A method for increasing the infection dose of porcine deltacoronavirus in vitro culture and its application

Abstract

The present invention discloses a method for increasing the infection amount of porcine deltacoronavirus in vitro. During the in vitro culture of PDCoV in PK-15 cells or IPEC-J2 cells, heavy metal cadmium is added, and the added concentration of heavy metal cadmium is 7.5 μM to 15 μM. Compared with the group without heavy metal cadmium treatment, the RNA content, protein expression level of PDCoV in the group with heavy metal cadmium added, and the titer of harvested progeny virus are significantly increased, and each index is about 2 to 3 times that of the blank control. The information of PDCoV-infected cells provided by the present invention enriches the proliferation mechanism of PDCoV and lays a foundation for subsequent research on the pathogenic mechanism of PDCoV. The method provided by the present invention can also be applied to the production of PDCoV vaccines.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal virus culture, and more specifically relates to a method for increasing the infection amount of porcine deltacoronavirus in vitro culture and its application. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is one of the enteropathogenic coronaviruses that have emerged in recent years and cause diarrhea in pigs, with strong pathogenicity and transmissibility. PDCoV is an enveloped single-stranded positive-sense RNA virus, belonging to the order Nidovirales, the family Coronaviridae, and the genus Deltacoronavirus. PDCoV can infect pigs of different ages, and neonatal piglets are most susceptible to PDCoV and have more severe diseases. It is mainly transmitted through the digestive tract (fecal-oral route), targets and infects the small intestine tissue of pigs, and causes neonatal piglets to present clinical symptoms such as severe vomiting, watery diarrhea, and dehydration, with a mortality rate as high as 30%-80%. Although pigs of older ages can recover and remain in a state of being virus-infected without showing symptoms after infection, when the body's immunity decreases, pigs of older ages can re-discharge the virus and cause the infection of the pig herd, seriously affecting the weight gain of pigs, reducing the feed conversion rate, resulting in low production efficiency, and causing serious economic losses to the pig industry.

[0003] At present, the pathogenic mechanism of PDCoV is still unclear, and there is no specific medicine. Traditional live attenuated vaccines and inactivated vaccines are the main prevention and control measures. Usually, the premise for a vaccine to produce a good immune effect is a high titer of the virus. However, most isolated wild strains have poor adaptability to cells in vitro and are difficult to culture in vitro. It is difficult to obtain a high titer of PDCoV, and a large amount of cell culture is required. Then, methods such as concentrating the virus are used to increase the titer of PDCoV. This is also the main difficulty faced in the current research on this virus, which restricts the research and development of PDCoV molecular biology to a certain extent and seriously hinders the research progress of PDCoV vaccines. Therefore, how to obtain a high titer of PDCoV in vitro culture to ensure the stability of the efficacy of the PDCoV vaccine produced still urgently requires further exploration and optimization of the virus in vitro culture methods and conditions. Summary of the Invention

[0004] Object of the Invention: The first object of the present invention is to provide a method for increasing the infection amount of porcine deltacoronavirus in vitro culture, which can obtain a high titer of PDCoV.

[0005] The second object of the present invention is to provide the application of the method for increasing the infection amount of porcine deltacoronavirus in vitro culture in increasing the expression amount of PDCoV viral protein, RNA content, virus titer, and vaccine production.

[0006] Technical solution: To achieve the above object, the present invention provides a method for increasing the infection amount of porcine deltacoronavirus in vitro culture, including the following steps of adding heavy metal cadmium during the in vitro culture of PDCoV.

[0007] Preferably, the concentration of the heavy metal cadmium is 7.5 μM to 15 μM.

[0008] The method for increasing the infection amount of porcine deltacoronavirus in vitro culture includes the following steps:

[0009] (1) Culturing porcine cells in cell growth DMEM medium;

[0010] (2) When the cell fusion reaches 70-90%, removing the original cell growth DMEM medium, replacing the fresh serum-free DMEM medium for the porcine cells, and adding heavy metal cadmium for culturing for 3-4 h;

[0011] (3) Discarding the cell supernatant, rinsing the porcine cells treated with heavy metal cadmium in step (2) with PBS buffer, replacing the fresh serum-free DMEM medium containing trypsin for the porcine cells, and infecting the porcine cells with PDCoV.

[0012] Preferably, the method for increasing the infection amount of porcine deltacoronavirus in vitro culture specifically includes the following steps:

[0013] (1) Laying porcine cells at 8×10 4 cells / mL in a 12-well cell culture plate, adding 1 mL of cell growth DMEM medium to each well, and culturing in an incubator at 37°C with 5% CO 2 ;

[0014] (2) When the porcine cells reach about 70-90% fusion, removing the original cell growth DMEM medium, adding 1 mL of fresh serum-free DMEM medium to each well in the cell culture plate, and adding heavy metal cadmium, and culturing in an incubator at 37°C with 5% CO 2 for 3 h to 4 h;

[0015] (3) Discarding the cell supernatant, rinsing the porcine cells treated with heavy metal cadmium in step (2) three times with PBS buffer, adding 1 mL of serum-free DMEM medium containing 2 μg / ml trypsin to each well of the cell culture plate, adding PDCoV with a multiplicity of infection MOI of 1, and continuing to culture at 37°C.

[0016] Preferably, the porcine cells are PK-15 cells or IPEC-J2 cells.

[0017] Preferably, the cell growth DMEM medium comprises 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0018] The present invention also provides an application of the method for increasing the in vitro culture infection amount of porcine deltacoronavirus in increasing the RNA content of PDCoV virus.

[0019] The present invention also provides an application of the method for increasing the in vitro culture infection amount of porcine deltacoronavirus in increasing the protein expression amount of PDCoV virus.

[0020] The present invention also provides an application of the method for increasing the in vitro culture infection amount of porcine deltacoronavirus in increasing the virus titer of PDCoV.

[0021] The present invention also provides an application of the method for increasing the in vitro culture infection amount of porcine deltacoronavirus in its vaccine production.

[0022] The present invention comprehensively utilizes techniques such as virology. First, the cytotoxicity of heavy metal cadmium is detected; the concentration of heavy metal cadmium without cytotoxicity is screened by fluorescence quantitative PCR (RT-PCR), and the concentration of heavy metal cadmium that can significantly increase the RNA content of PDCoV in vitro culture is identified; then, the concentration of heavy metal cadmium that can significantly increase the virus protein expression and progeny virus titer of PDCoV in vitro culture is further determined by Western blotting (WB) and virus plaque formation assay, respectively.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: (1) By using the method of the present invention, the virus infection amount can be significantly increased. When 7.5 μM - 15 μM heavy metal cadmium is added during the in vitro culture of PDCoV in PK-15 cells or IPEC-J2 cells, compared with the group without heavy metal cadmium treatment, the RNA content and protein expression of PDCoV in the group with heavy metal cadmium treatment are significantly increased, and the harvested progeny virus titer is significantly increased; (2) On the basis of not increasing additional production costs, the present invention can greatly increase the amount of progeny virus harvested per unit time, which is about 2 - 3 times that without cadmium treatment; (3) The PDCoV-infected cell information provided by the present invention enriches the PDCoV proliferation mechanism and provides a reference for subsequent research on the PDCoV pathogenesis mechanism. The method provided by the present invention can also be applied to the production of PDCoV vaccines. Description of the Drawings

[0024] Figure 1 is the cytotoxicity of heavy metal cadmium at different concentrations on PK-15 cells in the short term; ns indicates no significant difference, ** indicates p < 0.01;

[0025] Figure 2It is the long-term toxicity of heavy metal cadmium at different concentrations to PK-15 cells; ns indicates no significant difference, ** indicates p < 0.01;

[0026] Figure 3 It is the PDCoV RNA content in PK-15 cell culture; ** indicates p < 0.01;

[0027] Figure 4 It is the PDCoV viral protein content in PK-15 cell culture; Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as an internal reference for cells;

[0028] Figure 5 It is the PDCoV viral plaque formation assay in ST cell culture; Each viral plaque is a viral particle;

[0029] Figure 6 It is the cadmium concentration dependence of PDCoV infectivity in PK-15 cell culture; A: PDCoV RNA content under different cadmium concentrations; B: PDCoV viral protein content under different cadmium concentrations; C: Number of viral plaques under different cadmium concentrations; ** indicates p < 0.01;

[0030] Figure 7 It is the PDCoV infectivity in IPEC-J2 cell culture; A: PDCoV RNA content under different cadmium concentrations; B: PDCoV viral protein content under different cadmium concentrations; C: Number of viral plaques under different cadmium concentrations; ** indicates p < 0.01. Detailed implementation manners

[0031] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0032] PK-15 cells are preserved in the laboratory; IPEC-J2 cells are from the University of Pennsylvania in the United States; ST cells are preserved in the laboratory.

[0033] Example 1 Identification of short-term toxicity of heavy metal cadmium to PK-15 cells

[0034] (1) Seed PK-15 cells at 1×10 4 cells / mL in a 96-well cell culture plate, add 100 μL of DMEM medium (Shanghai Yuanpei Biotechnology Co., Ltd., product number L110KJ) containing 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin (Gibco, USA) to each well, and culture in an incubator at 37 °C with 5% CO 2 2.

[0035] (2) When the cell fusion reaches 70 - 80%, remove the original DMEM medium, and add 1 mL of fresh serum-free DMEM medium to each well of the cell culture plate. Add cadmium, a heavy metal with a concentration of 1.5 μM (product number 202908, Sigma Company, USA), and culture in an incubator at 37°C with 5% CO 2 for 3 h;

[0036] In addition, experimental groups with cadmium concentrations of 7.5, 15, 30, 60, and 150 μM respectively, and a blank control group without adding cadmium were set up;

[0037] (3) Remove the original DMEM medium, and add 100 μL of serum-free DMEM medium to each well of the cell culture plate; add 10 μL of CCK-8 Solution reagent (product number A311, Novoprotein Co., Ltd., Nanjing, China), and culture in an incubator at 37°C with 5% CO2 for 3 - 4 h.

[0038] Cell cytotoxicity was identified according to the operation instructions, and the results were as Figure 1 shown. The activity of the blank control cells without cadmium was 100%. Compared with the blank control, when the cadmium concentration ≤ 30 μM, there was no significant difference in cell activity CCK8, that is, there was no cytotoxicity, and it could be used in the subsequent examples.

[0039] Example 2 Identification of the long-term toxicity of cadmium to PK-15 cells

[0040] The steps were the same as those in Example 1, except that in step (2), the cells were cultured in an incubator at 37°C with 5% CO 2 for 24 h.

[0041] The results were as Figure 2 shown. The activity of the blank control cells without cadmium was 100%. Compared with the blank control, when the cadmium concentration ≤ 15 μM, there was no significant difference in cell activity CCK8, that is, there was no cytotoxicity, and it could be used in the subsequent examples.

[0042] Example 3 Effect of cadmium on the PDCoV RNA content in the culture of PK-15 cells

[0043] (1) Seed PK-15 cells at 8×10 4 cells / mL in a 12-well cell culture plate, and add 1 mL of DMEM medium (product number L110KJ, Shanghai Yuanpei Biotech Co., Ltd.) containing 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin (Gibco Company, USA), and culture in an incubator at 37°C with 5% CO 2 ;

[0044] (2) When the cell fusion reaches 70-90%, remove the original DMEM medium, add 1 mL of fresh serum-free DMEM medium to each well of the cell culture plate, add heavy metal cadmium with a concentration of 1.5 μM (product number 202908, Sigma, USA), and culture in a 37 °C 5% CO 2 incubator for 3 h;

[0045] Set up a blank control group without adding heavy metal cadmium;

[0046] (3) Discard the cell supernatant, wash the cells three times with phosphate buffer PBS, add 1 mL of serum-free DMEM medium containing 2 μg / ml trypsin to each well of the cell culture plate; add PDCoV (CHN-GD16-05 strain, GenBank accession number KY363868.1) with a multiplicity of infection MOI of 1, and continue to culture in a 37 °C 5% CO 2 incubator;

[0047] (4) When the virus causes cytopathic effect in PK-15 cells; discard the cell supernatant, wash the cells three times with PBS, use RNA extraction reagent TRIzol (TaKaRa, Dalian) to collect the cells, extract the total RNA of PDCoV-infected cells, and use HiScript Q RTSuperMix for qPCR (+gDNA wiper) reverse transcription kit (Vazyme, Nanjing) to generate complementary DNA (cDNA) as the RT-PCR template; since the nucleocapsid protein (N) gene of PDCoV is often used to represent the viral RNA content. Use Vazyme AceQ qPCR SYBR Green Master Mix reagent, use glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal reference in cells, normalize the viral RNA with GAPDH mRNA, and perform relative quantitative RT-PCR on the PDCoV NRNA content by 2 -△△CT method; the primers and reaction system are shown in Table 1 and Table 2. Use an ABI fluorescence quantitative PCR instrument (Applied Biosystems, USA), and the reaction program is as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 10 s, annealing and extension at 60 °C for 30 s, 40 cycles above; after amplification, perform melting curve analysis, and its program is: 95 °C for 15 s, 60 °C for 1 min; 95 °C for 15 s. Judge the specificity of the primers according to the specificity of the melting curve with a Tm of 85 ± 0.8 °C for amplification. Each test sample is detected 3 times in duplicate, and the average value is taken.

[0048] The results are as Figure 3As shown, compared with the treatment without cadmium heavy metal addition, the PDCoV RNA content under the treatment with 15 μM cadmium heavy metal was about 3.39 times that of the blank control, indicating that cadmium heavy metal can increase the PDCoV RNA content in PK-15 cell culture.

[0049] Table 1 Fluorescent quantitative PCR primer sequences

[0050] Primer Name Sequence (5’-3’) PDCoV-N forward CCCAGCTCAAGGTTTCAGAG PDCoV-N reverse ATTGGCACCAGTACGAGACC GAPDH forward TCATCATCTCTGCCCCTTCT GAPDH reverse GTCATGAGTCCCTCCACGAT

[0051] Table 2 Fluorescent quantitative PCR reaction system

[0052] Reagent Usage Amount 2×AceQ qPCR SYBR Green Master Mix 10μL PDCoV-N forward(10μM) 0.4μL PDCoV-N reverse(10μM) 0.4μL GAPDH forward(10μM) 0.4μL GAPDH reverse(10μM) 0.4μL cDNA(50ng) 2μL ddH2O Make up to 20μL

[0053] Example 4 Effect of cadmium heavy metal on the expression of PDCoV viral protein in PK-15 cell culture

[0054] Steps (1) to (3) are the same as in Example 3, except that:

[0055] (4) When the virus causes cytopathic effect in PK-15 cells, discard the cell supernatant, wash the cells three times with PBS to wash away the residual virus particles on the cell surface, discard the PBS, add 100 μL of cell lysate (Shanghai Beyotime Biotechnology Co., Ltd., product number P0013B) to obtain the whole cell lysate; centrifuge at 4 °C and 12,000 rpm for 15 min to obtain the supernatant of the cell lysate, add 5× protein loading buffer, boil the sample for 10 min and then centrifuge briefly; adjust the loading amount with the same content of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the standard, and perform sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE); transfer the protein sample to a 0.22 μm polyvinylidene fluoride membrane (PVDF, Merck Millipore, USA) at a constant voltage of 110 V for 1 h; block at room temperature for 1 h with TBST containing 5% (v / v) skim milk powder; use mouse anti-PDCoV N in our laboratory and mouse anti-GAPDH from Nanjing Biaode Biotechnology Co., Ltd. (product number MB001) as the primary antibodies and incubate overnight at 4 °C; wash three times with TBST, 10 min each time, and then use horseradish peroxidase (HRP)-labeled goat anti-mouse antibody (Nanjing Biaode Biotechnology Co., Ltd., product number BS12478) as the secondary antibody and incubate at room temperature for 1 h; wash three times with TBST, and use the enhanced chemiluminescence (ECL) kit (Suzhou Xinsaimi Biotechnology Co., Ltd., product number P10300) to develop the WB color of the protein levels of PDCoV N and GAPDH respectively.

[0056] The results are as Figure 4It is shown that under the condition of the same GAPDH content, compared with the treatment without cadmium heavy metal addition, the band thickness under the treatment of 15 μM cadmium heavy metal is about 3 times that of the treatment without cadmium heavy metal addition, indicating that cadmium heavy metal can significantly increase the content of PDCoV viral protein.

[0057] Example 5 Effect of Cadmium Heavy Metal on the Viral Titer of PDCoV Cultured in PK-15 Cells

[0058] Steps (1) to (3) are the same as in Example 3, except that:

[0059] (4) When the virus causes cytopathic effect in PK-15 cells, a virus titer experiment (virus plaque formation experiment) is carried out. Dilute the uninfected ST cells to 8×10 4 cells / mL and seed them in a 12-well cell culture plate, add 1 mL of DMEM medium to each well, and place it in an incubator at 37°C with 5% CO 2 2. After the cells reach 80-90% confluence, take the supernatant of the above-infected PK-15 cells and dilute it 10, 100, 1000, and 10000 times respectively, and inoculate it into the ST cells seeded in the 12-well cell culture plate. Add 500 μL of the diluted PK-15 cell supernatant to each well, and incubate it in an incubator at 37°C with 5% CO2 for 2 h. After discarding the supernatant, add 1 mL of 1% low melting point agar and let it solidify at room temperature. Place the 12-well cell culture plate in an incubator at 37°C with 5% CO 2 2. Another blank DMEM medium is used instead of the infected cell supernatant as a blank control. Observe the growth state of the cells once every 24 h for 1-3 d until obvious virus plaques appear in the cells and record and count the number of virus plaques in each treatment group.

[0060] After the virus destroys healthy cells, it will leave a trace, called a plaque. By detecting the plaque, relevant information such as the concentration (titer or virulence) and toxicity of the virus can be obtained. Comparing the above 4 dilution gradients, it is found that when there are more virus particles in the diluent, that is, when the supernatant of the infected PK-15 cells is diluted 10 and 100 times respectively, all the ST cells die and the experimental result of alternating live and dead cells cannot be formed; when there are fewer virus particles in the diluent, that is, when the supernatant of the infected PK-15 cells is diluted 10000 times, the plaque formation is not obvious and cannot be compared. Therefore, the plaque formed by infecting ST cells with the supernatant of PK-15 cells diluted 1000 times is selected as the best experimental result for comparison with the blank control.

[0061] The results are as Figure 5 shown. Compared with the treatment without cadmium heavy metal addition, the number of PDCoV virus plaques under the treatment of 15 μM cadmium heavy metal increases significantly, and the number is about 3 times that of the blank control, indicating that cadmium heavy metal can significantly increase the viral titer of PDCoV progeny cultured in PK15 cells.

[0062] Example 6: Effect of Heavy Metal Cadmium Dosage on the Infection Quantity of PDCoV in PK-15 Cell Culture

[0063] Steps (1) and (3) are the same as those in Example 3, with the differences being:

[0064] (2) When the cell fusion reaches 70-90%, remove the original DMEM medium, add 1 mL of fresh serum-free DMEM medium to each well of the cell culture plate, add heavy metal cadmium with a concentration of 1.5 μM (Sigma, USA, catalog number 202908), and culture in an incubator at 37°C with 5% CO 2 for 3 h;

[0065] Another experimental group with a heavy metal cadmium concentration of 7.5 μM and a blank control group without adding heavy metal cadmium were set up;

[0066] (4) When the virus causes cytopathic effect in PK-15 cells, according to the methods described in Examples 3, 4, and 5, detect the PDCoV RNA, protein, and virus titer in the PK-15 cell culture under the treatment of heavy metal cadmium with concentrations of 0, 7.5, and 15 μM, respectively.

[0067] The results are as Figure 6 shown. Compared with the blank control without adding heavy metal cadmium, the relative content of PDCoV RNA, protein content, and progeny virus titer (number of virus plaques) in the treatment groups with 7.5 μM and 15 μM heavy metal cadmium added were significantly increased. Among them, the various indicators of the 7.5 μM heavy metal treatment were about 2 times that of the blank control, and the various indicators of the 15 μM heavy metal treatment were about 3 times that of the blank control, indicating that heavy metal cadmium can increase the PDCoV RNA, protein, and progeny virus titer in PK-15 cell culture, and it is confirmed that 7.5-15 μM heavy metal cadmium can increase the infection quantity of PDCoV in PK-15 cell culture.

[0068] Example 7: Effect of Heavy Metal Cadmium on the RNA Content of PDCoV in IPEC-J2 Culture

[0069] IPEC-J2 is the main target cell in pigs infected with PDCoV. To verify whether heavy metal cadmium can also increase the infection quantity of PRRSV in IPEC-J2 culture, detect the PDCoV RNA, protein, and progeny virus titer after heavy metal cadmium treatment.

[0070] Steps (1) and (3) are the same as those in Example 3, and the cultured and infected porcine cells are changed to IPEC-J2, with other differences being:

[0071] When the IPEC-J2 cells are infected with the virus for 24 h, detect the PDCoV RNA, protein and progeny virus titer of 15 μM heavy metal cadmium in the IPEC-J2 cell culture according to the methods of Examples 3, 4 and 5 respectively.

[0072] The results are as Figure 7 shown. Compared with the blank control without heavy metal cadmium, the relative contents of PDCoV RNA, protein contents and progeny virus titers (the number of virus plaques) in the treatment group with 15 μM heavy metal cadmium added are significantly increased, and each index is about 3 times that of the blank control, indicating that heavy metal cadmium can increase the PDCoV RNA, protein and virus titers in the IPEC-J2 cell culture, and confirming that heavy metal cadmium can increase the infection amount of PDCoV cultured in IPEC-J2.

Claims

1. A method for increasing the infection amount of porcine deltacoronavirus in vitro culture Characterized in that, It includes the following steps: adding heavy metal cadmium during the process of culturing PK-15 cells or IPEC-J2 cells in vitro to produce PDCoV, and the concentration of the heavy metal cadmium is 7.5 μM to 15 μM.

2. The method for increasing the infection amount of porcine deltacoronavirus in vitro culture according to claim 1, Characterized in that, It includes the following steps: (1) Culturing porcine cells in a cell growth DMEM medium; the porcine cells are PK-15 cells or IPEC-J2 cells; (2) When cell fusion reaches 70-90%, remove the cell growth DMEM medium in step (1), replace the fresh serum-free DMEM medium for the porcine cells, and add heavy metal cadmium and culture for 3-4 h; (3) Discard the cell supernatant, wash the porcine cells treated with heavy metal cadmium in step (2) with PBS buffer, replace the fresh serum-free DMEM medium containing trypsin for the porcine cells, and infect the porcine cells with PDCoV.

3. The method for increasing the infection amount of porcine deltacoronavirus in vitro culture according to claim 2, Characterized in that, The cell growth DMEM medium in step (1) includes DMEM medium, heat-inactivated fetal bovine serum, penicillin, and streptomycin.

4. Application of the method for increasing the infection amount of porcine deltacoronavirus in vitro culture according to claim 1 in increasing the RNA content of PDCoV virus.

5. Application of the method for increasing the infection amount of porcine deltacoronavirus in vitro culture according to claim 1 in increasing the protein expression amount of PDCoV virus.

6. Application of the method for increasing the infection amount of porcine deltacoronavirus in vitro culture according to claim 1 in increasing the virus titer.

7. Application of the method for increasing the infection amount of porcine deltacoronavirus in vitro culture according to claim 1 in the production of PDCoV vaccine.

Images