Use of miR-682 in the treatment or diagnosis of diabetes

Abstract

The application discloses application of miR-682 in treatment or diagnosis of diabetes, and miR-682 is significantly up-regulated in early life high-fat diet exposure mice. Meanwhile, it is proved through experiments that the level of miR-682 is inhibited to improve liver cell sugar metabolism, and it is indicated that the miR-682 inhibitor can be applied to treatment of diabetes. The application further provides a pharmaceutical composition for treating diabetes, a product for diagnosing or predicting whether a subject is suffering from diabetes, a system for diagnosing or predicting whether a subject is suffering from diabetes, and a method for screening a drug for treating or preventing diabetes for non-treatment and non-diagnosis purposes.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the application of miR-682 in the treatment or diagnosis of diabetes. Background Technology

[0002] Diabetes mellitus is a complex polygenic inherited disease resulting from the combined effects of genetic and environmental factors. The incidence of type 2 diabetes is steadily rising, accounting for over 95% of all diabetes cases. my country has the highest number of diabetes patients in the world. Diabetes and its various complications, including cardiovascular and retinopathy, seriously impact public health, causing a huge social burden and economic cost. Recent research has found that early life environment plays a significant driving role in the development of chronic diseases in adulthood. Early intervention targeting adverse early life environments is extremely important. As one of the major chronic diseases, early prevention and treatment of diabetes have significant value. Multiple large-scale epidemiological studies have shown that early prevention and early intervention can delay the onset of diabetes and improve the prognosis of cardiovascular complications.

[0003] MicroRNAs (miRNAs) are a class of endogenous small RNAs, approximately 20-24 nucleotides in length, that play a variety of important regulatory roles within cells. miRNAs are also closely related to glucose metabolism. Therefore, studying the correlation between miRNAs and glucose metabolism disorders caused by adverse environmental factors in early life, and identifying miRNA biomarkers associated with the development and progression of diabetes, is of great significance for elucidating the pathogenesis of diabetes and achieving early prevention and control of the disease.

[0004] Currently, the most widely used drug treatments for type 2 diabetes are insulin stimulants—sulfonylureas—and insulin sensitizers—biguanides. However, sulfonylureas only stimulate the pancreas to produce insulin; the sensitivity of insulin-producing target tissues is not effectively improved. Biguanides have a certain degree of nephrotoxicity. Long-term use keeps the pancreas under constant strain, eventually requiring external insulin to help lower blood sugar, which can further lead to partial or complete loss of pancreatic function. Simultaneously, repeated blood sugar rebounds increase blood viscosity and impair microcirculation, ultimately leading to complications affecting the heart, brain, kidneys, skin, and nerves. Therefore, exploring the potential molecular mechanisms and new therapeutic targets of type 2 diabetes is of great significance for diabetes treatment. Summary of the Invention

[0005] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solution:

[0006] This invention provides the use of miR-682 inhibitors in the preparation of medicaments for the treatment of diabetes.

[0007] Furthermore, the prepared drug is intended for oral administration, suppository administration, local contact administration, intravenous administration, parenteral administration, intraperitoneal administration, intramuscular administration, intralesional administration, intrathecal administration, intranasal administration, or subcutaneous administration.

[0008] Furthermore, the prepared drug is intended for oral administration or intraperitoneal injection.

[0009] Furthermore, the diabetes includes type 1 diabetes, type 2 diabetes, latent autoimmune diabetes in adults, mitochondrial diabetes, and gestational diabetes.

[0010] The term "treatment" refers to the administration of any therapeutic molecule that partially or completely reduces, improves, alleviates, inhibits, delays the onset of, reduces the severity of, and / or decreases the incidence of one or more symptoms or features of a particular disease, condition, and / or disorder. Such treatment may be directed to a subject who does not exhibit signs of the relevant disease, condition, and / or disorder and / or to a subject who exhibits only early signs of the disease, condition, and / or disorder. Alternatively, such treatment may be directed to a subject who exhibits one or more identified signs of the relevant disease, condition, and / or disorder.

[0011] In one embodiment of the invention, the individual is a human being. In one embodiment, the term "diabetes" refers to type 1 diabetes. In another embodiment, the term "diabetes" refers to type 2 diabetes. The terms "type 1 diabetes" and "type 2 diabetes" are well known in the art. In type 2 diabetes, insulin secretion is insufficient. Insulin levels are typically high, especially in the early stages of the disease, but peripheral insulin resistance and increased hepatic glucose production make insulin levels insufficient to normalize plasma glucose levels. Insulin production then declines, further exacerbating hyperglycemia.

[0012] Furthermore, the drug also includes pharmaceutically acceptable additives.

[0013] Furthermore, the additives include adjuvants, carriers, excipients, gliding agents, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, pH adjusters and / or buffers, solvents, surfactants, or emulsifiers.

[0014] Furthermore, the miR-682 inhibitor includes miR-682 antisense nucleic acid; the sequence of the miR-682 antisense nucleic acid is shown in SEQ ID NO:1.

[0015] The present invention provides a pharmaceutical composition for treating diabetes, the pharmaceutical composition comprising a therapeutically effective amount of a miR-682 inhibitor.

[0016] The term "therapeutic effective amount" refers to the amount of a therapeutic molecule that imparts a therapeutic effect to a treated subject based on a reasonable benefit / risk ratio applicable to any medical treatment. Therapeutic effects can be objective or subjective. Specifically, a "therapeutic effective amount" refers to the amount of a therapeutic molecule or composition that effectively treats, improves, or prevents a particular disease or ailment, or exhibits a detectable therapeutic or preventative effect, such as by improving disease-related symptoms, preventing or delaying the onset of the disease, and / or also reducing the severity or frequency of disease symptoms. The specific therapeutic effective amount (and / or unit dose) used for any particular subject can depend on a variety of factors, including the condition being treated and its severity; the activity of the specific agent used; the specific composition used; the subject's age, weight, general health condition, sex, and diet; the timing, route of administration, and / or rate of excretion or metabolism of the specific therapeutic molecule used; the duration of treatment; and similar factors well known in the medical field.

[0017] Furthermore, the miR-682 inhibitor includes miR-682 antisense nucleic acid; the sequence of the miR-682 antisense nucleic acid is shown in SEQ ID NO:1.

[0018] Furthermore, the diabetes includes type 1 diabetes, type 2 diabetes, latent autoimmune diabetes in adults, mitochondrial diabetes, and gestational diabetes.

[0019] The term "pharmaceutical composition" refers to any composition comprising at least one bioactive pharmaceutical agent. When used herein, the term "pharmaceutical composition" also refers to a composition comprising an active pharmaceutical ingredient to be delivered to a subject to achieve, for example, a therapeutic, preventative, diagnostic, inhibitory, or prognostic effect. In some embodiments, the pharmaceutical composition comprises an active pharmaceutical ingredient and a pharmaceutically acceptable carrier.

[0020] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable additives.

[0021] Furthermore, the additives include adjuvants, carriers, excipients, gliding agents, sweeteners, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, pH adjusters and / or buffers, solvents, surfactants, or emulsifiers.

[0022] In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including those suitable for administration in the following ways: oral administration, such as solutions (aqueous or non-aqueous solutions or suspensions), tablets (e.g., intended for absorption via the buccal, sublingual, and systemic routes), pills, powders, granules, or pastes for application to the tongue; parenteral administration, such as by subcutaneous, intramuscular, intravenous, or epidural injection, such as sterile solutions or suspensions, or sustained-release formulations; topical administration, such as creams, ointments, or controlled-release patches or sprays applied to the skin, lungs, or mouth; intravaginal or rectal administration, such as pessaries, creams, or foams; sublingual administration; ocular administration; transdermal administration; or nasal, pulmonary, and other mucosal surfaces.

[0023] As used herein, “pharmaceuticalally acceptable additive” means any inactive ingredient (e.g., a medium that suspends or dissolves an active compound) that is non-toxic and non-inflammatory in a subject. Typical additives include, for example: anti-adhesion agents, antioxidants, adhesives, coating agents, compression aids, disintegrants, dyes (pigments), softeners, emulsifiers, fillers (diluents), film-forming agents or coating agents, flavoring agents, fragrances, flow enhancers (flow improvers), lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners, or water for hydration. Additives include, but are not limited to: optionally substituted butylated hydroxytoluene (BHT), calcium carbonate, calcium hydrogen phosphate, calcium stearate, croscarmellose, croscarmellose polyvinylpyrrolidone, citric acid, croscarmellose, cysteine, ethyl cellulose, gelatin, optionally substituted hydroxypropyl cellulose, optionally substituted hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silica, sodium carboxymethyl cellulose, sodium citrate, sodium glycolate starch, sorbitol, starch (corn starch), stearic acid, stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol. Those skilled in the art will understand that a variety of reagents and materials can be used as additives.

[0024] This invention also provides the use of miR-682 inhibitors in the preparation of products for the prevention of diabetes.

[0025] Furthermore, the miR-682 inhibitor includes miR-682 antisense nucleic acid; the sequence of the miR-682 antisense nucleic acid is shown in SEQ ID NO:1.

[0026] Furthermore, the diabetes includes type 1 diabetes, type 2 diabetes, latent autoimmune diabetes in adults, mitochondrial diabetes, and gestational diabetes.

[0027] The present invention also provides the use of reagents for detecting miR-682 markers in samples in the preparation of products for diagnosing or predicting whether a subject has diabetes.

[0028] The term "subject" includes both human and non-human subjects, including birds and non-human mammals such as non-human primates, companion animals (such as dogs and cats), livestock (such as pigs, sheep, and cattle); and non-domesticated animals such as large felines. The term "subject" applies regardless of the stage of an organism's life cycle. Therefore, depending on the organism (i.e., whether the organism is a mammal or a bird, whether domesticated or wild), the term "subject" applies to organisms in the womb or in an egg.

[0029] Furthermore, the sequence of the miR-682 marker is shown in SEQ ID NO:2.

[0030] Furthermore, the samples include tissue samples, primary or cultured cells or cell lines, cell supernatant, cell lysate, platelets, serum, plasma, vitreous fluid, lymph, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysate, liver tissue, tissue culture medium, tissue extract, homogenized tissue, tumor tissue, and cell extract, or a combination thereof.

[0031] Furthermore, the test samples are liver tissue, liver tissue culture medium, and liver tissue extract.

[0032] Furthermore, the subjects include humans or non-human mammals.

[0033] Furthermore, the subjects mentioned are human.

[0034] Furthermore, the diabetes includes type 1 diabetes, type 2 diabetes, latent autoimmune diabetes in adults, mitochondrial diabetes, and gestational diabetes.

[0035] Furthermore, the reagent includes primers or probes that specifically detect the expression level of miR-682.

[0036] Furthermore, the primers or probes can be designed and synthesized using phosphorimide solid-phase support or other well-known chemical methods. The nucleic acid sequence can also be modified using many techniques known in the art. Non-limiting examples of such modifications include methylation, capping, substitution with one or more analogues of natural nucleotides, and modifications between nucleotides, such as modification of uncharged linkers (e.g., methyl phosphate, triphosphate, phosphorimide, carbamate, etc.) or modification of charged linkers (e.g., thiophosphate, dithiophosphate, etc.).

[0037] The term "probe" refers to a molecule capable of binding to a specific sequence, subsequence, or other portion of another molecule. Unless otherwise specified, in this invention, the term "probe" generally refers to a polynucleotide probe capable of binding to another polynucleotide (often referred to as a "target polynucleotide") through complementary base pairing. Depending on the stringency of the hybridization conditions, the probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. Probes can be labeled directly or indirectly, including primers. Here, "complementarity" is used as long as hybridization occurs, and it does not have to be completely complementary. These polynucleotides typically have at least 80%, preferably at least 90%, more preferably at least 95%, and particularly preferably 100% homology with respect to the specific base sequence. These probes can be DNA or RNA, and can also be polynucleotides obtained by artificial nucleic acid substitutions such as PNA, LNA, ENA, GNA, and TNA in part or all of their nucleotides.

[0038] Furthermore, the product can detect reagents for miR-682 markers, including kits, chips, nucleic acid membrane strips, or test strips containing the reagents.

[0039] The present invention also provides a product for diagnosing or predicting whether a subject has diabetes, the product comprising a reagent for detecting the expression level of miR-682 in a sample.

[0040] Furthermore, the samples include tissue samples, primary or cultured cells or cell lines, cell supernatant, cell lysate, platelets, serum, plasma, vitreous fluid, lymph, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tumor lysate, liver tissue, tissue culture medium, tissue extract, homogenized tissue, tumor tissue, and cell extract, or a combination thereof.

[0041] Furthermore, the test samples are liver tissue, liver tissue culture medium, and liver tissue extract.

[0042] Furthermore, the sequence of the miR-682 marker is shown in SEQ ID NO:2.

[0043] Furthermore, the subjects include humans or non-human mammals.

[0044] Furthermore, the subjects mentioned are human.

[0045] In some embodiments, the biomarker may be or include biomarkers of a specific disease state or stage, or biomarkers of the likelihood of a specific disease, condition, or symptom developing. In some embodiments, the biomarker may include biomarkers of a specific disease or treatment outcome or its likelihood.

[0046] Furthermore, the product can detect reagents for miR-682 markers, including kits, chips, nucleic acid membrane strips, or test strips containing the reagents.

[0047] The term "chip," used interchangeably with "array" and "biochip," refers to a collection of various probes and markers arranged on a common substrate, which can be a silicon wafer, nylon tape, plastic tape, or glass slide.

[0048] The present invention also provides a system for diagnosing or predicting whether a subject has diabetes using the biomarker miR-682, the system including a result determination unit that compares the obtained biomarker expression level with the average value of the biomarker expression level detected in normal individual samples.

[0049] Furthermore, the system includes a detection unit or a data processing unit.

[0050] In some specific embodiments, the system is capable of executing a computer program that, when executed on a computer or computer network, contains computer-executable instructions for performing an automated diagnosis program that automatically determines whether a subject has diabetes by collecting and processing expression levels detected by biomarkers. Typically, the computer program may specifically contain computer-executable instructions for performing steps of the methods disclosed herein. Specifically, the computer program may be stored on a computer-readable data carrier.

[0051] The present invention also provides a method for screening drugs for the treatment or prevention of diabetes for non-therapeutic and non-diagnostic purposes, the method comprising the step of detecting the gene expression level of the aforementioned biomarkers in a subject sample.

[0052] The present invention also provides the application of the miR-682 biomarker in constructing computer models for diagnosing or predicting diabetes.

[0053] As used herein, the term "diagnosis" refers to a method skilled in the art that estimates and / or determines the probability that a patient has a given disease or condition, and is an aid to diagnosis. In certain specific instances of the invention, "diagnosis" includes the results of testing using diabetes biomarkers used in the invention. Optionally, it may be used in conjunction with other clinical features to diagnose whether or not a patient has diabetes, or to diagnose the risk of having diabetes, based on samples and tests obtained from the patient. Such a diagnosis is "definite" and does not imply that the diagnosis is 100% accurate. Therefore, the level of a biomarker measured on one side of a pre-determined diagnostic threshold only indicates a higher probability that the subject has the disease, relative to the measurement level being on the other side of the pre-determined diagnostic threshold.

[0054] The beneficial effects of this invention are:

[0055] This invention provides the first experimental finding that miR-682 is significantly upregulated in mice exposed to a high-fat diet in early life. Furthermore, experiments demonstrate that inhibiting miR-682 levels improves glucose metabolism in hepatocytes, suggesting that miR-682 inhibitors may be applicable to the diagnosis and treatment of diabetes. Attached Figure Description

[0056] Figure 1 This is a graph showing the effect of a high-fat maternal diet on glucose metabolism in offspring mice. A represents the effect of a high-fat maternal diet (HFD) on the oral glucose tolerance test (OGTT) in offspring mice; B represents the area under the blood glucose curve in the OGTT; and C represents the effect of a high-fat maternal diet on miR-682 expression in the liver of offspring mice. **P<0.01; SD: control diet; HFD: high-fat diet;

[0057] Figure 2 This is a graph showing the effect of miRNA-682 inhibitor transfection on glucose uptake in hepatocytes induced by high glucose. In graph A, the relative expression of miR-682 in hepatocytes after transfection with miRNA-682 inhibitor is shown. **P<0.01 in A indicates a significant comparison between the control group and the miRNA-682 inhibitor group. Graph B shows the effect of high glucose stimulation and miR-682 inhibitor transfection on glucose uptake in mouse primary hepatocytes. **P<0.01 in B indicates a significant comparison between the normal glucose group (NG) and the high glucose (HG) treatment group; ##P<0.01 indicates a significant comparison between the high glucose treatment + miRNA-682 inhibitor group and the high glucose (HG) treatment group. Note: Control: control group; NG: normal glucose group; HG: high glucose treatment group. Detailed Implementation

[0058] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention will now be described in detail with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of this invention. In the embodiments, all original reagent materials are commercially available, and experimental methods not specifically specified are conventional methods and conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0059] Example 1: High-fat diet exposure in early life significantly upregulated miR-682 expression in the liver of mice.

[0060] 1. Experimental materials

[0061] C57BL / 6J mice (Beijing Huafukang Biotechnology Co., Ltd.), normal rodent diet (Beijing Huafukang Biotechnology Co., Ltd.), high-fat diet (Beijing Huafukang Biotechnology Co., Ltd.), glucose (Sigma), blood glucose meter (Bayer Biocare), blood glucose test strips (Bayer Biocare), TRIzol reagent (Sigma), chloroform (Shanghai Chemical Reagent Co., Ltd.), isopropanol (Shanghai Chemical Reagent Co., Ltd.), RNA extraction kit (Qiagen), reverse transcription kit (TaKaRa), Taqman miRNA detection kit (ABI), ViiaA7 real-time quantitative PCR system (ABI), and Taqman probe sequences are shown in Table 1.

[0062] Table 1

[0063] mouse miRNA Serial Number mature sequence mmu-miR-682 SEQ ID NO:2 CUGCAGUCACAGUGAAGUCUG

[0064] 2. Experimental Methods

[0065] Five-week-old C57BL / 6J mice (Beijing Huafukang Biotechnology Co., Ltd., 16 females and 8 males) were purchased. Female mice were randomly divided into a normal diet group (SD, n=8) and a high-fat diet group (HFD, n=8). The normal diet group was fed a normal rodent diet (Beijing Huafukang Biotechnology Co., Ltd.), with a feed energy ratio of 10% fat, 20% protein, and 70% carbohydrates. The high-fat diet group was fed a high-fat diet (Beijing Huafukang Biotechnology Co., Ltd.), with a feed energy ratio of 45% fat, 20% protein, and 35% carbohydrates. Both groups had free access to food. After 3 weeks, females and males (fed a normal diet) were housed together at a ratio of 2:1. The first day of gestation was defined as the appearance of vaginal plugs. Pregnant mice continued to be fed either a normal diet or a high-fat diet during gestation and lactation. At 3 weeks of age, the offspring underwent an oral glucose tolerance test. After a 10-hour fast, glucose solution (2g / kg body weight) was administered by gavage, and blood glucose levels were measured before the glucose load, and at 30, 60, and 120 minutes after the glucose load. The mice were then euthanized and their livers were harvested.

[0066] Approximately 50 mg of liver was homogenized with 1 mL of TRIzol reagent. After homogenization, the mixture was incubated at room temperature for 5 min. Then, 0.2 mL of chloroform was added. The mixture was incubated at room temperature for 3 min. Centrifuged at 12000 g for 15 min at 4°C. After centrifugation, the supernatant was transferred to an RNase-free EP tube. 0.5 mL of isopropanol was added, mixed, and incubated at room temperature for 10 min. Centrifuged at 12000 g for 10 min at 4°C. The supernatant was discarded, yielding an RNA precipitate. Reverse transcription was performed using a reverse transcription kit (TaKaRa). cDNA was obtained, and a real-time quantitative PCR reaction system was prepared. The following program was run on a real-time quantitative PCR instrument: 95°C, 10 min; 40 PCR cycles (95°C, 10 sec; 60°C, 60 sec (collect fluorescence)). To establish the melting curve of the PCR product, after the amplification reaction, the reaction was repeated (95°C, 10 sec; 60°C, 60 sec; 95°C, 15 sec); and the temperature was slowly increased from 60°C to 99°C. Using Actin as an internal control, miR-682 expression was detected by real-time quantitative PCR. -△△Ct The method is used for relative quantification.

[0067] 3. Experimental Results

[0068] like Figure 1 As shown, in the oral glucose tolerance test, blood glucose levels were significantly elevated (P<0.01) and the area under the glucose curve was significantly increased (P<0.01) in mice exposed to a high-fat diet in early life at 30, 60, and 120 minutes after glucose administration. Hepatic miR-682 expression was significantly upregulated in mice exposed to a high-fat diet in early life (P<0.01).

[0069] Example 2: miR-682 inhibitors improve hepatocyte glucose metabolism

[0070] 1. Experimental materials

[0071] Cell incubator (Thermo), C57BL / 6J mice (Beijing Huafukang Biotechnology Co., Ltd.), DMEM medium (Gibco), fetal bovine serum (Gibco), glucose (Sigma), Lipofectamine RNAiMAX transfection kit (Thermo Fisher Scientific), glucose assay kit (Beijing Solarbio Science & Technology Co., Ltd.)

[0072] 2. Experimental Methods

[0073] Primary hepatocytes were isolated from the livers of C57BL / 6J mice. The isolated mouse primary hepatocytes were cultured in DMEM medium at 37°C in a 5% CO2 incubator. Based on the miR-682 sequence (shown in Table 2), a miR-682 inhibitor was designed and synthesized (Guangzhou Ruibo Pharmaceutical Co., Ltd.). Approximately 1×10⁻⁶ cells were seeded 24 hours before transfection.6 Hepatocytes were cultured in six-well plates. When the cell density reached 70%, the culture medium was replaced with serum-free medium. A diluted miR-682 inhibitor was mixed with Lipofectamine RNAiMAX transfection reagent, gently mixed, and incubated at room temperature for 20 min to form a transfection complex. Then, the mixture was added to the cell culture medium, gently mixed, and cultured in a 5% CO2 incubator at 37°C. After 6 h, the medium was replaced with complete medium. After 16 h, the hepatocytes were treated with high-glucose medium (33 mmol / L).

[0074] After 24 hours of cell treatment, the culture supernatant was collected, and the OD value of each well was measured at 505 nm using an ELISA reader according to the glucose assay kit instructions. Each sample was tested in triplicate.

[0075] After 24 hours of cell treatment, the culture medium was aspirated and washed twice with PBS. 1 mL of TRIzol reagent was added to each well, and the cells were thoroughly lysed by repeated pipetting. The cells were then incubated at room temperature for 10 minutes. The lysis buffer was transferred to an EP tube, and 0.2 mL of chloroform was added. The cells were incubated at room temperature for 3 minutes. The cells were then centrifuged at 12000g for 15 minutes at 4°C. After centrifugation, the supernatant was transferred to an RNase-free EP tube. 0.5 mL of isopropanol was added, and the cells were incubated at room temperature for 10 minutes. The cells were then centrifuged at 12000g for 10 minutes at 4°C. The supernatant was discarded, and the RNA precipitate was obtained. Reverse transcription was performed using a reverse transcription kit (TaKaRa). cDNA was obtained, and a real-time quantitative PCR reaction system was prepared. The following program was run on a real-time quantitative PCR instrument: 95°C, 10 minutes; 40 PCR cycles (95°C, 10 seconds; 60°C, 60 seconds (fluorescence collection)). To establish the melting curve of the PCR product, after the amplification reaction, the temperature was adjusted according to the following sequence: (95℃, 10 sec; 60℃, 60 sec; 95℃, 15 sec); and then slowly heated from 60℃ to 99℃. Using Actin as an internal control, miR-682 expression was detected using real-time quantitative PCR. -△△Ct The method is used for relative quantification.

[0076] Table 2

[0077]

[0078] 3. Experimental Results

[0079] Experimental results are as follows Figure 2 As shown, transfection of high-glucose-stimulated mouse primary hepatocytes with a miR-682 inhibitor significantly reduced miR-682 levels (P<0.01). Transfection of mouse primary hepatocytes with a miR-682 inhibitor improved high-glucose-induced glucose consumption (P<0.01). This indicates that the miR-682 inhibitor can improve glucose metabolism in hepatocytes.

[0080] It should be noted that the above embodiments are only used to illustrate the implementation process and features of the present invention, and are not intended to limit the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention without departing from the spirit and scope of the present invention. Any modifications or partial substitutions should be covered within the protection scope of the present invention.

Claims

1. The use of miR-682 inhibitors in the preparation of medicaments for the treatment of diabetes, wherein the miR-682 inhibitor comprises miR-682 antisense nucleic acid; the sequence of the miR-682 antisense nucleic acid is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The drug is prepared for oral administration or intraperitoneal injection.

3. The application according to claim 1, characterized in that, The drug also includes pharmaceutically acceptable additives.

Images