroot disease is described in detail below in combination with the drawings and examples, but they should not be understood as limiting the protection scope of the present application.

[0029] Example 1

[0030] 1.1 Test materials and disease resistance investigation

[0031] The disease-resistant DH line material 1EDHR1 (P1) and the disease-susceptible material 1EDHS1 (P2) of Brassica rapa were selected as parents (Yang Shuangjuan et al. Mapping of the Root Knot Resistance Gene BraA.Pb.8.4 and Development of KASP Markers in Brassica rapa. Acta Horticulturae Sinica, 2021, 48(7): 1317-1328. The biological material is available to the public from the applicant, which is only used for repeating the relevant experiments of the present application and cannot be used for other purposes). The F1 seeds were obtained by performing forward and reverse crosses on the two materials, and the F2 seeds were obtained by selfing the F1 materials. P1, P2, F1 and F2 were inoculated and identified at the seedling stage, and the source of the fungus was Xinye Xinjiang XY-2 in Henan. According to the Williams system identification system, it is physiological race No. 4, and according to the ECD identification system, it is ECD21 / 31 / 31 race (Yuxiang Yuan, Yanyan Zhao, Xiaochun Wei et al. 2017. Identification of Root Knot Nematode in Brassica rapa in Henan Province. Henan Agricultural Science, 46(7): 71-76). After 6 weeks of inoculation, the disease levels of each single plant were investigated, and the disease levels were divided into 0, 1, 3, 5 and 7 levels. The specific investigation method is referred to Zhao Yanyan et al. (Zhao Yanyan, Wu-sheng Jiang, Yuan Yuxiang et al. Comparison of Artificial Inoculation Methods and Conditions of Root Knot Nematode in Brassica rapa and Resistance Identification of Different Varieties. Acta Horticulturae Sinica, 2014, 41(S1): 2675).

[0032] The disease-resistant identification results showed that the disease levels of 10 plants of the disease-resistant parent 1EDHR1 (P1) were all 0, the disease levels of 10 plants of 1EDHS1 (P2) were all 7, and the disease levels of 10 plants of F1 materials were 0 (Table 1). In the F2 population, 159 plants were 0, 156 plants were 1, 9 plants were 3, 15 plants were 5, and 96 plants were 7. The 0 and 1 levels were classified as disease-resistant types, and the 3, 5 and 7 levels were classified as disease-susceptible types. In the F2 population, there were 315 disease-resistant single plants and 120 disease-susceptible single plants, which met the 3:1 segregation ratio by chi-square test (Table 1), indicating that the disease-resistant gene carried by 1EDHR1 (P1) was controlled by one pair of dominant nuclear genes, and the disease-resistant to disease-susceptible was dominant.

[0033] Table 1. Segregation of disease-resistant and disease-susceptible plants of Brassica rapa parents and their offspring

[0034]

[0035] 1.2 Extraction of genomic DNA

[0036] The genomic DNA of the two parents, F1 and F2 single plants was extracted by the improved CTAB method. The specific steps are as follows.

[0037] Take fresh leaves into 2.0 mL Eppendorf centrifuge tubes, add one steel ball (5 mm in diameter) to each tube, then add 1000 μL of 2% CTAB extraction buffer, and disrupt the tissue at a frequency of 30 times / second for 1 min using a tissue homogenizer (model: Retsch MM400, Germany). Incubate at 65℃ for 1 hour. After cooling, add 500 μL of 24:1 chloroform / isoamyl alcohol extraction buffer, shake up and down 30 times, allow to stand for layering, centrifuge (12000 r / min) for 10 min, and transfer 400 μL of supernatant to a new 1.5 mL centrifuge tube. Then add 400 μL of isopropanol to precipitate the DNA, mix well, centrifuge (12000 r / min) for 5 min, discard the supernatant, then add 750 μL of 70% ethanol to wash the DNA precipitate, centrifuge (12000 r / min) for 2 min, discard the supernatant, air dry the DNA at room temperature, add 100 μL of ddH2O to dissolve the DNA, and store at -20℃ for later use.

[0038] 1.3 Discovery and Detection of Crr5 Linked SNP Markers for Clubroot Disease Gene and Development of Primer Set Crr5-funK3

[0039] Candidate genes for the clubroot resistance gene Crr5 in Chinese cabbage were identified using gene mapping methods. Sequencing and sequence alignment of the candidate genes revealed an SNP variant A / G at position 12266524 bp on chromosome A08 (Brapa_Chiifu_V3.0 reference gene). As shown in the figure below, at position 70 bp, the base is A in the resistant material and G in the susceptible material. This variant is referred to as SNP marker A08-12266524.

[0040] TAACACACATACTGCAAAATGCGAAATGTTTCTCAGTTTCCATCAACATGAGAGAGCTAAGCTTTCTA[A / G]AGGACGTAGCCCGCATTCTTTAATCTCCCCGTTTTTTTTTTCGAACCTGAACTCAAAGACTAATTCGGG (SEQ ID NO. 1).

[0041] The KASP marker Crr5-funK3 was designed for this SNP marker A08-12266524, consisting of three primers:

[0042] Crr5-funK3Ra:5'- GAAGGTGACCAAGTTCATGCT AGAATGCGGGCTACGTCCTT-3'(SEQ IDNO.2);

[0043] Crr5-funK3Rb:5'- GAAGGTCGGAGTCAACGGATTGAATGCGGACTACGTCCTC-3' (SEQ ID NO. 3);

[0044] Crr5-funK3F: 5'-CATCAACATGAGAGAGCTAAGC-3' (SEQ ID NO. 4).

[0045] Crr5-funK3Ra and Crr5-funK3Rb are two allele-specific reverse primers, Crr5-funK3Ra is the specific primer for the resistant genotype, and the FAM fluorescent sequence tag sequence (underlined part) is added to the 5' end, Crr5-funK3Rb is the specific primer for the susceptible genotype, and the HEX fluorescent sequence tag sequence (underlined part) is added to the 5' end. Crr5-funK3F is a common forward primer.

[0046] The KASP-PCR reaction was carried out on a 96-well PCR instrument, and the reaction system was 8 μL: 1.5 μL DNA (80 ng / μL), 4 μL KASP Mastermix (2x), 0.14 μL primer mixture (mixed by Crr5-funK3Ra, Crr5-funK3Rb, Crr5-funK3F and ddH2O with a volume ratio of 12:12:30:46 at a concentration of 100 μmol / L), and the rest was filled with ddH2O.

[0047] The KASP-PCR amplification program is as follows: the first stage is denaturation at 94°C for 15 min; the second stage is denaturation at 94°C for 20 s, annealing at 61°C for 60 s, a total of 10 cycles (from the second cycle, each cycle is reduced by 0.6°C); the third stage is denaturation at 94°C for 20 s, annealing at 55°C for 60 s, a total of 26 cycles; the fourth stage is 37°C for 1 min.

[0048] The KASP-PCR amplification product was read by endpoint fluorescence signal reading using Roche fluorescent quantitative PCR instrument LightCycler 480 Instrument II (LC480II). The SNP genotyping results were analyzed by LC480 software v1.5.1: the signal point of homozygous resistant material is blue, the primer with FAM fluorescent tag sequence at the 5' end competes for amplification, and is aggregated near the X axis, and the genotype is AA; the signal point of homozygous susceptible material is green, the primer with HEX fluorescent tag sequence at the 5' end competes for amplification, and is aggregated near the Y axis, and the genotype is GG; the signal point of heterozygous resistant material is red, and the genotype is AG, which is aggregated near the diagonal line. Figure 1, the KASP genotyping of F2 population with marker Crr5-funK3 is shown in the result figure). The Crr5-funK3 marker can significantly distinguish two homozygous genotypes, and can identify the heterozygous genotype, has the characteristics of codominant marker, and the marker development is successful.

[0049] The 86 single plants of the F2 population are genotyped by using the Crr5-funK3 marker, the homozygous resistant genotype is marked as a, the homozygous susceptible genotype is marked as b, and the heterozygous type is marked as h. The results show that the single plants with genotype a are 18, and the disease level is 0; the single plants with genotype h are 21, and the disease level is 0; the single plants with genotype b are 47, and the disease level is 7 Figure 1 ) The genotype and phenotype consistency rate of the marker Crr5-funK3 in the 86 F2 single plants reaches 100%. The Crr5-funK3 marker can be used for the molecular assisted breeding of Chinese cabbage varieties resistant to clubroot.

[0050] 1.4 Application of SNP marker detection primer

[0051] The CTAB method is used for extracting leaf DNA. 47 DH line materials such as Y636-9, Y663-8, Y623-1 and Y578-2 are selected. The KASP marker Crr5-funK3 is used for verification in 47 DH populations, and 1EDHR1 is used as a disease-resistant control. The results show that the 47 disease-susceptible DH line materials are all aggregated near the Y axis, showing a disease-susceptible genotype, and 1EDHR1 is aggregated near the X axis as a disease-resistant material. The genotype and phenotype consistency rate of the marker Crr5-funK3 in the 48 DH line materials reaches 100%. The marker Crr5-funK3 has good universality and accuracy, and can be used for molecular marker assisted selection of Chinese cabbage clubroot materials.

[0052] Conclusion: The application discloses an SNP marker A08-12266524 related to a Chinese cabbage clubroot disease-resistant gene Crr5, and discloses a detection primer group Crr5-funK3 for detecting the marker. The SNP marker and the detection primer group Crr5-funK3 can accurately and efficiently detect disease-resistant and disease-susceptible materials. The screening method is not affected by environmental factors, can greatly reduce the workload of field selection, and is helpful for assisting and accelerating Chinese cabbage disease-resistant breeding.

[0053] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiment of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. Use of SNP molecular marker A08-12266524 in identifying resistance to clubroot and / or breeding of Chinese cabbage resistant to clubroot, wherein the sequence of the SNP molecular marker A08-12266524 is shown as SEQ ID NO. 1, and the 70th base from the 5' end of the sequence shown in SEQ ID NO. 1 is a SNP site, and the base is A or G.

2. Use of reagent for detecting SNP molecular marker A08-12266524 or kit for detecting SNP molecular marker A08-12266524 in the use of claim 1 in identifying resistance to clubroot and / or breeding of Chinese cabbage resistant to clubroot.

3. Use according to claim 2, characterized in that, The reagent comprises primer set Crr5-funK3, wherein the primer set Crr5-funK3 comprises Crr5-funK3Ra, Crr5-funK3Rb and Crr5-funK3F; the nucleotide sequence of Crr5-funK3Ra is shown as SEQ ID NO. 2; the nucleotide sequence of Crr5-funK3Rb is shown as SEQ ID NO. 3; and the nucleotide sequence of Crr5-funK3F is shown as SEQ ID NO.

4.

4. Use according to claim 3, characterized in that, The Crr5-funK3Ra and Crr5-funK3Rb are respectively labeled with different colored fluorescent groups.

5. Use according to claim 4, characterized in that, The fluorescent groups comprise FAM and HEX.

6. A method for identifying resistance to clubroot disease in Brassica rapa, characterized by, The method comprises the following steps: Competitive allele-specific PCR amplification of genomic DNA of Chinese cabbage using the reagent for detecting SNP molecular marker A08-12266524 or the kit for detecting SNP molecular marker A08-12266524 in the use of claim 1, and finally reading the KASP amplification product by end-point fluorescence signal reading to obtain genotyping results, wherein when the genotype is AA or AG, the Chinese cabbage is identified as Chinese cabbage resistant to clubroot, and when the genotype is GG, the Chinese cabbage is identified as Chinese cabbage susceptible to clubroot.

7. The method of claim 6, wherein, The reaction system of the PCR amplification is 8 μL, comprising 1.5 μL of genomic DNA, 4 μL of 2x KASP Master mix, 0.14 μL of primer set Crr5-funK3, and the balance of water.

8. The method of claim 6, wherein, The reaction program of the PCR amplification comprises: 94℃ 15min; 94℃ 20s, 61℃ 60s, a total of 10 cycles, and from the second cycle, each cycle is reduced by 0.6℃; 94℃ 20s, 55℃ 60s, a total of 26 cycles; 37℃ 1min.