Use of a substance that inhibits cdca2 in the manufacture of a medicament for treating melanoma

Abstract

The application provides application of a substance for inhibiting CDCA2 in preparation of a drug for treating melanoma and in preparation of a reagent for inhibiting PD-L1 expression of the melanoma. The application creatively finds that inhibition of CDCA2 can promote apoptosis of melanoma cells, inhibit proliferation and migration of the melanoma cells, and inhibit mRNA and protein expression levels of PD-L1, thereby providing a basis for determining a drug target point for treating melanoma, and having important clinical significance for improving prognosis of a melanoma patient.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the use of substances that inhibit cell division cycle associated 2 (CDCA2) in the preparation of drugs for treating malignant melanoma (MM). Background Technology

[0002] Malignant melanoma is a malignant tumor originating from neurospike melanocytes, characterized by rapid disease progression, poor treatment efficacy, high mortality, and poor prognosis. In recent years, the study of the molecular mechanisms of tumors has gradually become one of the hottest topics in basic tumor research. Over the past few decades, researchers have discovered multiple gene mutations and abnormal activation of cell signaling pathways in melanoma, which has promoted the development of targeted therapy and immunotherapy. In 2011, the molecularly targeted therapy drug BRAF inhibitor vemurafenib and the immunotherapy drug CTLA-4 monoclonal antibody ipilimumab were approved by the US FDA for the treatment of MM. In 2013 and 2014, the FDA approved the molecularly targeted drugs MEK inhibitor trametinib and immune checkpoint inhibitor PD-1 monoclonal antibodies (nivolumab and pembrolizumab) for the clinical treatment of melanoma. Although these drugs have revolutionized melanoma treatment to some extent and improved the prognosis of melanoma patients, the limited range of applicable patients and the emergence of drug resistance mean that melanoma treatment still faces significant challenges. Therefore, further exploring the regulatory mechanisms of melanoma development and progression or the immunosuppressive microenvironment, and identifying potential drug targets, is of great clinical significance for improving the prognosis of melanoma patients. Summary of the Invention

[0003] In order to overcome the shortcomings of the prior art, the present invention provides the use of substances that inhibit CDCA2 in the preparation of drugs for treating melanoma.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] The first aspect of the present invention is to provide the use of a substance that inhibits CDCA2 in the preparation of a medicament for treating melanoma.

[0006] Furthermore, the substances that inhibit CDCA2 include at least one of the following:

[0007] Small molecule compounds that specifically inhibit CDCA2;

[0008] Interfering molecules that specifically interfere with CDCA2 gene expression;

[0009] Gene editing reagents that specifically knock out the CDCA2 gene;

[0010] Antibodies or ligands that specifically bind to the protein encoded by the CDCA2 gene.

[0011] A second aspect of the invention is to provide the use of a substance that inhibits CDCA2 in the preparation of a reagent that inhibits PD-L1 expression in melanoma.

[0012] Furthermore, the substances that inhibit CDCA2 include at least one of the following:

[0013] Small molecule compounds that specifically inhibit CDCA2;

[0014] Interfering molecules that specifically interfere with CDCA2 gene expression;

[0015] Gene editing reagents that specifically knock out the CDCA2 gene;

[0016] Antibodies or ligands that specifically bind to the protein encoded by the CDCA2 gene.

[0017] A third aspect of the present invention is the use of substances that block the CDCA2-AURKA pathway in the preparation of reagents that inhibit PD-L1 expression in melanoma.

[0018] Furthermore, the substances that block the CDCA2-AURKA pathway include at least one of the following:

[0019] Substances that inhibit CDCA2 expression; and

[0020] Substances that inhibit AURKA expression.

[0021] A fourth aspect of the present invention is to provide a medicament for treating melanoma, comprising a substance that inhibits CDCA2 and a pharmaceutically acceptable carrier or excipient.

[0022] Furthermore, the substances that inhibit CDCA2 include at least one of the following:

[0023] Small molecule compounds that specifically inhibit CDCA2;

[0024] Interfering molecules that specifically interfere with CDCA2 gene expression;

[0025] Gene editing reagents that specifically knock out the CDCA2 gene;

[0026] Antibodies or ligands that specifically bind to the protein encoded by the CDCA2 gene.

[0027] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:

[0028] This invention creatively discovers that inhibiting CDCA2 can promote melanoma cell apoptosis, inhibit melanoma cell proliferation and migration, and inhibit the mRNA and protein expression levels of PD-L1, providing a basis for identifying drug targets for the treatment of melanoma and having important clinical significance for improving the prognosis of melanoma patients. Attached Figure Description

[0029] Figure 1 Figure A shows the results of high-throughput transcriptome sequencing screening for differentially expressed genes; Figure B shows the results of qPCR verification of endogenous expression of some differentially expressed genes; Figure C shows the high-content cell proliferation assay verifying the regulatory effect of knockdown of some differentially expressed genes on cell proliferation levels.

[0030] Figure 2 IHC staining confirmed the upregulation of CDCA2 expression in melanoma;

[0031] Figure 3 Figures A and B show the results of qPCR and WB validation of the CDCA2 knockdown model construction, respectively; Figure C shows that CDCA2 knockdown significantly inhibits melanoma cell proliferation.

[0032] Figure 4 Figure A shows that CDCA2 knockdown significantly promotes melanoma cell apoptosis, and Figure B shows that CDCA2 knockdown significantly inhibits melanoma cell migration.

[0033] Figure 5 Figure A shows the results of screening potential downstream targets of CDCA2 at the RNA level using transcriptome sequencing, and Figure B shows the results of screening potential downstream targets of CDCA2 at the protein level using proteomics analysis.

[0034] Figure 6 This showed that CDCA2 knockdown reduced the protein stability of AURKA in melanoma cells;

[0035] Figure 7 The results showed that MG132 treatment inhibited CDCA2-mediated regulation of AURKA protein expression;

[0036] Figure 8 This shows that CDCA2 knockdown promotes ubiquitination of AURKA;

[0037] Figure 9 Figure A shows the E3 ubiquitin ligase with AURKA as a substrate; Figure B shows that SMURF1 overexpression reduces the protein stability of AURKA; Figure C shows the protein-protein interaction between CDCA2 and SMURF1 verified by immunoprecipitation.

[0038] Figure 10 The results showed that CDCA2 knockdown suppressed the mRNA and protein expression levels of PD-L1;

[0039] Figure 11 The effect of the CDCA2-AURKA axis on PD-L1 was demonstrated. Detailed Implementation

[0040] This invention provides the application of substances that inhibit CDCA2 in the preparation of drugs for treating melanoma and in the preparation of reagents that inhibit PD-L1 expression in melanoma, providing a new direction for the treatment of melanoma.

[0041] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings to enable a better understanding of the invention. However, the following embodiments do not limit the scope of the invention.

[0042] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared according to conventional methods, unless otherwise specified.

[0043] Example 1

[0044] 1. CDCA2 molecular screening and clinically relevant validation

[0045] (1) High-throughput transcriptome sequencing was performed on 16 melanoma tumor tissues and 6 adjacent normal tissues:

[0046] RNA from 16 melanoma tissues and 6 adjacent normal tissues was sequenced using a gene chip hybridization system, stainer, and scanner from Affymetrix (California, USA). First, RNA was synthesized into one-stranded and two-stranded cDNA; these two strands were then transcribed in vitro to synthesize labeled cDNA. The concentration of cDNA was then determined spectrophotometrically, and single-stranded cDNA was synthesized by reverse transcription. After purification, the cDNA concentration was determined and converted into dUTP fragments and broken DNA strands. The fragmented cDNA was covalently ligated to biotin using Affymetrix's proprietary DNA labeling reagent. Finally, the cDNA was prepared into a hybridization cocktail, injected into a microarray, and hybridized and washed. After washing and staining, the samples were automatically scanned. Significant differences in gene expression profiles between melanoma and adjacent normal tissue samples were analyzed using Limma in R software. The p-value for significance was calculated using a linear model based on an empirical Bayesian distribution, and the Benjamini-Hochberg method was used to correct for the significance level (FDR). The EdgeR data package was used to process transcriptome expression profiles and perform differential expression analysis between groups. Genes with significantly upregulated or downregulated expression levels in melanoma tissues compared to adjacent normal tissues were screened based on a statistically significant difference in expression levels exceeding 2-fold (P < 0.05). Figure 1 (A)

[0047] (2) Among the DEGs with the highest upregulation levels, some genes (DLGAP5, ADAMDEC1, APOC1, SERPINA1, SULT1C2, GABBR1, CHAC2, CDCA2, PPM1H, W1PF1) were selected as candidate genes. On the one hand, qPCR was used to verify the endogenous expression of these genes in melanoma cells. On the other hand, corresponding gene knockout melanoma cell models were constructed and cell proliferation phenotypes were detected. The results showed that all candidate genes were expressed in melanoma cells. Figure 1 (B) Among them, the knockdown of CDCA2 has a significant inhibitory effect on the proliferation level of melanoma cells. Figure 1 (C)

[0048] (3) To investigate the expression level of CDCA2 in melanoma and its relationship with the malignancy of the tumor: The tissue microarray used was purchased from Xi'an Alina Biotechnology Co., Ltd. (T17-1430 TMA2 024), which contained 136 melanoma tissues and 181 benign melanocytic nevus tissues. Immunohistochemistry was performed on the tissue microarray T17-1430 TMA2 024 to detect the expression of CDCA2 in the tissue samples. After dewaxing the 5 μm paraffin-embedded tissue microarray, the antigen was extracted with citrate. The endogenous peroxidase in the tissue microarray was blocked with 3% H2O2 for 5 min, and then blocked with 5% serum for 15 min. The tissue microarray was incubated with primary antibody at 4℃ overnight, and then incubated with secondary antibody at 37℃ in an incubator (Bluepard, Shanghai, China) for 1 h. The microarray was washed 3 times with 1×PBST buffer, 5 min each time. The chip was incubated with DAB dye solution in the dark for 5 minutes, then incubated with hematoxylin (Baso Diagnostics Inc., Zhuhai, China) for 15 seconds. After rinsing off excess dye solution, the chips were mounted with neutral adhesive (China National Pharmaceutical Group Co., Ltd., Beijing, China). Positive cells and staining intensity were observed under a microscope (Olympus, Tokyo, Japan). Immunohistochemical scoring was calculated as positive cell score × staining intensity score. Higher scores correspond to higher protein expression. Figure 2 It is known that CDCA2 expression is upregulated in melanoma and is positively correlated with the degree of tumor malignancy.

[0049] 2. In vitro validation of the regulatory role of CDCA2 in melanoma progression.

[0050] (1) Cell model construction and cell phenotype detection: Based on the principle of RNA interference sequence design, RNA interference target sequences were designed using the target gene as a template, and then single-stranded DNA oligomers were synthesized. The target gene sequence and RNA interference target sequence are shown in Table 1 below. The single-stranded DNA oligomers were converted into double-stranded DNA oligomers, and then ligated with a linearized vector to form a recombinant vector. The recombinant vector and lentivirus carrying a fluorescent tag (green fluorescent protein) were co-transfected into 293T cells to obtain lentivirus containing the target gene interference sequence. Lentiviral virus infection of melanoma cells (2×10⁻⁶ cells) 5 Cells, A375, SK-MEL-28) Viral titer 1×10⁻⁶ 8 TU / mL for 20 h. Cell groups included: negative control group (controlled lentiviral infection, shCtrl) and CDCA2 knockdown group (shCDCA2). Cell phenotypes were analyzed in each group to clarify the regulatory role of CDCA2 in melanoma progression in vitro:

[0051] a. Cell model validation: The mRNA expression level of CDCA2 in each group of cells was detected by quantitative real-time polymerase chain reaction (qPCR), and the protein expression level of CDCA2 was detected by Western blot (WB) to determine the efficiency of cell model construction.

[0052] b. Cell proliferation level detection: Melanoma cells infected with lentivirus were digested with trypsin and resuspended during the logarithmic growth phase. Cells were transferred to 96-well plates, 1500 cells per well. The 96-well plates were scanned continuously for 5 days at the same time point using Celigo (Nexcelom Bioscience, Massachusetts, USA) to obtain images. Cells in the scanned images were counted using image analysis software, and cell growth curves were plotted for 5 consecutive days. The experiment was repeated 3 times.

[0053] c. Flow cytometry detection of apoptosis: When A375 and SK-MEL-28 cells reached 70% coverage, cells were collected and washed with D-Hanks buffer and pre-chilled 1× binding buffer at 4°C. Cells were resuspended in 200 μL of 1× binding buffer. 10 μL of Annexin V-APC (eBioscience, California, USA) was added to the cell suspension, and the cells were incubated in the dark at room temperature for 15 min. Apoptosis was detected using flow cytometry.

[0054] d. Cell migration and invasion phenotype detection: Transwell assay was used to detect the migration rate of cells in each group. Following the instructions of the Transwell kit (3422, Corning Company, NY, USA), Transwell assays were performed on A375 and SK-MEL-28 cells infected with lentivirus to assess cell migration ability. 1×10⁻⁶ 5 Cells were infiltrated in serum-free medium and added to the upper chamber of a Transwell apparatus. The cell-added upper chamber was placed in the lower chamber, with 600 μL of culture medium (containing 30% fetal bovine serum). After 30 h, the culture medium was removed, and any untransferred cells were discarded. The upper chamber was then immersed in 400 μL of Giemsa staining solution (Dingguo Biotechnology, Shanghai, China) for 5 min. The upper chamber was washed several times with water and then air-dried. Cell migration was observed and photographed under a microscope.

[0055] Table 1. Target gene sequence and shRNA sequence used to knock out the CDCA2 gene.

[0056] Serial Number Target gene shRNA sequence (5'-3') CDCA2-1 TCTCCTAAAGTTGGTAGAATA (SEQ ID NO.1) ccggTCTCCTAAAGTTGGTAGAATActcgagTATTCTACCAACTTTAGGAGATTTTTg (SEQ ID NO.2) aattcaaaaaTCTCCTAAAGTTGGTAGAATActcgagTATTCTACCAACTTTAGGAGA (SEQ ID NO.3)

[0057] qPCR and WB results showed that the mRNA and protein expression of CDCA2 in melanoma cells A375 and SK-MEL-28 transfected with shCDCA2 lentivirus were significantly reduced, indicating the successful construction of the gene knockdown cell model. Figure 3 (AB). Subsequent cell phenotyping showed that CDCA2 knockdown significantly reduced the proliferation of melanoma cells ( ). Figure 3 (C) and migration ( Figure 4 (B) ability, while promoting apoptosis ( Figure 4 These results (including those from the Chinese A-group) further confirm the potential promoting effect of CDCA2 on melanoma progression.

[0058] Example 2

[0059] 1. Exploration and validation of downstream targets of CDCA2 in regulating melanoma progression.

[0060] a. Transcriptomics: Transcriptomics sequencing technology on the Illumina platform was used to analyze the transcriptomic expression profiles of melanoma cells in the shCtrl and shCDCA2 groups. The EdgeR language package was used for inter-group differential expression analysis. Differentially expressed genes (DEGs) were screened with a statistical significance of more than 2-fold difference in expression level between groups (up- or down-regulated) (P < 0.05). Based on this, downstream cell function / pathway enrichment analysis was performed.

[0061] b. Proteomics: The protein expression profiles of melanoma cells from the shCtrl and shCDCA2 groups were analyzed using ITRAQ technology, and differentially expressed proteins (DEPs) were screened using the same conditions as those used for transcriptomics.

[0062] Transcriptome sequencing was performed on melanoma cells from the shCtrl and shCDCA2 groups (3 v 3). Figure 5 (A) and ITRAQ proteomics analysis ( Figure 5 (B) The downstream regulatory factors of CDCA2 were explored at both the RNA and protein levels. Comprehensive analysis of the results revealed that CDCA2 has a significant positive regulatory effect on the mRNA level of PD-L1, which is known to play an important role in melanoma progression and immune escape. Simultaneously, CDCA2 also has the function of regulating AURKA expression levels at the protein level.

[0063] 2. Exploring the molecular mechanism by which CDCA2 regulates the stability and expression level of AURKA protein through ubiquitination.

[0064] a. Protein stability assay: A375 cells were infected with a lentivirus containing the shCDCA2 sequence. CHX (0.2 mg / mL) was added to the culture medium to inhibit translation, and cell lysates were prepared at specified time points (0, 2, 4, 8 h). Then, 20 μg of total protein was treated with Western blotting to assess AURKA protein levels.

[0065] b. Ubiquitination Analysis: After lentiviral infection of A375 cells for 24 h, MG-132 (20 μM) was added to the culture medium and co-incubated with the cells for 6 h. A375 cells were lysed to obtain total protein, and AURKA protein levels were detected by Western blotting. Cell lysates were incubated overnight at 4°C with an appropriate amount of antibody, followed by incubation with 20 μL microspheres at 4°C for 2 h. The bound protein complex was washed twice with IP lysis buffer and then subjected to Western blotting with ubiquitin antibody to detect ubiquitin levels.

[0066] Depend on Figure 6 It can be seen that CDCA2 knockdown significantly reduced the protein stability of AURKA in melanoma cells, and further investigation showed that the regulatory effect of CDCA2 on AURKA protein expression was severely inhibited after cells were treated with the proteasome inhibitor MG132. Figure 7 This suggests that CDCA2 may affect AURKA protein stability and expression levels through protein degradation mediated by the ubiquitin-proteasome system (UPS). We also examined the regulatory role of CDCA2 on AURKA ubiquitination levels, and the results were consistent with expectations: CDCA2 knockdown significantly promoted AURKA ubiquitination modification. Figure 8 ).

[0067] c. To further explore the pathway by which CDCA2 regulates AURKA ubiquitination, we first used the Ubibrowser online tool to predict the E3 ubiquitin ligase based on AURKA ( Figure 9 (A) and selected SMURF1, which had the highest probability, for verification. Similar tests showed that SMURF1 overexpression could significantly reduce the protein stability of AURKA. Figure 9 (B)

[0068] d. Immunoprecipitation assay: Total protein was extracted from A375 cells, and protein concentration was determined using a BCA protein assay kit (23225, HyClone-Pierce). Total protein and antibody were incubated overnight at 4°C, followed by incubation with 20 μL beads at 4°C overnight. The protein-antibody-bead complex was washed three times with IP lysis buffer, separated by SDS-PAGE, and then transferred to a PVDF membrane. Subsequent procedures were the same as for Western blot, and finally, chemiluminescence imaging was performed.

[0069] Depend on Figure 9 As can be seen from C, CDCA2 and SMURF1 have protein-protein interactions, which may be the molecular pathway by which CDCA2 ubiquitination mediated by SMURF1 is affected.

[0070] Example 3: CDCA2 regulates PD-L1 via AURKA, thereby affecting melanoma immune escape.

[0071] 1. The regulatory effect of CDCA2 on PD-L1 expression level was verified by qPCR and Western blotting. The results showed that CDCA2 knockdown significantly inhibited the mRNA and protein expression levels of PD-L1. Figure 10 ).

[0072] 2. Based on the principles of RNA interference sequence design, an RNA interference target sequence was designed using the AURKA target gene as a template, and then a single-stranded DNA oligomer was synthesized. The single-stranded DNA oligomer was converted into a double-stranded DNA oligomer, which was then ligated with a linearized vector to form the recombinant vector shAURKA. Primers were designed to amplify the CDCA2 target gene as a template, and the target gene fragment was prepared using OCR amplification. The target gene fragment was ligated with the linearized vector to form the recombinant vector OE-CDCA2. The recombinant vector and lentiviruses carrying fluorescent tags (green fluorescent protein for OE-CDCA2 and red fluorescent protein for shAURKA) were co-transfected into 293T cells to obtain lentiviruses containing the target gene interference sequence or the target gene fragment. The OE-CDCA2 and shAURKA lentiviruses were simultaneously used to infect melanoma cells (2 × 10⁻⁶ cells per cell line). 5 Cells, A375, SK-MEL-28) Viral titer 1×10⁻⁶ 8 TU / mL 20 h. The mRNA expression level of CDCA2 in each group of cells was detected by qPCR, and the protein expression level of CDCA2 was detected by Western blotting.

[0073] The results show that CDCA2 overexpression significantly upregulated PD-L1 mRNA and protein expression levels, while AURKA knockdown inhibited PD-L1 expression, demonstrating the regulatory role of the CDCA2-AURKA axis on PD-L1. Figure 11 ).

[0074] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. Use of a substance that blocks the CDCA2-AURKA pathway in the manufacture of a medicament for treating melanoma, characterized in that, The drug inhibits the expression of PD-L1; the substance blocking the CDCA2-AURKA pathway is shRNA capable of silencing or inhibiting the expression of the CDCA2 gene; the shRNA is encoded by two oligonucleotide chains as shown in SEQ ID NO: 2 and SEQ ID NO:

3. The drug inhibits the expression of PD-L1; the substance blocking the CDCA2-AURKA pathway is shRNA capable of silencing or inhibiting the expression of the CDCA2 gene; the shRNA is encoded by two oligonucleotide chains as shown in SEQ ID NO: 2 and SEQ ID NO:

3. The drug inhibits the expression of PD-L1; the substance blocking the CDCA2

Images