TPPP3 interfering RNA and its application

Abstract

The present invention discloses an interfering RNA of TPPP3 and its application, belonging to the field of biomedicine preparation technology. The present invention discloses the application of a preparation for inhibiting TPPP3 in the preparation of a drug for treating type I hypersensitivity reaction, the preparation comprising an siRNA that interferes with the expression of TPPP3, and the nucleotide sequence of the siRNA is as shown in SEQ ID NO: 5-6. The present invention knocks down the TPPP3 gene by RNAi technology, and finds that downregulating the expression of the TPPP3 gene can significantly inhibit IgE-mediated mast cell degranulation, and reduces the activity of upstream signal molecules of the FcεRI signaling pathway to regulate type I hypersensitivity reaction, providing an experimental basis and scientific basis for revealing the pathogenesis of type I hypersensitivity reaction and in-depth research on the role of TPPP3 in type I hypersensitivity reaction.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine preparation, and in particular to TPPP3 interfering RNA and applications thereof. Background Art

[0002] Hypersensitivity disorders are a group of conditions mediated by a combination of innate and adaptive immune responses and epithelial cells. The immune system plays a vital role in maintaining health and protecting the body from invading microorganisms. However, this same system can lead to excessive immune and inflammatory responses, resulting in adverse consequences known as hypersensitivity reactions. Hypersensitivity is an exaggerated immune response to allergens and is divided into four major types: type I, type II, type III, and type IV. Type I, II, and III reactions are the result of antibody action, while type IV reactions involve T cell lymphocytes and cell-mediated immune responses. In short, hypersensitivity is a general term, while the term "anaphylaxis" is primarily defined within the scope of type I hypersensitivity reactions mediated by immunoglobulin E (IgE).

[0003] The incidence of type I hypersensitivity disorders (T1Hs) is increasing annually, placing a significant socioeconomic burden. Factors including pollution, climate change, biodiversity loss, urbanization, and changes in lifestyle and dietary habits are believed to be contributing to the significant increase in T1Hs. However, current treatment for T1Hs remains limited to symptom control, with no definitive cure, making radical cure extremely difficult. T1Hs are initiated by exposure to an antigen. The response to an antigen occurs in two phases: the sensitization phase and the effector phase. During the sensitization phase, antigen-presenting cells (APCs) deliver the allergen (or antigen) to T cells. T cells initiate signals, stimulating B cells to produce IgE, an antibody that binds to Fc receptors on mast cells and basophils. Subsequently, free antigen-bound IgE antibodies undergo cross-linking on mast cells, ultimately leading to mast cell degranulation and the release of histamine (HA), proteolytic enzymes, and other mediators (e.g., prostaglandins, cytokines, leukotrienes, platelet-activating factor, macrophage inflammatory proteins, and tryptase). The result is increased vascular permeability, peripheral vasodilation, smooth muscle contraction, and individuals may experience itching and local asthmatic reactions or systemic hypersensitivity reactions. Throughout this process, mast cells have been shown to play a key role.

[0004] Mast cells are the primary responders to type I hypersensitivity reactions. The release of allergic mediators through mast cell degranulation, triggered by IgE / FcεRI signaling, is a key component of the disease. This process requires sophisticated signaling coordination between cytoskeletal reorganization and membrane fusion mechanisms to achieve lipid bilayer mixing, leading to the release of inflammatory mediators. Although proximal signaling downstream of mast cell FcεRI has been extensively studied in recent years, its regulation of granule secretion and microtubule transport mechanisms remains unclear.

[0005] Tubulin polymerization promoting protein 3 (TPPP3), a member of the TPPP family, can induce tubulin polymerization and microtubule bundling, and belongs to the group of microtubule-associated proteins (MAPs). Vincze et al. first reported that TPPP3, a member of the TPPP family, can attach to microtubules and induce microtubule bundling activity. Currently, the family is known to include three members: the first discovered TPPP / p25, and two others that share 60% homology, TPPP2 / p18 and TPPP3 / p20. Currently, research on TPPP1 is predominant, focusing on diseases related to the nervous system, such as neurodegenerative diseases and multiple system atrophy; relatively little research has been conducted on TPPP3 and TPPP2.

[0006] TPPP3 promotes tubulin polymerization and assembly, participating in intracellular cargo transport and various physiological functions, including tumorigenesis, motor neuron disease, musculoskeletal development, and embryonic development. TPPP3 exhibits distinct biological functions in different genetic backgrounds and under different physiological conditions. To date, no studies have identified TPPP3 regulation of type I hypersensitivity reactions. Summary of the Invention

[0007] The purpose of the present invention is to provide an interfering RNA of TPPP3 and its application to solve the problems existing in the above-mentioned prior art. The present invention knocks down the TPPP3 gene through RNAi technology, and finds that downregulating TPPP3 gene expression can significantly inhibit IgE-mediated mast cell degranulation and reduce the activity of upstream signaling molecules in the FcεRI signaling pathway to regulate type I hypersensitivity reaction.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides an application of a preparation for inhibiting tubulin polymerization-promoting protein 3 in preparing a drug for treating type I hypersensitivity reaction. The preparation comprises siRNA that interferes with the expression of a gene encoding tubulin polymerization-promoting protein 3.

[0010] Furthermore, the nucleotide sequence of the siRNA is shown in SEQ ID NO: 5-6.

[0011] Furthermore, the siRNA plays a role in treating type I hypersensitivity reaction by improving the morphological changes of mast cell degranulation, reducing cell apoptosis, reducing the release of histamine and β-hexosaminidase in cells, and regulating signal pathways.

[0012] Furthermore, the signaling pathway includes Lyn / Fyn, PI3K / AKT and NF-κB.

[0013] Furthermore, the type I hypersensitivity reaction includes an IgE-mediated type I hypersensitivity reaction.

[0014] The present invention also provides a drug for preventing and treating type I hypersensitivity reaction, comprising siRNA that interferes with the expression of a gene encoding tubulin polymerization-promoting protein 3.

[0015] Furthermore, the nucleotide sequence of the siRNA is shown in SEQ ID NO: 5-6.

[0016] Furthermore, the dosage form of the drug is tablets, capsules, granules, injections or sprays.

[0017] Furthermore, the drug is taken orally or parenterally.

[0018] The present invention also provides an interfering RNA of a gene encoding a microtubule polymerization-promoting protein 3, wherein the interfering RNA has a nucleotide sequence as shown in SEQ ID NO: 5-6.

[0019] The present invention discloses the following technical effects:

[0020] The present invention used siRNA to knock down the TPPP3 gene. Neutral red staining was used to observe cell morphology, AO / EB staining was used to detect cell apoptosis, ELISA was used to detect histamine (HA), and chromogenic assays were used to detect β-hexosaminidase (β-HEX) release. The results showed that silencing TPPP3 improved morphological changes in RBL-2H3 cells during degranulation, reduced cell apoptosis, and decreased the release of HA and β-HEX. Immunofluorescence results showed that silencing TPPP3 inhibited the aggregation of microtubules during cell degranulation. Western Blot results showed that silencing TPPP3 could regulate type I hypersensitivity reactions by regulating the Lyn / Fyn, PI3K / AKT, and NF-κB signaling pathways upstream and downstream of IgE / FcεRI.

[0021] The present invention analyzes the regulatory role and possible mechanism of action of TPPP3 in type I hypersensitivity reaction in vitro, providing an experimental basis and scientific basis for revealing the pathogenesis of type I hypersensitivity reaction and in-depth research on the role of TPPP3 in type I hypersensitivity reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 The image shows the cell transfection effect observed by fluorescence microscopy (bar = 100 μm); from left to right are bright field imaging and fluorescence imaging;

[0024] Figure 2 This is the result of RNA gel electrophoresis;

[0025] Figure 3 TPPP3 gene expression results of each group;

[0026] Figure 4 TPPP3 protein expression results (n=3); (a) Western Blot results; (b) grayscale analysis results;

[0027] Figure 5 Neutral red staining results showing the effect of TPPP3 knockdown on RBL-2H3 cell morphology (bar = 100 μm);

[0028] Figure 6 To investigate the effect of TPPP3 knockdown on IgE-induced β-Hex release in RBL-2H3 cells (n=3);

[0029] Figure 7 To show the effect of TPPP3 knockdown on IgE-induced HA release from RBL-2H3 cells (n=3);

[0030] Figure 8 The effect of TPPP3 knockdown on IgE-induced apoptosis in RBL-2H3 cells (n=3) (bar=100 μm);

[0031] Figure 9 Statistics of the apoptosis rate of RBL-2H3 cells induced by IgE by knocking down TPPP3 (n=3);

[0032] Figure 10Western Blot and grayscale analysis results of the effects of TPPP3 knockdown on key signaling protein expression. The Western Blot results are from left to right for the expression of p-Lyn / Lyn, p-Syk / Syk, p-ERK1 / 2 / ERK1 / 2, p-p65 / p65, and p-AKT / AKT proteins in each group. The first row of grayscale analysis results are from left to right for p-Lyn / Lyn, p-ERK1 / 2 / ERK1 / 2, and p-AKT / AKT, and the second row are from left to right for the expression of p-Syk / Syk and p-p65 / p65 proteins. Do these need to be described separately because they are clearly marked with letters in the picture, and the WB results of each protein are not from left to right. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Example 1 Effect of Inhibiting TPPP3 Expression on Degranulation of RBL-2H3 Cells

[0039] 1 Experimental Materials

[0040] The TPPP3 gene knockdown sequences siRNA-608, siRNA-108, siRNA-419, and NegativeControl (NC) were designed and synthesized by GenePharma Technology Co., Ltd. (the sequences of each si-RNA chain (5'-3') are as follows). RBL-2H3 cells were obtained from the Cell Bank of the Chinese Academy of Sciences in Shanghai.

[0041] siRNA-608:

[0042] F: GACACUAUGACGCCAAGGUTT (SEQ ID NO: 1), R: ACCUUGGCGUCAUAGGUGCTT (SEQ ID NO: 2);

[0043] siRNA-108:

[0044] F: GGCAGCAAGCACUGACAUATT (SEQ ID NO: 3), R: UAUGUCAGUGCUUGCUGCCTT (SEQ ID NO: 4);

[0045] siRNA-419:

[0046] F: GCAAGGAACCAGCCAACAUTT (SEQ ID NO: 5), R: AUGUUGGCUGGUUCCUUGCTT (SEQ ID NO: 6);

[0047] Negativecontrol:

[0048] F: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 7), R: ACGUGACACGUUCGGAGAATT (SEQ ID NO: 8).

[0049] 2 Experimental methods

[0050] 2.1 siRNA chain screening

[0051] 2.1.1 TPPP3-siRNA transfection

[0052] RBL-2H3 cells were seeded into six-well plates at 3×10 5Cells were divided into knockdown groups (transfected with siRNA-608, siRNA-108, siRNA-419, and siRNA-FAM, respectively) using TPPP3-siRNA at a final concentration of 80 nM; negative control group (NC group): transfected with negative control siRNA; and blank control group (Control group): cells not subjected to any transfection treatment. Three replicate wells were set up for each well. Transfection was performed when the cell growth density reached 80%. The specific steps are as follows:

[0053] (1) Before transfection, equilibrate the GP-transfect-Mate transfection reagent to room temperature.

[0054] (2) According to the experimental group, refer to the dosage of GP-transfect-Mate transfection reagent instructions, dilute the transfection reagent and siRNA with culture medium, mix well, and let it stand for 15 minutes.

[0055] (3) During transfection, change the medium in the 6-well plate, then add the transfection complex and shake gently to mix.

[0056] (4) Place the cells in an incubator and culture them. After 6 hours, replace the culture medium with complete medium. Observe the intracellular fluorescence for 24 hours to verify whether the siRNA has been transfected into the cells.

[0057] 2.1.2 RT-qPCR detection of TPPP3 expression

[0058] (1) Extraction of total RNA and reverse transcription

[0059] The cells transfected for 36 h in 2.1.1 were collected and RNA was extracted using a cell tissue RNA extraction kit (Takara RNAisoPlus). The RNA was synthesized using the FastQuant cDNA first-strand synthesis kit (PrimeScript TM RNA was converted to cDNA according to the instructions of the RT reagent Kit with gDNA Eraser. The above kits were purchased from Takara.

[0060] (3) Amplification of the TPPP3 gene

[0061] Based on the complete gene mRNA sequence, primers were designed as follows: TPPP3:

[0062] F: TGGAGGAGAGTTTCCGCAAGTTTG;

[0063] R:TCCGTCAGCCACCTTACAGTCC.

[0064] PCR reaction system: SYBR PremixTaq TM II 10μL, PCR Forward Prime 0.8μL, PCRReverse Primer 0.8μL, cDNA 1μL, ddH2O Up to 20μL.

[0065] Prepare the reaction system on ice and set the PCR reaction conditions as follows: initial denaturation—95°C, 30 s; 95°C, 5 s; 60°C, 30 s; 72°C, 30 s; 40 cycles. Melting analysis: 95°C, 15 s; 55°C, 15 s; 95°C, 15 s.

[0066] 2.1.3 Western blot detection of TPPP3 protein expression

[0067] Collect cells transfected 72 hours after step 2.1.1 and test protein expression. The steps are as follows:

[0068] Extract total protein according to the instructions for the IP cell lysis buffer. Mix the total protein with SDS loading buffer in appropriate proportions, incubate at 100°C in a water bath for 5 minutes, and store aliquots at -20°C until use. Detect the protein concentration of each group according to the instructions for the BCA protein concentration quantification kit. Western blot procedures are as follows:

[0069] (1) Preparation of SDS-PAGE gel

[0070] According to the molecular weight of TPPP3 protein 15KDa, 15% separation gel and 5% stacking gel were prepared. The formula is as follows

[0071] (a) 15% separating gel 5 mL: distilled water 1.2 mL, 30% Acr-Bis (29:1) 2.5 mL, Gelbuffer A 1.25 mL, 10% APS 0.05 mL, TEMED 0.003 mL;

[0072] (b) 5% stacking gel 2 mL: distilled water 0.67 mL, 30% Acr-Bis (29:1) 0.33 mL, Gelbuffer A 1.0 mL, 10% APS 0.02 mL, TEMED 0.002 mL;

[0073] (2) Electrophoresis and membrane transfer

[0074] Load 60 μg of protein sample and protein marker, and run the electrophoresis conditions at 70V for 40 minutes on the stacking gel and 120V for 60 minutes on the separating gel. After electrophoresis, cut the PVDF membrane and soak it in methanol for 2 minutes. Cut the gel according to the Maker instructions, soak the filter paper, gel, and PVDF membrane in transfer buffer, and then align them on a semi-dry transfer apparatus in the order of filter paper, gel, PVDF membrane, and filter paper. Due to the small molecular weight of the TPPP3 protein, the transfer conditions were: constant voltage 16V for 20 minutes.

[0075] (3) Immune response and imaging

[0076] Remove the PVDF membrane and block with 5% skim milk powder at room temperature for 1 hour. Incubate the PVDF membrane with primary antibodies against TPPP3 (1:500) and β-actin (1:3000) at 4°C overnight. Wash the membrane thoroughly with TBST three times for 10 minutes each and incubate with HRP-labeled secondary antibody (1:5000) at room temperature for 1 hour. Wash the membrane thoroughly with TBST three times for 10 minutes each. Prepare ECL luminescent solution and add it dropwise to the dried PVDF membrane. Develop the membrane using a chemiluminescence imager. Use Image J to analyze the grayscale of the bands.

[0077] The siRNA chain with the most significant knockdown effect on TPPP3 was screened for subsequent experiments.

[0078] 2.2 Effects of TPPP3 knockdown on RBL-2H3 cell morphology

[0079] RBL-2H3 cells (8×10 4 Each well was plated with 24-well plates (100 μg / well). The groups were set up as follows: normal group (Control); model group (Model); negative control group (NC); experimental group (TPPP3-siRNA); with three replicates per group. 12 hours later, the negative control group and experimental group were transfected with siRNA at a final concentration of 80 nM, as described in 2.1.1. One day after transfection, the cells were washed three times with PBS buffer. Each group, except the control group, was sensitized with 500 μL of DMEM containing 0.4 μg / mL DNP-IgE; the control group received an equal volume of DMEM. 12 hours later, each group, except the control group, was stimulated with 200 μL of PIPES buffer containing 10 μg / mL DNP-BSA; the control group received an equal volume of PIPES buffer. One hour later, the reaction was terminated by incubating on ice for 10 minutes. Neutral red stain was added to each well, incubated at room temperature for 10 minutes, and then rinsed twice with distilled water for 2 minutes each. The cells were then observed and photographed under a microscope.

[0080] 2.3 Effect of TPPP3 knockdown on IgE-induced β-Hex release in RBL-2H3 cells

[0081] RBL-2H3 cells (8×10 4 Cells were plated in 24-well plates (cells / well). The cell grouping, transfection steps and cell sensitization and excitation operations were the same as in 2.2. After terminating the reaction in an ice bath for 10 minutes, the supernatant of each group was collected and centrifuged at 12000 rpm and 4°C for 5 minutes. The cells in the Control group were lysed on ice with 0.5% TritonX-100 for 10 minutes as the total enzyme wells. 50 μL of supernatant from each group was incubated with 50 μL of 1mM colorimetric solution at 37°C for 1 hour, and then 200 μL of 0.1 mol / L stop solution was added to each well to terminate the reaction. The absorbance at 405 nm was measured using a microplate reader.

[0082]

[0083] 2.4 Effect of TPPP3 knockdown on IgE-induced HA release from RBL-2H3 cells

[0084] RBL-2H3 cells (8×10 4 Cells were plated in 24-well plates (cells / well). Cell grouping, transfection, and cell sensitization procedures were the same as in 2.2. After terminating the reaction by incubating on ice for 10 minutes, the supernatant from each group was collected and centrifuged at 12,000 rpm at 4°C for 5 minutes. The histamine ELISA kit instructions were followed.

[0085] 2.5 Effect of TPPP3 knockdown on IgE-induced apoptosis in RBL-2H3 cells

[0086] RBL-2H3 cells (8×10 4 Cells were plated in 24-well plates (cells / well). Cell grouping, transfection, and cell sensitization procedures were the same as in 2.2. The reaction was terminated by incubating on ice for 10 minutes. Following the instructions for the AO / EB staining kit, cells were observed under a fluorescence microscope. Images of five random fields of view were taken. The number of cells of different colors was quantified using ImageJ software. The apoptosis rate was calculated using the following formula.

[0087]

[0088] 2.6 Effects of TPPP3 knockdown on proteins in the IgE signaling pathway during degranulation in RBL-2H3 cells

[0089] Protein extraction, quantification, and electrophoresis

[0090] RBL-2H3 cells (8×10 4 Cells were plated in 24-well plates (cells / well). Cell grouping, transfection, and cell sensitization procedures were the same as in 2.2. After terminating the reaction by incubating on ice for 10 minutes, proteins from each group were extracted. Protein extraction, quantification, and electrophoresis were performed as in 2.1.3.

[0091] 2.7 Statistical analysis

[0092] Experimental data are expressed as mean ± SD. Pairwise comparisons were performed using one-way ANOVA with GraphPad Prism 7.00. All statistical significance was set at **p < 0.05 and ***p < 0.01.

[0093] 3 Experimental results

[0094] 3.1 Knockdown of TPPP3 gene and screening of TPPP3-siRNA chains

[0095] 3.1.1 Observation of TPPP3-siRNA transfection efficiency

[0096] The siRNA end is labeled with the fluorescent marker FAM, which has simple chemical synthesis, high yield, and can track the location and distribution of RNA in cells, making it easier to optimize transfection conditions. Figure 1 ), green fluorescence appeared in most cells, indicating that siRNA had been transferred into the cells, proving that the transfection conditions used in this experiment met the experimental requirements.

[0097] 3.1.2 Extract RNA from each group and test its quality

[0098] Agarose gel electrophoresis shows that ( Figure 2 ), with clear 28S and 18S bands, indicating good quality RNA extraction and absence of contamination and degradation. The extract data, measured using an ultramicrospectrophotometer, are shown in Table 1. Both the A260 / A280 and A260 / A230 ratios are within the specified range, demonstrating the high purity of the extracted RNA, meeting experimental requirements.

[0099] Table 1 RNA concentration and quality test results of each group

[0100]

[0101] 3.1.3 RT-qPCR detection of TPPP3 gene expression in each group

[0102] RNA quantification results showed that ( Figure 3 ), using cells transfected with negative control siRNA as a control, each TPPP3-siRNA chain had varying degrees of knockdown effect, but siRNA-419 had the best knockdown effect and the highest significance.

[0103] 3.1.4 Western-blot detection of TPPP3 protein expression in each group

[0104] Western-Blot results Figure 4As can be seen in the TPPP3 protein expression levels of each group, the siRNA-419 group showed the lowest protein expression and a significant difference, indicating that siRNA-419 had the best knockdown effect. Therefore, the following experiments used siRNA-419 as the TPPP3-siRNA group.

[0105] 3.2 Effects of TPPP3 knockdown on RBL-2H3 cell morphology

[0106] Neutral red staining can be seen under the microscope ( Figure 5 ). The cells in the normal group were roughly spindle-shaped or fusiform, with intact morphology, good growth status, and darker cell staining. In the model group, most cells began to swell and round, with lighter staining, and some had ruptured cell membranes and vacuoles. In the TPPP3-siRNA group, cell swelling was reduced after TPPP3 gene inhibition, and the cells became spindle-shaped, a significant improvement compared to the model group. There was no difference between the negative control siRNA group and the model group.

[0107] 3.3 Effect of TPPP3 knockdown on IgE-induced β-Hex release in RBL-2H3 cells

[0108] The release of β-Hex by cells in each group was determined by Figure 6 The β-Hex release rate of the normal group cells was 12.24%, while that of the model group was 58.60%, both significantly different from the normal group. However, after silencing the TPPP3 gene, the β-Hex release rate of RBL-2H3 cells decreased to 28.57%, also significantly different from the model group. These results indicate that TPPP3 gene inhibition can reduce IgE-induced β-Hex release in RBL-2H3 cells.

[0109] 3.4 Effect of TPPP3 knockdown on IgE-induced HA release from RBL-2H3 cells

[0110] The release of HA by cells in each group was determined by Figure 7 The HA release rate of cells in the normal group was 13.19%, while that in the model group was 24.40%, both significantly different from the normal group. However, after silencing the TPPP3 gene, the HA release rate of RBL-2H3 cells decreased to 15.21%, also significantly different from the model group. These results suggest that TPPP3 gene inhibition can reduce IgE-induced HA release in RBL-2H3 cells.

[0111] 3.5 Effect of TPPP3 knockdown on IgE-induced apoptosis in RBL-2H3 cells

[0112] In this experiment, AO / EB staining was used to double-stain live cells and necrotic cells. Figure 8 、 Figure 9It can be seen that the vast majority of cells in the normal group emitted bright green fluorescence, with spindle-shaped morphology and intact cell membranes, and the calculated apoptosis rate was 1.91%. In the model group, however, there were more dead cells with orange-red fluorescence, round morphology, and broken structures. The calculated apoptosis rate was 35.20%, which was significantly different from the cells in the normal group. After silencing the TPPP3 gene, the cell apoptosis rate was reduced to 18.64%, which was significantly different from the cells in the model group. The apoptosis rate of cells in the negative control group was 39.53%, which was not significantly different from the apoptosis rate of cells in the model group. This proves that after the TPPP3 gene is inhibited, apoptosis after degranulation can be reduced.

[0113] 3.7 Effects of TPPP3 knockdown on proteins in the IgE signaling pathway during degranulation in RBL-2H3 cells

[0114] Figure 10 The expression of p-Lyn / Lyn, p-Syk / Syk, p-ERK1 / 2 / ERK1 / 2, p-p65 / p65, and p-AKT / AKT proteins in each group is shown. FcεRI-mediated signaling is initiated by phosphorylation of the ITAM motifs at the tails of the β and γ subunits of FcεRI. Tyrosine-phosphorylated ITAMs recruit Syk kinase, which, together with activated receptor-proximal Src protein tyrosine kinases (such as Fyn and Lyn), mediates the phosphorylation and subsequent reorganization of scaffold proteins at the activated FcεRI complex. Therefore, we measured the expression of key signaling proteins Lyn and Syk by immunoblotting to verify whether TPPP3 regulates FcεRI-mediated signaling. Grayscale analysis results showed that after knocking down the TPPP3 gene, the expression of p-Lyn and p-Syk was significantly decreased compared with the model group, suggesting that TPPP3 may have a regulatory effect on Lyn and Syk.

[0115] Signaling via the MAPK kinase pathway is also a key pathway for the production and release of inflammatory factors during mast cell degranulation. Nuclear factor-kB (NF-kB) is a crucial nuclear transcription factor in cells that participates in inflammatory and immune responses and regulates apoptosis and stress responses. Therefore, we examined the phosphorylation levels of ERK1 / 2 and p-65, key proteins in the MAPK kinase and NF-kB pathways. Compared with the model group, p-65 expression was significantly decreased after TPPP3 gene inhibition. However, p-ERK1 / 2 expression remained unchanged.

[0116] Ca 2+The TPPP3-independent pathway (Fyn, Gab2, PI3K, RhoA, RasGRP1, Arf1, Nck2, DOCK5, Akt) mediates the reorganization of microtubules and actin, which is essential for the transport and fusion of cell granules. Therefore, this experiment examined the phosphorylation of Akt protein. The results showed that compared with the model group, the expression of p-Akt showed a significant decrease. This indicates that inhibiting TPPP3 gene protein expression can also affect the phosphorylation of Akt protein, thereby affecting the regulation of microtubule degranulation in RBL-2H3 cells.

[0117] 4 Results Analysis

[0118] A suitable cell model is a prerequisite for successful experiments. The rat basophil leukemia cell line (RBL-2H3) has been widely used as a recognized model for studying mast cell signaling and function. RBL-2H3 cells are easy to culture rapidly, continuously, and in large quantities. They contain the core signaling machinery of mature human mast cells and are functionally homologous to rodent mucosal mast cells. Many molecular similarities between human and rodent mast cells have been detailed by Abramson et al. In RBL-2H3 cells, the mechanisms and pathways of degranulation have been described in many studies, which confirms that the RBL-2H3 cell model can serve as a cell model for studying toxicants or drugs that affect this signaling system.

[0119] Reducing gene expression is a common method for studying gene function. Currently, the main techniques include RNA interference (RNAi), CRISPR-Cas9, and gene transfection. RNAi offers advantages such as high efficiency, short cycle times, strong specificity, and ease of use. It involves silencing target genes by introducing siRNA to determine their biological function. While this method is simple, careful consideration of various transfection conditions is crucial. The present invention discovered that cell status, siRNA quality, the amount of siRNA added, and the amount of transfection reagent (GP-transfect-Mate) all play a crucial role in influencing transfection efficiency. Excessive amounts of transfection reagent can cause toxic effects on cells, leading to cell death. In this experiment, key factors such as the amount of siRNA and transfection reagent added were explored in 24-well plates, ultimately selecting a final siRNA concentration of 80 nM and a GP-transfect-Mate dosage of 1.5 μL / well. Next, to determine TPPP3 gene expression in specific cells before and after siRNA delivery, RT-qPCR and western blot were used to quantitatively measure the silencing efficiency of each RNA group. siRNA-419, which showed the highest knockdown efficiency, was selected for subsequent experiments.

[0120] Methods for identifying mast cell degranulation primarily use enzyme-linked immunosorbent assays (ELISAs) or colorimetric assays to measure intracellular and extracellular inflammatory mediators, such as HA and β-HEX. These mediators are considered important markers for mast cell degranulation. Histamine, a major mediator of hypersensitivity diseases with diverse effects, is released upon activation of specific surface receptors on target cells. Therefore, HA release has been developed to monitor mast cell degranulation. β-HEX, another preformed inflammatory mediator in mast cell granules, is also a potent inflammatory mediator stored in mast cells and is often released concurrently with histamine from activated mast cells. β-HEX measurement is currently widely used to assess the level of mast cell degranulation. Therefore, in this study, we investigated whether knockdown of the target gene TPPP3 could inhibit degranulation in RBL-2H3 cells by measuring the release of β-HEX and HA. Results demonstrated that TPPP3 downregulation significantly inhibited degranulation in RBL-2H3 cells.

[0121] Mast cell-mediated apoptosis is known to depend on the granule remnants produced by mast cell stimulation and degranulation, thus necessitating a correlation between degranulation and apoptosis. Numerous methods exist for detecting apoptosis, including morphological observation, biochemical methods, DNA fragmentation assays, and methods such as TUNEL (Tunneling Untranslated Dinucleotide) (TUNEL) labeling of fragmented DNA. Acridine orange (AO) can cross intact cell membranes, intercalate into nuclear DNA, and bind to double-stranded DNA, emitting green fluorescence. Ethidium bromide (EB) can only cross damaged cell membranes, intercalating into nuclear DNA, causing it to emit orange-red fluorescence. Apoptotic cells exhibit enhanced staining, uniform and bright fluorescence, and a morphologically similar nuclear structure. In contrast, apoptotic nuclei exhibit varying degrees of fluorescence, with condensed and fragmented structures. These differences in color and morphology make them easily distinguishable. The AO / EB dual fluorescence staining method used in this experiment can detect basic morphological changes in apoptotic cells and is convenient and rapid. Numerous studies have used AO / EB dual fluorescence staining to detect apoptosis. Some studies have even demonstrated no significant difference between flow cytometry and AO / EB staining in their ability to detect apoptosis. AO / EB staining results showed that knockdown of TPPP3 could inhibit DNP-IgE / DNP-BSA-induced apoptosis of RBL-2H3 cells.

[0122] FcεRI-mediated signaling controls cytoskeletal rearrangements during mast cell degranulation, and therefore the dynamic properties of intracellular microtubules play a crucial role. To determine whether the TPPP3 gene affects microtubule polymerization during RBL-2H3 cell degranulation, this study used immunofluorescence staining for tubulin to observe changes in microtubule morphology in each cell group. The results showed that RBL-2H3 cells exhibited significant microtubule polymerization after activation with DNP-IgE / DNP-BSA. Knockdown of TPPP3 alleviated intracellular microtubule polymerization, suggesting that TPPP3 may further influence RBL-2H3 cell degranulation by affecting microtubule polymerization.

[0123] FcεRI-mediated signaling is initiated by phosphorylation of ITAM motifs on the tails of the β and γ subunits of FcεRI. Tyrosine-phosphorylated ITAMs recruit Syk kinase, which, together with activated receptor-proximal Src protein tyrosine kinases (such as Fyn and Lyn), mediates the phosphorylation and subsequent reorganization of scaffold proteins within the activated FcεRI complex. Lyn activation is the initial step in cellular degranulation. After the IgE-FcεRI complex is cross-linked by multivalent antigens, FcεRI is phosphorylated by Lyn kinase, triggering a hypersensitivity response at the plasma membrane. Shelby et al. found that actin stabilizes membrane structure to reduce spontaneous collisions between Lyn and IgE-FcεRI, and that antigen-stimulated Lyn coupling with IgE-FcεRI initiates signaling, a step mediated by ordered lipids and regulated by the actin cytoskeleton. Experimental results showed that knockdown of the TPPP3 gene reduced the phosphorylation levels of Lyn and Syk. This indicates that TPPP3 deficiency can inhibit the FcεRI signaling pathway.

[0124] NF-κB is a typical pro-inflammatory signaling pathway that primarily regulates the production of many inflammatory cytokines. Shukla et al. found in their study of the endometrium that TPPP3 knockout inhibited the expression of β-catenin, NF-κB, and COX-2 during decidualization. This study also found in RBL-2H3 cells that TPPP3 knockout inhibited the phosphorylation of the p65 subunit of NF-κB. This suggests that TPPP3 may inhibit the production of inflammatory factors by regulating the NF-κB pathway.

[0125] In mast cells, we know that the downstream signaling generated by FcεRI leads to microtubule reorganization, and the Ca2+ signaling involved by Fyn, Gab2, PI3K, RhoA, RasGRP1, Arf1, Nck2, DOCK5, Akt, etc. 2+The independent pathway is the key to mediating the reorganization of microtubules and actin required for the transport and fusion of intracellular particles. This experiment found that the inhibition of TPPP3 inhibited the phosphorylation of AKT, suggesting that TPPP3 may be involved in the Ca2+ regulation during the degranulation process of mast cells. 2+ Independent pathways have mutually regulatory effects.

[0126] In summary, the present invention studies the effect of knocking down TPPP3 on the degranulation of RBL-2H3 cells. The TPPP3 gene was knocked down by siRNA, and the degranulation of RBL-2H3 cells was detected by neutral red staining to observe cell morphology, AO / EB staining to detect cell apoptosis, ELISA to detect histamine (HA), and colorimetric detection of β-hexosaminidase (β-HEX) release. The results showed that silencing TPPP3 can improve the morphological changes of RBL-2H3 cells during degranulation, reduce cell apoptosis, and reduce the release of HA and β-HEX; immunofluorescence results showed that silencing TPPP3 can inhibit the aggregation of microtubules during cell degranulation; Western Blot results found that silencing TPPP3 can regulate type I hypersensitivity reactions by regulating the Lyn / Fyn, PI3K / AKT and NF-κB signaling pathways upstream and downstream of IgE / FcεRI. The present invention analyzes the regulatory role and possible mechanism of action of TPPP3 in type I hypersensitivity reaction in vitro, providing an experimental basis and scientific basis for revealing the pathogenesis of type I hypersensitivity reaction and in-depth research on the role of TPPP3 in type I hypersensitivity reaction.

[0127] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a preparation for inhibiting tubulin polymerization-promoting protein 3 in the preparation of a drug for treating type I hypersensitivity reaction, characterized in that: The preparation includes siRNA that interferes with the expression of the gene encoding microtubule polymerization promoting protein 3; the nucleotide sequence of the siRNA is shown in SEQ ID NO: 5-6.

2. The use according to claim 1, characterized in that The siRNA plays a role in treating type I hypersensitivity reaction by improving the morphological changes of mast cell degranulation, reducing cell apoptosis, lowering the amount of histamine and β-hexosaminidase released by cells, and regulating signal pathways.

3. The use according to claim 2, characterized in that The signaling pathway includes Lyn / Fyn, PI3K / AKT and NF-κB.

4. The use according to claim 1, characterized in that The type I hypersensitivity reaction includes IgE-mediated type I hypersensitivity reaction.

5. A drug for preventing and treating type I hypersensitivity reaction, characterized in that: The invention comprises siRNA that interferes with the expression of the gene encoding microtubule polymerization promoting protein 3; the nucleotide sequence of the siRNA is shown in SEQ ID NO: 5-6.

6. The drug according to claim 5, characterized in that The dosage form of the medicine is tablet, capsule, granule, injection or spray.

7. The drug according to claim 5, characterized in that The drug administration method is oral or parenteral administration.

Images