A blocking ELISA antibody detection kit for lumpy skin disease of cattle and its application

Abstract

The present invention discloses a blocking ELISA antibody detection kit for lumpy skin disease of cattle and its application. The kit includes an enzyme-linked reaction plate and an enzyme-labeled antibody; wherein, the enzyme-labeled plate is coated with LSDV A33R protein expressed by an Escherichia coli expression system, which is purified and used as a coating antigen, and at the same time used as an immunogen to prepare and screen specific monoclonal antibodies against LSDV A33R protein and perform peroxidase labeling to obtain a blocking enzyme-labeled monoclonal antibody. The kit of the present invention has high sensitivity, good specificity, and convenient operation. The result is judged by the blocking rate, with high accuracy, and can be used for the detection of the antibody level of the Capripoxvirus genus.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection. More specifically, the present invention relates to a blocking ELISA antibody detection kit for lumpy skin disease of cattle and its application, which is suitable for specific, rapid and accurate detection of antibodies against lumpy skin disease of cattle. Background Art

[0002] Lumpy skin disease (LSD) of cattle, also known as bovine nodular dermatitis, is an acute infectious disease caused by the lumpy skin disease virus (LSDV) of the genus Capripoxvirus in the family Poxviridae. This disease can infect cattle of any age and any breed, causing extensive skin lesions and typical symptoms of systemic poxvirus infection, such as extensive nodules on the skin, mucous membranes and organ surfaces, swollen lymph nodes, skin edema, etc. In severe cases, it can lead to death, with a mortality rate of up to 100% in calves and 3%-10% in adult cattle. It is listed as a notifiable animal infectious disease by the World Organization for Animal Health (OIE), and China has also classified it as a Class I animal epidemic disease. This disease was first introduced into China on August 12, 2019. The main mode of transmission of this disease is through blood-sucking arthropod insects as vectors, and these insects will reproduce and migrate in large numbers with seasonal climate changes. With the increasing international trade exchanges and the convenience of cargo transportation tools every year, it will also lead to the spread of this disease and increase the probability of its global spread.

[0003] At present, the main prevention and control measures for this disease are to inoculate attenuated vaccines, and there is no drug treatment. Local skin adverse reactions will occur during the use of attenuated vaccines. There is a risk of spreading the attenuated vaccines, posing a biosafety hazard. In addition, due to the host specificity of heterologous attenuated vaccines, there is also a potential risk of infecting goats and sheep. Moreover, there may be a risk of increased virulence in the evolution of attenuated vaccines in the animal body and its environment. Serological antibody detection is one of the important detection methods for detecting natural infection and evaluating the immune effect of vaccines.

[0004] Enzyme-Linked Immunosorbent Assays (ELISA) is the mainstream immunoassay technology in the market, which has been widely used in clinical detection, is fast, convenient and highly sensitive, and does not require special instrument equipment, and can be used for antibody detection of lumpy skin disease of cattle. Currently, there is no ELISA antibody detection kit for detecting antibodies against lumpy skin disease of cattle in the market.

[0005] Studies have shown that Lumpy Skin Disease Virus (LSDV), Goatpox Virus (GTPV), and Sheep Pox Virus (SPPV) all belong to the genus Capripoxvirus of the family Poxviridae. The genomes of various isolates of CaPV are very conservative. The genomic identities of SPPV, GTPV, and LSDV are all greater than 96%. They show cross-reactivity in serum and do not cross-infect under natural conditions. Some studies have shown that inoculating animals with purified A33R protein or DNA vaccines expressing these proteins can provide partial or even complete protection against virus challenge. Therefore, in the present invention, LSDV A33R protein is selected as the coating antigen to meet the detection of LSDV antibody levels.

[0006] Since the neutralizing antibody levels in infected sera, especially vaccine-immunized sera, are very low and often undetectable, we need to improve the sensitivity of diagnostic detection products. The present invention is a blocking ELISA antibody detection method based on specific monoclonal antibodies against LSDV A33R protein, making the kit have good sensitivity and specificity. Summary of the Invention

[0007] The purpose of the present invention is to provide a blocking ELISA kit that is highly sensitive, highly specific, and can quickly and simply detect antibodies against Lumpy Skin Disease.

[0008] One of the advantages of this kit is the use of monoclonal antibodies against LSDV A33R protein labeled with horseradish peroxidase (HRP), which improves the sensitivity and specificity of the detection.

[0009] Based on the above purpose, the blocking ELISA antibody detection kit for Lumpy Skin Disease of the present invention includes an enzyme-linked reaction plate coated with LSDV A33R protein and an enzyme-labeled antibody; the enzyme-labeled antibody is an enzyme-labeled antibody made from a monoclonal antibody (LSDV-12D1) that specifically binds to LSDV A33R protein. The enzyme-labeled antibody is preferably an antibody labeled with horseradish peroxidase, and the horseradish peroxidase can be cross-linked to the antibody by the glutaraldehyde method or the periodate method.

[0010] Preferably, the sequence of the LSDV A33R protein is Sequence 6 in the sequence listing, and it is a purified LSDV A33R protein expressed using an Escherichia coli expression system. The enzyme-linked reaction plate can be a detachable 96-well enzyme-labeled plate.

[0011] Preferably, the monoclonal antibody that specifically binds to LSDV A33R protein contains a heavy chain variable region LSDV-12D1-V H and a light chain variable region LSDV-12D1-V L ; the heavy chain variable region LSDV-12D1-V H and the light chain variable region LSDV-12D1-VL Both are composed of a complementarity-determining region and a framework region; the LSDV-12D1-V H and the LSDV-12D1-V L The complementarity-determining regions of both are composed of CDR1, CDR2, and CDR3; the CDR1 of the LSDV-12D1-V H The amino acid sequence of CDR1 is shown as the amino acids at positions 50-54 of SEQ ID No.1; the CDR1 of the LSDV-12D1-V H The amino acid sequence of CDR2 is shown as the amino acids at positions 69-85 of SEQ ID No.1; the CDR1 of the LSDV-12D1-V H The amino acid sequence of CDR3 is shown as the amino acids at positions 118-126 of SEQ ID No.1; the CDR1 of the LSDV-12D1-V L The amino acid sequence of CDR1 is shown as the amino acids at positions 43-58 of SEQ ID No.2; the CDR1 of the LSDV-12D1-V L The amino acid sequence of CDR2 is shown as the amino acids at positions 74-80 of SEQ ID No.2; the CDR1 of the LSDV-12D1-V L The amino acid sequence of CDR3 is shown as the amino acids at positions 113-121 of SEQ ID No.2.

[0012] Preferably, the amino acid sequence of the LSDV-12D1-V H is shown as the 1st to 137th positions of SEQ ID No.1 in the sequence listing; the amino acid sequence of its LSDV-12D1-V L is shown as the 1st to 131st positions of SEQ ID No.2 in the sequence listing.

[0013] The optimal coating preparation method and conditions for the enzyme-linked reaction plate are to dissolve the LSDV A33R protein in 100 μl of carbonate solution with a pH of 9.6, and then add it to a 96-well polystyrene enzyme-linked reaction plate, with 0.1 μg - 1 μg of LSDV A33R protein per well, and place it at 2-8 °C for 8-12 hours to allow the coated antigen to fully bind to the enzyme-linked reaction plate. Then, add 300 μl / well of PBS buffer containing 10 mg / ml casein with a pH of 7.4, and perform a blocking treatment at 37 °C for 2-3 hours. After centrifuging to dryness, store it sealed at 4 °C after the enzyme-linked reaction plate is dried.

[0014] Preferably, the kit further includes a positive control serum and a negative control serum. The positive control serum is the serum of cattle immunized with the inactivated vaccine for bovine nodular skin disease; the negative control serum is the serum of cattle without specific pathogens (without bovine nodular skin disease pathogens and without vaccination).

[0015] Furthermore, the kit further includes a sample diluent, 20× concentrated washing solution, substrate solution A, substrate solution B, and termination solution. The enzyme-linked reaction plate is a detachable 96-well microtiter plate. The sample diluent is a 0.01M phosphate buffer solution with a pH value of 7.4 containing 5 mg / ml casein. The 20× concentrated washing solution is a 0.01M phosphate buffer solution with a pH value of 7.4 containing 0.8% - 1.2% (ml / ml) Tween-20. The substrate solution A is a citric acid phosphate buffer solution containing 0.6 mg / ml urea hydrogen peroxide, and the substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution. When in use, the two are mixed in a ratio of 1:1. The termination solution is a 2 mol / L sulfuric acid solution.

[0016] The present invention also claims protection for a monoclonal antibody that can specifically bind to lumpy skin disease of cattle, which is any one of the following monoclonal antibodies:

[0017] 1) Containing a heavy chain variable region LSDV-12D1-V H and a light chain variable region LSDV-12D1-V L ; the heavy chain variable region LSDV-12D1-V H and the light chain variable region LSDV-12D1-V L are both composed of a complementarity-determining region and a framework region; the complementarity-determining regions of the LSDV-12D1-V H and the LSDV-12D1-V L are both composed of CDR1, CDR2, and CDR3; the amino acid sequence of CDR1 of the LSDV-12D1-V H is shown as the amino acids at positions 50 - 54 of SEQ ID No.1; the amino acid sequence of CDR2 of the LSDV-12D1-V H is shown as the amino acids at positions 69 - 85 of SEQ ID No.1; the amino acid sequence of CDR3 of the LSDV-12D1-V H is shown as the amino acids at positions 118 - 126 of SEQ ID No.1; the amino acid sequence of CDR1 of the LSDV-12D1-V L is shown as the amino acids at positions 43 - 58 of SEQ ID No.2; the amino acid sequence of CDR2 of the LSDV-12D1-V L is shown as the amino acids at positions 74 - 80 of SEQ ID No.2; the amino acid sequence of CDR3 of the LSDV-12D1-V L is shown as the amino acids at positions 113 - 121 of SEQ ID No.2.

[0018] 2) Containing a heavy chain variable region LSDV-12D1-VH and the light chain variable region LSDV-12D1-V L ; said LSDV-12D1-V H has an amino acid sequence as shown in positions 1 to 137 of SEQ ID No.1 in the sequence listing; its LSDV-12D1-V L has an amino acid sequence as shown in positions 1 to 131 of SEQ ID No.2 in the sequence listing.

[0019] Through the above heavy chain variable region and light chain variable region sequences, it can be connected with animal-derived constant regions (such as mouse antibody heavy chain and light chain constant regions) to prepare a monoclonal antibody that can specifically bind to bovine lumpy skin disease.

[0020] The application of the above enzyme-linked immunosorbent assay kit in the detection of blocking antibodies against bovine lumpy skin disease also belongs to the protection scope of the present invention.

[0021] The application of the above monoclonal antibody that can specifically bind to bovine lumpy skin disease in the preparation of a kit for detecting bovine lumpy skin disease also belongs to the protection scope of the present invention. Especially its application in the preparation of a kit for detecting antibodies against bovine lumpy skin disease.

[0022] The above LSDV A33R protein is a purified A33R protein expressed using an Escherichia coli expression system, and may include the following steps:

[0023] 1) Construction of recombinant plasmid: According to the sequence reported in GenBank (MT992618.1), the target fragment sequence was handed over to Beijing Zhongmei Taihe Company for codon optimization and then synthesized. The synthesized gene was constructed on the PET-28a vector, and the 5' and 3' of the A33R protein gene were inserted into two restriction enzyme digestion sites, BamH I and EcoR I respectively. The plasmid was subjected to target gene sequencing and double enzyme digestion identification.

[0024] 2) Plasmid transformation and strain screening: Take out BL21(DE3) competent cells, mix the competent cells with the recombinant plasmid, incubate on ice for 30 min, heat shock at 42 °C for 90 s, and then quickly incubate on ice for 3 min. Add 700 μl of LB liquid medium, place it in a shaker at 37 °C and culture at 200 r / min for 60 min. Spread the culture solution on LB solid medium with kanamycin resistance and culture overnight at 37 °C. Pick the strains, perform colony PCR identification using A33R protein-specific primers, and send the positive strains to a sequencing company for sequencing and comparison.

[0025] 3) Induced expression of A33R protein, treatment of bacterial cells and protein purification: Inoculate the positive strain into LB medium with kanamycin resistance and culture overnight at 37°C with 200 r / min. The next day, inoculate the seed into LB medium with kanamycin resistance at a ratio of 1:100 and culture at 37°C with 200 r / min. When the OD 600nm of the bacterial solution reaches 0.6 - 0.8, add 0.2 mM IPTG for induced expression, adjust the temperature to 25°C, and induce expression for 5 h. Centrifuge the bacterial cells at 4500 r / min for 30 min to collect the bacterial cells. Resuspend the bacterial cells with PBS at a ratio of 1:10, ultrasonically disrupt the cells, and set the parameters as power 190 W, working for 5 s and turning off for 10 s. Centrifuge to obtain the supernatant of the disrupted bacterial solution, filter it through a 0.22 μM filter membrane, and then perform affinity chromatography purification through a nickel column and gel filtration chromatography purification through a molecular sieve. Finally, identify the content and purity of the protein by SDS-PAGE.

[0026] The method for obtaining the above monoclonal antibody that can specifically bind to LSDV A33R protein is as follows: Screen the specific monoclonal cell line of bovine nodular dermatitis of the present invention according to the conventional methods known in the art, then use gene sequencing to determine the gene sequence of the specific monoclonal cell line, and use gene synthesis and the method of constructing a recombinant expression vector to prepare a stably expressed monoclonal antibody as the enzyme-labeled monoclonal antibody of the present invention. Specifically, the method for obtaining the specific monoclonal antibody of bovine nodular dermatitis of the present invention may include the following steps:

[0027] 1) Use the A33R protein expressed and purified by the Escherichia coli expression system as the immunogen, with a purity of not less than 80%, and adjust the antigen concentration to 100 μg / ml;

[0028] 2) Immunize continuously 4 times, with an interval of 14 days each time. The first 3 times adopt the multi-point subcutaneous immunization method, and the 4th time adopts the intraperitoneal injection immunization method, 10 μg per animal each time;

[0029] 3) Isolate the spleen cells of the immunized animals, fuse them with myeloma cells, screen the hybridoma cells with HAT selective medium, and screen the specific positive clones from the supernatant of the hybridoma cells by the indirect ELISA method; When the titer of the serum antibody level of the immunized animal detected by the indirect ELISA exceeds 1:50000, the spleen cells of the animal can be isolated and prepared into a single-cell suspension, and fused with myeloma cells (preferably mouse myeloma cell line SP2 / 0) under the induction of an appropriate fusogen (such as polyethylene glycol) to form a hybridoma; After detection, preferably the monoclonal cell line secreting LSDV-12D1 can specifically react with LSDV A33R protein.

[0030] 4) Extraction of DNA from specific positive cloned hybridoma cell lines: Take 200 μl of the supernatant of the virus solution into a 1.5 ml EP tube, add 200 μl of lysis buffer, mix well by shaking, and let it stand for 5 min. Then add 75 μl of protein removal solution, mix well by shaking, and centrifuge at 12000×g for 5 min. Transfer the supernatant to a new 2 ml EP tube, add 300 μl of isopropanol (1% glacial acetic acid), invert it up and down 6 - 8 times, mix well, and place it in a new 2 ml EP tube. Centrifuge at 6000×g for 1 min, discard the filtrate, wash it with 75% DEPC ethanol, and centrifuge. Discard the ethanol, dry it, and dissolve the RNA with 20 μl of RNase-free water.

[0031] 5) Reverse transcription, PCR amplification, and gene sequencing: Use the Invitrogen reverse transcription kit to perform reverse transcription according to the instructions to obtain the cDNA of the hybridoma cells. For the heavy chain (V H -1: 5’-GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG-3’; V H -2: 5’-ATGTCGACTGAGGAGACGGTGACCAGGGTGCC-3’) and the light chain (V L -1: 5’-GTGAATTCATGGACATTGTGATGACCCAGTCTCC-3’; V L -2: 5’-CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC-3’) variable regions, design universal primers, use the amplification primers to amplify the target fragment, after amplification, recover the fragment by gel electrophoresis, then ligate the vector for sequence determination to obtain the sequence information of the variable regions of the monoclonal antibody heavy chain and light chain.

[0032] 6) Synthesis of the gene sequence of the specific monoclonal antibody, construction of the shuttle vector, screening and extraction of the recombinant Bacmid, and rescue of the recombinant baculovirus: ① Synthesis of the gene sequence: According to the sequences of the heavy chain and light chain variable regions of the monoclonal antibody LSDV - 12D1 that have been measured, supplement the sequences of the mouse antibody heavy chain and light chain constant regions to the variable region part, and then send it to Beijing Zhongmei Taihe Company for the synthesis of the gene sequence and perform codon optimization for insect cells. ② Construction of the shuttle vector: According to the sequence information of the heavy chain and light chain and the pFastBacdual vector sequence information, design the corresponding primers. For the heavy chain (12D1 - HF: 5’-TCATACATCTACGCGGCC GCTAGC ATGAAGTGTTCGTGGGT-3’; 12D1 - HR: 5’-TCCCCCATCTCCC GGTA CCCGCCGAAACTGTTACGA-3’) and light chain (12D1-LF: 5’-CTGCCTTTGCGGCGGAT GAATTC ATGAAACTCCCGGTGC-3’; 12D1-LR: 5’-CTAGTACTTCTCGAC AAGCTT TTTTATCTCGAGCTT-3’), amplify the full-length fragments of the heavy chain and light chain, and ligate them into the pFastBacdual vector by homologous recombination after gel recovery. The pFastBacdual vector contains two promoters, namely the PH promoter and the P10 promoter. After ligation into the vector, sequence determination is performed to ensure the accuracy of the sequence. ③ Screening and extraction of recombinant Bacmid: Transform the constructed shuttle vector into DH10Bac competent cells, then coat the KTG triple-antibody plate (kanamycin, gentamicin, tetracycline) containing Bluo-gal and IPTG, and pick white colonies after culturing in a 37°C incubator for 48 h for identification. Select completely negative clone bacteria for shaking culture and plating, repeat the screening three times, and then extract the Bacmid according to the instructions of the TIANGEN plasmid miniprep kit, and then measure the concentration using Nanodrop. ④ Rescue of recombinant baculovirus: Before transfection, seed SF9 cells with a density of 2×10 6 into a six-well plate, and transfect the recombinant Bacmid in amounts of 5 μg and 2.5 μg. The amount of transfection reagent used is 8 μl. Change the medium 4 - 6 h after transfection and culture in a 28°C incubator. Harvest and amplify the P1 generation virus after 72 h, and amplify the P2 generation virus using the same method. The amplification of the P3 generation virus is carried out by shake flask amplification, and the virus inoculation ratio is 1:100.

[0033] 7) Expression and purification of specific monoclonal antibody: After amplifying and culturing the P3 generation virus for 48 h, collect the supernatant, inoculate High Five suspension cells with a density of 2×10 6 at a ratio of 1:5, culture in a 28°C incubator for 48 h, centrifuge at 8000 r / min for 1 h to collect the supernatant, and then filter it through a 0.22 μm filter membrane for standby. Equilibrate the Protein A pre-packed column with a Na3PO4 solution with a pH value of 7.0 for 3 - 5 column volumes, then bind the cell supernatant to the Protein A pre-packed column, and elute with a Glycine-HCL eluent with a pH value of 3.0 after the sample binding is complete to obtain the purified LSDV-specific monoclonal antibody LSDV-12D1.

[0034] The detection procedure of the kit of the present invention is as follows:

[0035] 1) Equilibration: Take out the kit from the refrigerated environment, place it at room temperature for 30 min for standby; mix the liquid reagents before use.

[0036] 2) Preparation of reagent solution: Dilute the concentrated washing solution 20-fold with distilled water or deionized water to obtain the washing buffer.

[0037] 3) Sample dilution: Dilute the serum to be tested 2-fold with the sample diluent in the serum dilution plate. The negative and positive control sera have already been diluted and can be used directly.

[0038] 4) Sample addition: Take out the required strips, put the remaining strips into an aluminum foil bag and seal it, then store it at 2 - 8 °C for later use. Add the diluted serum to be tested, the negative control serum, and the positive control serum to the antigen-coated plate, 100 μl per well. Set 1 well for each serum to be tested, and set 2 wells for both the negative control and the positive control. The time span during the sample addition process should be as short as possible. As shown in the figure below for sample addition: N: represents the addition of the negative control serum; P: represents the addition of the positive control serum; S1, S2, S3, S4, etc. represent the addition of each serum to be tested. Figure 1 Shown as follows for sample addition: N: indicates adding the negative control serum; P: indicates adding the positive control serum; S1, S2, S3, S4, etc. indicate adding each serum to be tested.

[0039] 5) Incubation: Mix well by shaking, place it in an incubator at 37 °C, and react for 60 min.

[0040] 6) Plate washing: Discard the reaction solution, add 300 μl of the diluted washing buffer to each well, soak for 15 s, discard the washing solution, wash the plate continuously 4 times, and then pat it dry.

[0041] 7) Enzyme addition: Add 100 μl (concentration 0.5 μg / ml) of the monoclonal antibody against A33R protein labeled with horseradish peroxidase to each well.

[0042] 8) Incubation: Place it in an incubator at 37 °C and react for 30 min.

[0043] 9) Plate washing: Discard the reaction solution, add 300 μl of the diluted washing buffer to each well, soak for 15 s, discard the washing solution, wash the plate continuously 4 times, and then pat it dry.

[0044] 10) Color development: Add 100 μl of the substrate working solution to each well (mix equal amounts of substrate solution A and substrate solution B to obtain the substrate working solution, prepare it immediately before use), mix well by shaking, place it in an incubator at 37 °C, and react in the dark for 15 min.

[0045] 11) Add 50 μl of the color development stop solution to each well, mix well by shaking to terminate the reaction, and measure the results within 15 minutes.

[0046] 12) Conditions for a valid test: The OD 450nm values of the negative control should all be ≥ 1.0. The blocking rate of the positive control wells should be ≥ 50%.

[0047] 13) Judgment: Measure the OD 450nm values of each well on the microplate reader. Blocking rate = 100% * (1 - OD of sample 450nm value / OD of negative control 450nm(Mean). By calculating the blocking rate of each sample, the presence or absence of antibodies can be determined. Negative: blocking rate ≤ 40%; Positive: blocking rate ≥ 50%; Suspected: 40% < blocking rate < 50%.

[0048] The positive effects of the present invention are as follows: The present invention provides an enzyme-linked immunosorbent assay kit for detecting antibodies against bovine nodular dermatitis. This kit is a blocking enzyme-linked immunosorbent antibody detection kit prepared using purified A33R protein of LSDV and specific monoclonal antibodies. It can determine the levels of specific antibodies against bovine nodular dermatitis, goatpox, and sheeppox in samples by detecting the signal changes generated by enzyme-catalyzed substrates, and does not cross-react with other current pathogens such as positive sera of bovine infectious rhinotracheitis, bovine viral diarrhea, foot-and-mouth disease virus type O positive serum, and foot-and-mouth disease virus type A positive serum of cattle.

[0049] In summary, this kit is a blocking enzyme-linked immunosorbent antibody detection kit prepared using purified A33R protein of LSDV and specific monoclonal antibodies. It has high sensitivity and strong specificity. It can not only effectively detect the levels of specific antibodies against bovine nodular dermatitis in samples, but also detect the levels of specific antibodies against goatpox and sheeppox. It has high sensitivity and good specificity, and has broad market prospects and good economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 It is a schematic diagram of adding samples to the enzyme-linked immunosorbent plate of the kit of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0051] The methods in the following examples are all conventional methods unless otherwise specified.

[0052] The acquisition routes of various biological materials described in the examples are only provided as an experimental acquisition route to achieve the purpose of specific disclosure, and should not be a limitation on the source of biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and ethical morals can be replaced and used according to the prompts in the examples.

[0053] The examples are implemented on the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given. The examples will help to understand the present invention, but the protection scope of the present invention is not limited to the following examples.

[0054] Example 1. Preparation of purified LSDV protein

[0055] It includes the following steps:

[0056] 1) According to the sequence reported by GenBank (MT992618.1), the target fragment sequence was submitted to Beijing Zhongmei Taihe Company for codon optimization and synthesis. The synthesized gene was constructed on the PET-28a vector, and the 5' and 3' ends of the A33R protein gene were inserted into the BamH I and EcoR I restriction enzyme sites respectively. The plasmid was subjected to target gene sequencing and double digestion identification.

[0057] 2) Take out the BL21(DE3) competent cells, mix the competent cells with the recombinant plasmid, incubate on ice for 30 min, heat shock at 42 °C for 90 s, and then quickly incubate on ice for 3 min. Add 700 μl of LB liquid medium, and culture in a 37 °C shaker at 200 r / min for 60 min. Spread the culture solution on the LB solid medium with kanamycin resistance and culture overnight at 37 °C. Pick the strains, identify them by colony PCR with A33R protein specific primers, and send the positive strains to the sequencing company for sequencing and comparison.

[0058] 3) Inoculate the positive strains into the LB medium with kanamycin resistance and culture overnight at 37 °C at 200 r / min. The next day, inoculate the seeds into the LB medium with kanamycin resistance at a ratio of 1:100 and culture at 37 °C at 200 r / min. When the OD 600nm of the bacterial solution reaches 0.6 - 0.8, add 0.2 mM IPTG for induction expression, adjust the temperature to 25 °C, and induce expression for 5 h. Centrifuge the bacteria at 4500 r / min for 30 min to collect the bacteria. Resuspend the bacteria with PBS at a ratio of 1:10, ultrasonically lyse the cells, and set the parameters as power 190 W, working for 5 s, and turning off for 10 s. Centrifuge to obtain the supernatant of the lysed bacterial solution, filter it through a 0.22 μM filter membrane, and then purify it by affinity chromatography on a nickel column and gel filtration chromatography on a molecular sieve. The protein content and purity are identified by SDS-PAGE.

[0059] Example 2. Screening of LSDV A33R protein-specific hybridoma cell lines

[0060] The screening of LSDV A33R protein-specific hybridoma cell lines includes the following steps:

[0061] 1) Use the A33R protein expressed and purified by the Escherichia coli expression system obtained in Example 1 as the immunogen, with a purity of not less than 80%, and adjust the antigen concentration to 100 μg / ml;

[0062] 2) The immunized animal is a BALB / c mouse (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.). Immunize continuously 4 times, with an interval of 14 days each time. The first 3 times use the multi-point subcutaneous immunization method, and the 4th time uses the intraperitoneal injection immunization method. Inject 10 μg of A33R protein into each mouse each time;

[0063] 3) Seven days after the last immunization, mouse tail blood was collected to isolate serum, and then detected by indirect ELISA. After the titer was >1:50000, spleen cells of the immunized animals were isolated and fused with myeloma cells SP2 / 0 in good growth state, and hybridoma cells were obtained by screening with HAT selective medium;

[0064] 4) The hybridoma cell supernatant was screened for specific positive clones by indirect ELISA method. After detection, a monoclonal cell line secreting LSDV-12D1 was finally obtained, which could specifically react with LSDV A33R protein. Specific operation steps: Dissolve LSDV A33R protein in 100 μl of carbonate solution with pH 9.6 and dilute the concentration to 2 μg / ml, then add it to a 96-well polystyrene ELISA plate, 100 μl per well, and place it at 2-8 °C for 8-12 hours to allow the specific monoclonal antibody to fully bind to the ELISA plate. Then add 300 μl / well of PBS buffer containing 10 mg / ml casein with pH 7.4, and perform blocking treatment at 37 °C for 2-3 hours. After centrifuging to dryness, wait for the ELISA plate to dry and seal it with aluminum foil, and store it at 2-8 °C for later use.

[0065] Take the cell culture supernatant and add it to the ELISA plate coated with viral antigen, react at 37 °C for 30 minutes, wash the plate 4 times with washing solution (0.01 M phosphate buffer containing 0.8%-1.2% (ml / ml) Tween-20, diluted 20 times with double-distilled water before use). After patting dry, add 1:5000 diluted rabbit anti-mouse IgG-HRP label (purchased from Sigma, USA) to each well, react at 37 °C for 30 minutes, wash with the washing solution 4 times, pat dry, and add 50 μl each of substrate solution A (citrate phosphate buffer containing 0.6 mg / ml urea hydrogen peroxide) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution) to each well of the substrate working solution, and react at 37 °C in the dark for 15 minutes. Add 50 μl of termination solution (2 mol / L sulfuric acid solution) to each well, shake well to terminate the reaction. Measure the OD 450nm value within 15 minutes. Using the absorbance value > negative control (i.e., washing plate culture medium) × 2.1 times as the positive determination standard, measure the titer of specific monoclonal antibody in the cell culture supernatant. Finally, 1 specific cell clone was obtained, which had a strong signal reaction with LSDV A33R protein, and this clone was numbered LSDV-12D1.

[0066] Example 3: Gene sequencing of specific hybridoma cell line of bovine nodular dermatitis, establishment of monoclonal antibody recombinant expression system and purification of monoclonal antibody

[0067] Gene sequencing of a specific hybridoma cell line for lumpy skin disease, establishment of a monoclonal antibody recombinant expression system, and purification of monoclonal antibodies, including the following steps:

[0068] 1) DNA extraction, PCR, and sequence determination of specific positive clone hybridoma cell lines:

[0069] ① DNA extraction of specific positive clone hybridoma cell lines: Take 250 ml of hybridoma cell suspension in a 1.5 ml EP tube, add 200 μl of lysis buffer, shake well and let stand for 5 min, add 75 μl of protein removal solution, shake well, and centrifuge at 12000×g for 5 min. Transfer the supernatant to a new 2 ml EP tube, add 300 μl of isopropanol (1% glacial acetic acid), invert up and down 6 - 8 times, mix well and transfer to a new 2 ml EP tube, centrifuge at 6000×g for 1 min, discard the filtrate, wash with 75% DEPC ethanol, and centrifuge. Discard the ethanol, dry, and dissolve the DNA with 20 μl of RNase - free water.

[0070] ② PCR reaction and cloning and sequencing of its products: Design universal primers for the variable regions of the heavy and light chains, and the sequence information is as follows:

[0071] Table 1 Universal primers for variable regions of heavy and light chains

[0072] Name Sequence (5’-3’) <![CDATA[V H -1 (Forward)]]> GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG <![CDATA[V H -2 (Reverse)]]> ATGTCGACTGAGGAGACGGTGACCAGGGTGCC <![CDATA[V L -1 (Forward)]]> GTGAATTCATGGACATTGTGATGACCCAGTCTCC <![CDATA[V L -2 (Reverse)]]> CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC

[0073] Use the amplification primers to amplify the target fragment. After amplification, recover the fragment by gel extraction, then ligate the vector for sequence determination to obtain the sequence information of the variable regions of the heavy and light chains of the monoclonal antibody.

[0074] The monoclonal antibody LSDV - 12D1 contains the heavy - chain variable region LSDV - 12D1 - V H and the light - chain variable region LSDV - 12D1 - V L The amino acid sequence of its LSDV - 12D1 - V H is shown as positions 1 - 137 of SEQ ID No.1 in the sequence listing; the amino acid sequence of its LSDV - 12D1 - V L is shown as positions 1 - 131 of SEQ ID No.2 in the sequence listing.

[0075] The heavy - chain variable region LSDV - 12D1 - V H and the light - chain variable region LSDV - 12D1 - V L are both composed of complementarity - determining regions and framework regions; the complementarity - determining regions of the LSDV - 12D1 - V H and the LSDV - 12D1 - V L are both composed of CDR1, CDR2, and CDR3; the complementarity - determining regions of the LSDV - 12D1 - VH The amino acid sequence of CDR1 is shown as the amino acids at positions 50 - 54 of SEQ ID No.1; the LSDV-12D1-V H The amino acid sequence of CDR2 is shown as the amino acids at positions 69 - 85 of SEQ ID No.1; the LSDV-12D1-V H The amino acid sequence of CDR3 is shown as the amino acids at positions 118 - 126 of SEQ ID No.1; the LSDV-12D1-V L The amino acid sequence of CDR1 is shown as the amino acids at positions 43 - 58 of SEQ ID No.2; the LSDV-12D1-V L The amino acid sequence of CDR2 is shown as the amino acids at positions 74 - 80 of SEQ ID No.2; the LSDV-12D1-V L The amino acid sequence of CDR3 is shown as the amino acids at positions 113 - 121 of SEQ ID No.2.

[0076] 2) Synthesis of the gene sequences of specific monoclonal antibodies and establishment of a recombinant expression system

[0077] ① Synthesis of gene sequences: According to the sequences of the heavy and light chain variable regions of the monoclonal antibody LSDV-12D1 that have been measured, the sequences of the murine antibody heavy and light chain constant regions were supplemented to the variable region part, and then sent to Beijing Zhongmei Taihe Company for the synthesis of gene sequences and codon optimization for insect cells. The nucleotide sequence of the heavy chain variable region of LSDV-12D1 is shown as SEQ ID No.3 in the sequence listing, and the nucleotide sequence of the light chain variable region of LSDV-12D1 is shown as SEQ ID No.4 in the sequence listing. The antibody subtype IgG2a was selected.

[0078] ② Construction of shuttle vectors: According to the sequence information of the heavy and light chains and the sequence information of the pFastBacdual (purchased from ThermoFisher, catalog number 10712024) vector, corresponding primers were designed (the sequences are shown in Table 2 below), and the full-length fragments of the heavy and light chains were amplified. After gel extraction, they were ligated into the pFastBacdual vector by homologous recombination. The pFastBacdual vector contains two promoters, namely the PH promoter and the P10 promoter, and contains the GP67 signal peptide sequence information behind the PH promoter sequence, and the HDM signal peptide sequence information behind the P10 promoter sequence. After ligation into the vector, sequence determination was performed to ensure the accuracy of the sequence.

[0079] Table 2 Primer sequence information for expression vector construction

[0080] Name Sequence (5’-3’) 12D1-HF <![CDATA[TCATACATCTACGCGGCC GCTAGC ATGAAGTGTTCGTGGGT]]> 12D1-HR <![CDATA[TCCCCCATCTCCC GGTACC CGCCGAAACTGTTACGA]]> 12D1-LF <![CDATA[CTGCCTTTGCGGCGGAT GAATTC ATGAAACTCCCGGTGC]]> 12D1-LR <![CDATA[CTAGTACTTCTCGAC AAGCTT TTTTATCTCGAGCTT]]>

[0081] ③ Screening and extraction of recombinant Bacmid: The constructed shuttle vector was transformed into DH10Bac competent cells, and then spread on KTG triple-antibody plates (kanamycin, gentamicin, tetracycline) containing Bluo-gal and IPTG. After culturing in a 37°C incubator for 48 h, white colonies were picked and identified using M13 primers. Completely negative clone bacteria were selected for shaking culture and plating. After screening three times, Bacmid was extracted according to the instructions of the TIANGEN plasmid miniprep kit, and then the concentration was measured using Nanodrop.

[0082] ④ Rescue of recombinant baculovirus: Before transfection, SF9 cells with a density of 2×10 6 were seeded in six-well plates. 5 μg of recombinant Bacmid was taken for transfection, and the amount of transfection reagent used was 8 μl. The medium was changed 4 - 6 h after transfection, and the cells were cultured in a 28°C incubator. After 72 h, the amplified P1 generation virus was harvested, and the P2 generation virus was amplified using the same method. The amplification of the P3 generation virus was carried out by shaking flask amplification, and the virus inoculation ratio was 1:100.

[0083] 3) Expression and purification of specific monoclonal antibody: The supernatant was collected after the P3 generation virus was amplified and cultured for 48 h, and seeded at a ratio of 1:5 into High Five suspension cells with a density of 2×10 6 . After culturing in a 28°C incubator for 48 h, the supernatant was taken after centrifugation at 8000 r / min for 1 h and then filtered through a 0.22 μm filter membrane for standby. The Protein A pre-packed column was equilibrated with a Na3PO4 solution with a pH of 7.0 for 3 - 5 column volumes, and then the cell supernatant was bound to the Protein A pre-packed column. After the sample binding was completed, it was eluted with a Glycine-HCL eluent with a pH of 3.0 to obtain the purified LSDV-specific monoclonal antibody LSDV-12D1. The concentration was measured using Nabodrop. The results showed that the concentration of the monoclonal antibody secreted by LSDV-12D1 was 4.17 mg / ml.

[0084] Example 4. Preparation of a blocking ELISA antibody detection kit for bovine nodular dermatitis

[0085] 1) Preparation of an antigen-coated plate using purified A33R protein of LSDV: The purified protein was diluted with a carbonate solution at pH 9.6 to a coating working solution of 1 μg / ml, and then added to a 96-well polystyrene ELISA plate, 100 μl / well. It was placed at 2 - 8°C for 8 - 12 hours to allow the coated antigen to fully bind to the ELISA plate. Then, a PBS buffer solution containing 10 mg / ml casein at pH 7.4 was added at 300 μl / well, and the plate was blocked at 37°C for 2 - 3 hours. After discarding the liquid, the ELISA plate was dried and stored sealed at 2 - 8°C.

[0086] 2) Preparation of Horseradish Peroxidase-Labeled LSDV-Specific Monoclonal Antibody LSDV-12D1

[0087] Couple the LSDV-specific monoclonal antibody LSDV-12D1 with horseradish peroxidase (HRP) using the glutaraldehyde oxidation method, dialyze thoroughly with PBS buffer at pH 7.4, add an equal volume of high-quality glycerol, and store at -20°C or below. The specific steps are as follows:

[0088] ① Dissolve 5 mg of HRP in 0.2 ml of 0.1 mol / L PBS buffer at pH 6.8 containing 1.25% glutaraldehyde, couple at room temperature for 18 hours, and dialyze thoroughly to remove excess glutaraldehyde;

[0089] ② Add normal saline to 1 ml, then add 2.5 mg of purified LSDV-specific monoclonal antibody and 0.1 ml of 1 mol / L carbonate buffer at pH 9.6, and place at 2 - 8°C for 24 hours;

[0090] ③ Add 0.1 ml of 0.3 mol / L lysine solution and place at room temperature for 2 hours;

[0091] ④ Dialyze thoroughly with PBS buffer at pH 7.4, remove the precipitate by centrifugation, and the supernatant is the enzyme conjugate. Dilute it with the enzyme-labeled diluent at a certain ratio to obtain the working solution of the enzyme-labeled substance (0.5 μg / ml).

[0092] 3) Positive control serum: Use the inactivated LSDV vaccine-immunized bovine serum as the positive control serum for the kit (1 tube, 1.5 ml / tube).

[0093] 4) Negative control serum: Use the bovine serum without LSDV pathogen and without vaccine vaccination as the negative control serum for the kit (1 tube, 1.5 ml / tube).

[0094] 5) Preparation of sample diluent: Prepare a 0.01 M phosphate buffer at pH 7.4 containing 5 mg / ml casein, 1 bottle (24 ml / bottle).

[0095] 6) Preparation of substrate solution A: Prepare a citrate phosphate buffer containing 0.6 mg / ml urea hydrogen peroxide (1 bottle, 12 ml / bottle).

[0096] 7) Preparation of substrate solution B: Prepare a 0.2 mg / ml tetramethylbenzidine (TMB) solution (1 bottle, 12 ml / bottle).

[0097] 8) Preparation of 20-fold concentrated washing solution: It is a 0.01M phosphate buffer solution with a pH value of 7.4 containing 0.8% - 1.2% (ml / ml) of Tween-20 (50 ml / bottle, 2 bottles).

[0098] 9) Preparation of termination solution: 2 mol / L sulfuric acid solution (1 bottle, 12 ml / bottle).

[0099] 10) According to needs, the kit can also include sample dilution plates (2 pieces, 96 wells / piece) for diluting samples.

[0100] Example 5. Usage method of the blocking ELISA antibody detection kit for bovine nodular dermatitis

[0101] 1) Equilibration: Take out the kit from the refrigerated environment and equilibrate it at room temperature for 30 min for standby; mix the liquid reagents well before use.

[0102] 2) Solution preparation: Dilute the concentrated washing solution 20-fold with distilled water or deionized water to obtain the washing buffer solution;

[0103] 3) Sample dilution: Dilute the serum to be tested 2-fold with the sample diluent in the serum dilution plate. The negative and positive control sera have been diluted and can be used directly.

[0104] 4) Sample addition: Take out the required strips, put the remaining strips into an aluminum foil bag and seal it, and store it at 2 - 8°C for standby. Add the diluted serum to be tested, negative control serum, and positive control serum to the antigen-coated plate, 100 μl / well. Set 1 well for each serum to be tested, and set 2 wells for both negative and positive controls. The time span during the sample addition process should be as short as possible. As shown in the following for sample addition: N: indicates adding negative control serum; P: indicates adding positive control serum; S1, S2, S3, S4, etc. indicate adding each serum to be tested. Figure 1 Shown as follows for sample addition: N: indicates adding negative control serum; P: indicates adding positive control serum; S1, S2, S3, S4, etc. indicate adding each serum to be tested.

[0105] 5) Incubation: Mix well by shaking, place it in a 37°C incubator, and react for 60 min.

[0106] 6) Plate washing: Discard the reaction solution, add 300 μl of the diluted washing buffer solution to each well, soak for 15 s, discard the washing solution, wash the plate continuously 4 times and then pat dry.

[0107] 7) Enzyme addition: Add 100 μl of the working solution of the enzyme-labeled substance prepared in Example 4 to each well.

[0108] 8) Incubation: Place it in a 37°C incubator and react for 30 min.

[0109] 9) Plate washing: Discard the reaction solution, add 300 μl of the diluted washing buffer solution to each well, soak for 15 s, discard the washing solution, wash the plate continuously 4 times and then pat dry.

[0110] 10) Color development: Add 100 μl of substrate working solution to each well (mix equal amounts of substrate solution A and substrate solution B to obtain the substrate working solution, prepare it freshly before use), shake well, place it in an incubator at 37 °C, and react for 15 min in the dark.

[0111] 11) Add 50 μl of color development stop solution to each well, shake well to terminate the reaction, and measure the results within 15 minutes.

[0112] 12) Conditions for a valid test: OD of the negative control 450nm values should all be ≥ 1.0. The blocking rate of the positive control wells should be ≥ 50%.

[0113] 13) Judgment: Measure the OD of each well 450nm values on an ELISA reader. Blocking rate = 100% * (1 - OD of the sample 450nm value / mean OD of the negative control 450nm ). By calculating the blocking rate of each sample, determine the presence or absence of the antibody. Negative: blocking rate ≤ 40%; Positive: blocking rate ≥ 50%; Suspected: 40% < blocking rate < 50%.

[0114] Example 6. Sensitivity test

[0115] Use 3 batches of blocking ELISA antibody detection kits for bovine nodular dermatitis (batch numbers ZM202201, ZM202202, ZM202203) prepared according to the method of Example 4, and detect 50 portions of inactivated bovine nodular dermatitis vaccine immune sera according to the usage method of Example 5. The experimental results are shown in Table 3. A total of 47 portions were detected by the kit of the present invention, and 3 portions were not detected. The results show that the sensitivity of the kit to 50 portions of vaccine immune sera is 94.0%.

[0116] Table 3. Sensitivity test results

[0117] Kit Lot Number Detection Rate Sensitivity ZM202201 47 / 50 94.0％ ZM202202 47 / 50 94.0％ ZM202203 47 / 50 94.0％

[0118] Example 7. Specificity test

[0119] 1. Use 3 batches of blocking ELISA antibody detection kits for bovine nodular dermatitis (batch numbers ZM202201, ZM202202, ZM202203) prepared according to the method of Example 4, and detect 50 portions of healthy bovine sera, 2 portions of bovine infectious rhinotracheitis positive sera (IBRV), 2 portions of bovine viral diarrhea positive sera (BVDV), 2 portions of foot-and-mouth disease virus type O (FMDV-O) positive sera, and 2 portions of foot-and-mouth disease virus type A (FMDV-A) positive sera respectively according to the usage method of Example 5.

[0120] The specific detection results of the kit are shown in the following table (Table 4). The detection results of 50 healthy bovine sera show that the specificity of the 3 batches of kits is 100.0%. The detection results of 2 bovine infectious rhinotracheitis positive sera (IBRV), 2 bovine viral diarrhea positive sera (BVDV), 2 foot-and-mouth disease virus type O (FMDV-O) positive sera, and 2 foot-and-mouth disease virus type A (FMDV-A) positive sera are all negative. Therefore, the specificity of the 3 batches of kits for the detection of these 8 relevant pathogen positive sera is 100%.

[0121] Table 4 Specific detection results

[0122]

[0123] 2. Use 3 batches of bovine nodular dermatitis blocking ELISA antibody detection kits (batches ZM202201, ZM202202, ZM202203) prepared by the method according to Example 4, and detect 5 sheeppox positive sera and 5 goatpox positive sera according to the usage method of Example 5.

[0124] The specific detection results of the kit are shown in the following table (Table 5). The detection results of 5 sheeppox positive sera and 5 goatpox positive sera are all positive. The detection method of the invention can be generally used to detect the serum antibody levels of sheeppox and goatpox.

[0125] Table 5 Detection results of the kit of the invention for sheeppox and goatpox positive sera

[0126]

Claims

1. A blocking ELISA antibody detection kit for lumpy skin disease of cattle, comprising an enzyme-linked reaction plate and an enzyme-labeled antibody; wherein, The enzyme-linked reaction plate is coated with LSDV A33R protein, and the enzyme-labeled antibody is a monoclonal antibody against LSDV A33R protein labeled with horseradish peroxidase; The monoclonal antibody against LSDV A33R protein is monoclonal antibody LSDV-12D1 that specifically binds to LSDV A33R protein, and contains heavy chain variable region LSDV-12D1-V H and light chain variable region LSDV-12D1-V L ; the LSDV-12D1-V H and LSDV-12D1-V L are both composed of complementarity-determining regions and framework regions; the complementarity-determining regions of the LSDV-12D1-V H and the LSDV-12D1-V L are both composed of CDR1, CDR2 and CDR3; The CDR1 of the LSDV-12D1-V H has an amino acid sequence as shown in amino acids 50 to 54 of SEQ ID No.1; The amino acid sequence of the CDR2 of LSDV-12D1-V H is shown as the amino acids at positions 69 to 85 of SEQ ID No.1; The amino acid sequence of the CDR3 of LSDV-12D1-V H is shown as the amino acids at positions 118 to 126 of SEQ ID No.1; The CDR1 of the LSDV-12D1-V L has an amino acid sequence as shown in amino acids 43 to 58 of SEQ ID No. 2; The amino acid sequence of the CDR2 of LSDV-12D1-V L is shown as the amino acids at positions 74 to 80 of SEQ ID No. 2; The amino acid sequence of the CDR3 of the LSDV-12D1-V L is shown as the amino acids at positions 113 to 121 of SEQ ID No.

2.

2. The bovine nodular dermatitis blocking ELISA antibody detection kit according to claim 1, wherein: The amino acid sequence of LSDV-12D1-V H is shown as positions 1 to 137 of SEQ ID No.1 in the sequence listing; the amino acid sequence of LSDV-12D1-V L is shown as positions 1 to 131 of SEQ ID No.2 in the sequence listing.

3. The bovine nodular dermatitis blocking ELISA antibody detection kit according to claim 2, characterized in that: The method for obtaining the enzyme-linked reaction plate is to dissolve the LSDV A33R protein in 100 μl of carbonate solution with a pH of 9.6, and then add it to a 96-well polystyrene enzyme-linked reaction plate, with 0.1 μg to 1 μg of LSDV A33R protein per well. Place it at 2-8 °C for 8-12 hours to allow the coated antigen to fully bind to the enzyme-linked reaction plate. Then, add PBS buffer containing 10 mg / ml casein at a rate of 300 μl / well and perform a blocking treatment at 37 °C for 2-3 hours. After centrifuging to dryness, store it sealed at 4 °C after the enzyme-linked reaction plate is dried.

4. The bovine nodular dermatitis blocking ELISA antibody detection kit according to claim 2, wherein: The kit also includes substrate solution A, substrate solution B, and termination solution; substrate solution A is a citrate phosphate buffer containing 0.6 mg / ml urea hydrogen peroxide, substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution, and when used, the two are mixed in a ratio of 1:1; the termination solution is a 2 mol / L sulfuric acid solution.

5. The bovine nodular dermatitis blocking ELISA antibody detection kit according to claim 2, characterized in that: The kit also includes sample diluent and 20-fold concentrated washing solution; the sample diluent is a 0.01 M phosphate buffer with a pH of 7.4 containing 5 mg / ml casein; the concentrated washing solution is a 0.01 M phosphate buffer with a pH of 7.4 containing 0.8% - 1.2% Tween-20; The bovine lumpy skin disease blocking ELISA antibody detection kit also includes positive control serum and negative control serum; the positive control serum is bovine serum collected after artificial infection with bovine lumpy skin disease; the negative control serum is bovine serum without bovine lumpy skin disease pathogens and without vaccination.

6. Use of the bovine nodular dermatitis blocking ELISA antibody detection kit according to any one of claims 1 to 5 in the preparation of a reagent for detecting a sample to be tested for bovine nodular dermatitis infection or vaccination, wherein, The test sample for vaccination is bovine serum immunized with ordinary attenuated vaccines or inactivated vaccines.

7. A monoclonal antibody that can specifically bind to LSDV A33R protein, which is any one of the following monoclonal antibodies: 1) Containing the heavy chain variable region LSDV-12D1-V H and the light chain variable region LSDV-12D1-V L ; The heavy chain variable region LSDV-12D1-V H and the light chain variable region LSDV-12D1-V L are both composed of complementarity-determining regions and framework regions; The complementarity-determining regions of the LSDV-12D1-V H and the LSDV-12D1-V L are both composed of CDR1, CDR2, and CDR3; The CDR1 of the LSDV-12D1-V H has an amino acid sequence as shown in amino acids 50 to 54 of SEQ ID No. 1; The amino acid sequence of the CDR2 of the LSDV-12D1-V H is shown as the 69th to 85th amino acids of SEQ ID No.1; The amino acid sequence of the CDR3 of the LSDV-12D1-V H is shown as the amino acids at positions 118 to 126 of SEQ ID No. 1; The CDR1 of the LSDV-12D1-V L has an amino acid sequence shown as amino acids at positions 43 to 58 of SEQ ID No. 2; The amino acid sequence of the CDR2 of the LSDV-12D1-V L is shown as the amino acids at positions 74 to 80 of SEQ ID No. 2; The amino acid sequence of the CDR3 of the LSDV-12D1-V L is shown as the amino acids at positions 113 to 121 of SEQ ID No. 2; 2) Containing a heavy chain variable region LSDV-12D1-V H and a light chain variable region LSDV-12D1-VL; the amino acid sequence of the LSDV-12D1-V H is shown as positions 1 to 137 of SEQ ID No.1 in the sequence listing; the amino acid sequence of its LSDV-12D1-V L is shown as positions 1 to 131 of SEQ ID No.2 in the sequence listing.

8. Use of the monoclonal antibody according to claim 7 in the preparation of a kit for detecting antibodies against bovine lumpy skin disease virus.

Images