Preparation and application of a strain of metarhizium anisopliae and metarhizium granules

The preparation of Metarhizium anisopliae NMMa198 formulation for scarab beetles has solved the ecological and health problems caused by chemical pesticides in the control of the firefly beetle on scallops, providing an efficient and environmentally friendly pest control solution, and achieving effective control of the firefly beetle on scallops and promotion of pasture growth.

CN116769608BActive Publication Date: 2026-03-03INNER MONGOLIA MENGFENG BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-04
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Existing technologies for controlling the firefly beetle using chemical pesticides have problems such as disrupting the ecological balance, polluting the environment, threatening human health, and increasing the pest's resistance to pesticides. The control effect of using Metarhizium anisopliae alone is not ideal.

Method used

A strain of Metarhizium anisopliae NMMa198 and its formulation are provided. The formulation includes conidia and/or microsclerotia. The conidia and microsclerotia are prepared by liquid-phase and solid-phase fermentation culture. Combined with suitable adjuvants and substrates, they are prepared into granules for the control of the firefly beetle.

Benefits of technology

Metarhizium anisopliae granules have a significant effect on the control of leaf beetle on sand onions, with a control effect of over 85%. They also promote the growth of pasture, reduce pesticide pollution, and reduce the use of chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116769608B_ABST
    Figure CN116769608B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of microbial inoculant, and particularly relates to a Metarhizium anisopliae and granules, a preparation method and application thereof. The present application provides a Metarhizium anisopliae NMMa198, and the preservation number of the Metarhizium anisopliae NMMa198 is CGMCC No. 40148. The Metarhizium anisopliae granules prepared by using the active substance of the Metarhizium anisopliae NMMa198 provided by the present application can be used to prevent and control Agonoscena hippodromi, and the prevention and control effect of the high-dose application group can reach more than 80% after 10 days. The Metarhizium anisopliae granules also have the effect of promoting the growth of Allium sand-racemose and other pasture grasses. It can be seen that the Metarhizium anisopliae granules have a good application prospect in the prevention and control of pests in grassland pasture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial inoculant technology, specifically relating to the preparation and application of a strain of Metarhizium anisopliae NMMa198 and its granules. Background Technology

[0002] The sand onion leaf beetle is a major grassland pest that lives in the soil and damages the stems and leaves of plants in the genus Allium, such as sand onion, wild onion, and wild leek. This pest often hides under cow dung or rocks in grasslands when temperatures are too high or too low. The larvae's voracious feeding period is from late April to the end of May each year, severely damaging grassland plants such as sand onion. When infestations are severe, grassland vegetation is completely devastated, seriously affecting grassland ecology and the healthy development of livestock production.

[0003] Currently, the control of the sand onion leaf beetle mainly relies on chemical agents, such as phoxim, which can quickly and effectively kill the beetle. Chemical agents have the advantage of rapid action. However, the long-term and large-scale use of chemical pesticides poses the following hazards or hidden dangers: First, while killing and poisoning pests, they also harm the pests' natural enemies, pollinators, birds, and other beneficial insects and birds, disrupting the ecological balance of nature. Second, the large-scale use of chemical pesticides leads to their gradual accumulation in the environment, especially in soil and water, causing pesticide pollution. Third, chemical pesticides are absorbed by pasture and enter animal bodies, where they undergo bioaccumulation and concentration, increasing their toxicity. This not only makes the natural enemies of pests more susceptible to poisoning but may also threaten human health through the food chain; furthermore, even without considering bioaccumulation, pesticide residues directly affect food safety and impact crop production and trade. Fourth, long-term and excessive use of chemical pesticides can easily lead to pesticide resistance in pests, not only affecting the effectiveness of pest control but also creating a vicious cycle of continuously increasing the dosage of chemical pesticides to ensure control effectiveness. Currently, preventing pesticide pollution has become a key concern for many countries around the world, and the abuse of chemical pesticides can cause more serious and far-reaching harm than pest infestations.

[0004] The use of microorganisms for biological control of pests has been widely adopted in many agricultural and forestry areas. Although existing technologies have reported the combined use of *Metarhizium anisopliae* and insecticides to control the firefly beetle (see "Synergistic Effect of *Metarhizium anisopliae* and Three Insecticides on Firefly Beetles in Onions," Chang Jing, *Journal of Pesticide Science*, 20141212), the *Metarhizium anisopliae* used is *Metarhizium anisopliae*. The synergistic effect of indoxacarb with *Metarhizium anisopliae* is strongest. However, the combined application of *Metarhizium anisopliae* and chemical agents still suffers from the aforementioned drawbacks: disruption of the ecological balance, pesticide pollution, threats to human health, and increased resistance. In contrast, the use of *Metarhizium anisopliae* alone results in lower LT (thickness / lowering). 50The value was 12.94 days, indicating that the control effect of applying only *Metarhizium anisopliae* on the firefly beetle of *Onionia spp.* was not ideal. There are currently no reports on the use of highly effective insecticidal fungi for the control of *Onionia spp.* Summary of the Invention

[0005] The purpose of this invention is to provide a strain of Metarhizium anisopliae NMMa198 and its preparation. The preparation of Metarhizium anisopliae NMMa198 provided by this invention has a good effect on controlling the firefly leaf beetle of the sand onion.

[0006] To address the aforementioned technical problems, the following technical solutions are provided:

[0007] This invention provides a strain of Metarhizium anisopliae NMMa198, which has the accession number CGMCCNo.40148.

[0008] This invention provides a Metarhizium anisopliae preparation, wherein the active ingredients of the Metarhizium anisopliae preparation include the conidia of Metarhizium anisopliae NMMa198 and / or the microsclerotia of NMMa198 as described in the above technical solution.

[0009] Preferably, the number of conidia in the Metarhizium anisopliae preparation is greater than or equal to 1.0 × 10⁻⁶. 9 Conidia / g; the number of microsclerotia in the *Metarhizium anisopliae* preparation is greater than or equal to 1.0 × 10⁻⁶. 7 microsclerotia / g.

[0010] Preferably, the method for preparing the conidia of Metarhizium anisopliae NMMa198 includes the following steps:

[0011] Liquid seed culture was obtained by liquid-phase fermentation of conidia of Metarhizium anisopliae NMMa198. The liquid seed culture was then inoculated onto solid fermentation material for solid fermentation culture, and conidia powder was obtained by separation.

[0012] The volume-to-mass ratio of the liquid seed solution to the solid fermentation material is 1L:10Kg;

[0013] The liquid-phase fermentation culture is carried out at a temperature of 26–28°C, a rotation speed of 200–250 rpm, and a time of 56–72 h; the solid-phase fermentation culture is carried out at a temperature of 25–27°C and a time of 10–15 d.

[0014] Preferably, the method for preparing the Metarhizium anisopliae NMMa198 microsclerotia includes the following steps:

[0015] Conidia were obtained by plate culture of Metarhizium anisopliae NMMa198. The obtained conidia were inoculated into microsclerotium induction culture medium for induced fermentation culture to obtain fermentation products containing microsclerotia.

[0016] The spore concentration of the conidial suspension inoculated into the microsclerotium induction culture medium was 1×10⁻⁶. 8 ~1×10 9 1 spore / mL; the temperature of the induced fermentation culture is 25-28℃, the rotation speed of the induced fermentation culture is 200-250 rpm, and the time of the induced fermentation culture is 5-7 days;

[0017] The plate culture temperature is 26–28°C, and the plate culture time is 7–14 days.

[0018] Preferably, the dosage form of the Metarhizium anisopliae preparation includes granules, powders, or wettable powders;

[0019] The granules include spore-type Metarhizium anisopliae granules or micro-sclerotium-type Metarhizium anisopliae granules;

[0020] By weight, the conidial type Metarhizium anisopliae granules comprise the following components: 1-6 parts of Metarhizium anisopliae NMMa198 conidial powder, 3-5 parts of adjuvants, and 90-94 parts of fermentation substrate;

[0021] By weight, the micro-sclerotium type Metarhizium anisopliae granules comprise the following components: 10-20 parts of Metarhizium anisopliae NMMa198 micro-sclerotium mother powder, 3-5 parts of adjuvants, and 75-85 parts of matrix; the matrix includes fermentation matrix and / or carrier matrix;

[0022] The Metarhizium anisopliae NMMa198 microsclerotium mother powder is a mixture of fermentation products containing Metarhizium anisopliae NMMa198 microsclerotiums and a carrier matrix.

[0023] The fermentation substrate includes the solid fermentation material remaining after extracting the conidia of Metarhizium anisopliae NMMa198; the carrier substrate includes one or more of diatomaceous earth, kaolin, attapulgite, and clay.

[0024] Preferably, the additives include potassium humate and / or xanthan gum.

[0025] This invention provides the application of Metarhizium anisopliae NMMa198 or the Metarhizium anisopliae preparation described in the above-mentioned technical solution in the control of pasture pests.

[0026] Preferably, the pasture pests include one or more of the following: sand onion leaf beetle, pasture leaf beetle, flea beetle, and grub.

[0027] Preferably, the application method includes uniformly mixing the Metarhizium anisopliae granules and the dispersant and then applying them, wherein the mass ratio of Metarhizium anisopliae granules to the dispersant during mixing is 1:10 to 1:20, and the dispersant includes organic fertilizer or fine soil.

[0028] The beneficial effects of this invention: This invention provides a strain of *Metarhizium anisopliae* NMMa198, with the preservation number CGMCC No. 40148. The insecticidal active ingredient of *Metarhizium anisopliae* NMMa198 is a fermentation product conidia or microsclerotia, which can control the leaf beetle of *Metarhizium anisopliae* and grassland forage leaf beetles. Example results show that the *Metarhizium anisopliae* granules prepared using the active ingredient of the strain provided by this invention have a good control effect on the leaf beetle of *Metarhizium anisopliae*. After 10 days of application, the control effect can reach over 85%. The *Metarhizium anisopliae* granules also have a significant effect on promoting the growth of *Metarhizium anisopliae* and other forage grasses. Therefore, the *Metarhizium anisopliae* granules of this invention have good application prospects in grassland pest control.

[0029] Biological Preservation Instructions

[0030] Metarhizium anisopliae (NMMa198) was deposited on March 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40148. The address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0032] Figure 1 This is a morphological diagram of the mummified beetle *Metarhizium anisopliae* NMMa198 from Example 1. Detailed Implementation

[0033] This invention provides a strain of Metarhizium anisopliae NMMa198, which has the accession number CGMCCNo.40148.

[0034] In this invention, the ITS sequence of the *Metarhizium anisopliae* NMMa198 is shown in SEQ ID NO.1. The *Metarhizium anisopliae* NMMa198 of this invention is preferably isolated from the leaf beetle *Metarhizium anisopliae*, and it has the advantages of high production efficiency and large sporulation yield in liquid-solid two-phase fermentation. The *Metarhizium anisopliae* NMMa198 of this invention mainly infects Coleoptera pests, including not only the leaf beetle *Metarhizium anisopliae*, but also flea beetles, white grubs, and many other Coleoptera pests.

[0035] The *Metarhizium anisopliae* NMMa198 described in this invention has yellowish-green, fluffy colonies in the early stages after sporulation, which later turn green. The colony matrix pigment is yellowish-brown, the spores are yellowish-green, the hyphae are white with branching septa, and the conidia are oblong with blunt ends. The diameter and length of the spores are (4.3–5.2) μm × (10.9–12.6) μm, respectively.

[0036] This invention provides a Metarhizium anisopliae preparation, wherein the active ingredient of the Metarhizium anisopliae preparation includes the conidia of Metarhizium anisopliae NMMa198 as described in the above technical solution and / or the microsclerotia of NMMa198.

[0037] The number of conidia in the *Metarhizium anisopliae* preparation of the present invention is preferably greater than or equal to 1.0 × 10⁻⁶. 9 Conidia / g; the number of microsclerotia in the *Metarhizium anisopliae* preparation is preferably greater than or equal to 1.0 × 10⁻⁶. 7 microsclerotia / g.

[0038] The preferred dosage form of the Metarhizium anisopliae preparation of this invention includes granules, powders, or wettable powders. This invention creatively utilizes Metarhizium anisopliae NMMa198 spores and / or Metarhizium anisopliae NMMa198 microsclerotia to prepare Metarhizium anisopliae granules, which can effectively control damage from the sand onion leaf beetle and various grassland beetles. The Metarhizium anisopliae granules prepared by this invention have the advantages of strong stress resistance and long shelf life.

[0039] When the Metarhizium anisopliae preparation of the present invention is preferably in granule form, the granule form of the present invention preferably includes spore-type Metarhizium anisopliae granules or micro-sclerotium-type Metarhizium anisopliae granules.

[0040] By weight, the spore-type Metarhizium anisopliae granules of the present invention preferably comprise the following components: 1-6 parts of Metarhizium anisopliae NMMa198 conidial powder, 3-5 parts of adjuvants, and 90-94 parts of matrix.

[0041] The preferred method for preparing the conidia of Metarhizium anisopliae NMMa198 according to the present invention includes the following steps: liquid-phase fermentation culture of Metarhizium anisopliae NMMa198 conidia to obtain liquid seed liquid, inoculating the liquid seed liquid into solid fermentation material for solid fermentation culture, and then separating to obtain conidia powder.

[0042] Before liquid-phase fermentation, the present invention preferably activates the *Metarhizium anisopliae* NMMa198 strain through plate culture to obtain conidia. During plate culture, the present invention preferably streaks *Metarhizium anisopliae* NMMa198 onto a solid 1 / 4 SDAY plate.

[0043] In this invention, the composition of the solid 1 / 4SDAY culture medium has been discussed in the preparation of Metarhizium anisopliae NMMa198 microsclerotia, and will not be repeated here.

[0044] In this invention, the pH of the 1 / 4 SDAY culture medium is preferably 5.0 to 7.5, more preferably 6.0 to 7.0, and even more preferably 6.5.

[0045] In this invention, the culture time on the 1 / 4 SDAY plate is preferably 7–14 days, more preferably 12.5–13.5 days, and even more preferably 13 days. The fermentation temperature is preferably 26–28°C, more preferably 26–27°C, and even more preferably 26°C. The fermentation culture of this invention is preferably isothermal culture. The fermentation culture of this invention is preferably dark culture, carried out in an incubator. During the fermentation culture, this invention preferably stops fermentation after a large number of conidia are produced on the surface of the culture medium (see preferred fermentation time), and the mature conidia of *Metarhizium anisopliae* NMMa198 are scraped off under aseptic conditions as the production strain.

[0046] The present invention preferably uses sterile water to prepare a conidia suspension from the conidia of Metarhizium anisopliae NMMa198, and the spore content of the conidia suspension is preferably 1×10⁻⁶. 8 ~1×10 9 When preparing conidial suspensions, the present invention preferably adds Tween-80 to sterile water, wherein the amount of Tween-80 added is 0.1% (V:V) of sterile water.

[0047] After obtaining the conidial suspension of *Metarhizium anisopliae* NMMa198, this invention preferably utilizes the *Metarhizium anisopliae* NMMa198 conidial suspension for liquid-phase fermentation to obtain a liquid seed culture. In this invention, the liquid-phase fermentation medium is preferably a modified SDY liquid culture medium, prepared using distilled water as a solvent, and preferably comprising the following components at the following mass concentrations: sucrose 10–30 g / L, yeast extract 1.5–4.5 g / L, and peptone 1–3 g / L; more preferably, sucrose 10–20 g / L, yeast extract 1.5–3.5 g / L, and peptone 1–2 g / L; even more preferably, sucrose 10 g / L, yeast extract 1.5 g / L, and peptone 2 g / L. In this invention, the pH of the liquid-phase fermentation medium is preferably 5.0–7.5, more preferably 6.0–7.0, and even more preferably 6.5.

[0048] In this invention, the liquid-phase fermentation culture time is preferably 56–72 h, more preferably 60–72 h, and even more preferably 72 h. The liquid-phase fermentation temperature is preferably 26–28 °C, more preferably 26.5–27.5 °C, and even more preferably 27 °C. The rotation speed of the liquid-phase fermentation culture is preferably 200–250 rpm, more preferably 220–250 rpm, and even more preferably 240 rpm.

[0049] The liquid-phase fermentation culture of this invention preferably utilizes 1L Erlenmeyer flasks, with each 1L Erlenmeyer flask containing 200mL of liquid culture medium, representing 20% ​​of the flask's volume. The liquid-phase fermentation culture of this invention is preferably carried out on a shaker. During the liquid-phase fermentation process, this invention preferably stops fermentation after a large amount of mycelium and spores have been produced (see Preferred Liquid-Phase Fermentation Culture Time), obtaining a liquid seed culture of *Metarhizium anisopliae* NMMa198. The liquid seed culture of this invention is a mixture of mycelium and spores.

[0050] After obtaining the liquid seed culture of *Metarhizium anisopliae* NMMa198, this invention preferably uses wheat bran or rice as the fermentation material to carry out solid-state fermentation culture of the seed culture to obtain spore powder, with rice being more preferred. This strain grows rapidly on the fermentation material, produces a large amount of spores, is not easily infected by contaminants, and has excellent production performance that is unmatched by other strains. The spore powder yield of the *Metarhizium anisopliae* NMMa198 strain of this invention is 1.5%–2.0%.

[0051] This invention does not have any special limitations on the source of the wheat bran or rice used in the fermentation material; conventional commercially available products are sufficient. The wheat bran or rice used in this invention serves as the fermentation substrate.

[0052] In this invention, the preferred method for preparing the rice fermentation material is as follows: rice is soaked in water for 2 hours at a volume ratio of 2:1, followed by high-temperature sterilization. Preferably, the rice fermentation material is placed in a polyethylene fermentation bag, the bag is tightly sealed, and then subjected to high-temperature sterilization. Preferably, each polyethylene fermentation bag contains 500g of water-absorbed rice, and the preferred size of the polyethylene fermentation bag is 50cm × 40cm. The preferred high-temperature sterilization conditions are 121℃ for 30 minutes.

[0053] In the solid-state fermentation culture, this invention preferably inoculates the sterilized rice fermentation material with a liquid seed culture of Metarhizium anisopliae NMMa198 and mixes it thoroughly before carrying out solid-state fermentation culture. The preferred volume-to-mass ratio of the Metarhizium anisopliae NMMa198 liquid seed culture to rice is 1L:10kg. This invention does not have specific limitations on the mixing method; conventional aseptic mixing methods are sufficient.

[0054] In this invention, the temperature of the solid-state fermentation culture is preferably 25–27°C, more preferably 25.5–26.5°C, and even more preferably 26°C; the time is preferably 10–15 days, more preferably 11–15 days, and even more preferably 15 days. In this invention, the relative humidity of the solid-state fermentation culture is preferably 80–90%, more preferably 82–88%, and even more preferably 85%.

[0055] The solid fermentation culture described in this invention is preferably carried out on a culture rack. After the liquid seed liquid of Metarhizium anisopliae NMMa198 is mixed with rice, the fermentation bag is placed in a single layer on the culture rack and allowed to ferment statically.

[0056] In solid-state fermentation culture, the present invention preferably stops fermentation after 15 days (when the substrate is covered with green spore powder) to obtain the conidia of Metarhizium anisopliae NMMa198.

[0057] This invention preferably involves collecting *Metarhizium anisopliae* NMMa198 conidia, drying them at room temperature using an air dryer, and then sieving them to obtain conidia powder. The sieving is preferably done using a 100-200 mesh vibrating sieve. In this invention, the air drying time for the *Metarhizium anisopliae* NMMa198 culture is preferably 2-3 days. This invention preferably uses a hemocytometer to count the conidia, and the conidia powder produced by this invention has a conidia content of 30 billion / g. The *Metarhizium anisopliae* NMMa198 conidia of this invention can also be separated using a cyclone separator.

[0058] The spore-type Metarhizium anisopliae granules provided by this invention comprise 3-5 parts of adjuvants, preferably 3.5-5 parts, and more preferably 4-5 parts. The adjuvants preferably include potassium humate and / or xanthan gum, wherein the pH value of the potassium humate and xanthan gum is <8.0. The addition of potassium humate provides nutrients for Metarhizium anisopliae spores, prolonging their survival period in the wild; the xanthan gum in this invention enhances the adhesion of conidia to insect bodies or plant surfaces, facilitating the attachment of active ingredients to the surface of forage grasses and pests. The addition of adjuvants promotes the environmental survival and stress resistance of Metarhizium anisopliae NMMa198 microsclerotia and conidia, ensuring the insecticidal activity of the Metarhizium anisopliae granules.

[0059] In this invention, the potassium humate is optimized to be mineral-derived fulvic acid, and the pH is optimized to be below 8; the source of xanthan gum is not particularly limited, and conventional commercially available products can be used.

[0060] Based on the mass fraction of the adjuvant, the conidial type Metarhizium anisopliae granules provided by the present invention include 1 to 6 parts of Metarhizium anisopliae NMMa198 conidia, more preferably 4 parts;

[0061] Based on the mass fraction of the adjuvant, the spore-type Metarhizium anisopliae granules provided by this invention comprise 90-94 parts of fermentation substrate, more preferably 91 parts. In this invention, the substrate in the spore-type Metarhizium anisopliae granules preferably includes a fermentation substrate; the fermentation substrate is preferably the solid fermentation material remaining after extracting conidia of Metarhizium anisopliae NMMa198, and the fermentation material preferably includes wheat bran or rice. The fermented substrate of this invention, as a component of the granules, enables Metarhizium anisopliae NMMa198 to maintain its activity in the field for a longer period after application.

[0062] The micro-sclerotium type Metarhizium anisopliae granules provided by the present invention preferably include the following components by weight: 10-20 parts of Metarhizium anisopliae NMMa198 micro-sclerotium mother powder, 3-5 parts of adjuvants and 75-85 parts of matrix.

[0063] In this invention, the fermentation method for the *Metarhizium anisopliae* NMMa198 microsclerotia preferably includes the following steps:

[0064] Conidia obtained from plate culture of Metarhizium anisopliae NMMa198 were inoculated into a microsclerotium-induced culture medium for fermentation to obtain fermentation products containing microsclerotia.

[0065] In this invention, during plate culture, *Metarhizium anisopliae* NMMa198 is preferably inoculated onto a solid 1 / 4 SDAY medium or a solid SDAY medium for plate culture. The solid SDAY medium of this invention is prepared using distilled water as a solvent and preferably comprises the following components at the following mass concentrations: sucrose 5-30 g / L, yeast extract 5-20 g / L, peptone 5-20 g / L, and agar powder 20 g / L; more preferably, sucrose 10 g / L, yeast extract 5 g / L, peptone 10 g / L, and agar powder 20 g / L. In this invention, the pH of the solid SDAY medium is preferably 5.0-7.5, more preferably 6.0-7.0, and more preferably 6.5. The solid 1 / 4 SDAY medium of this invention is prepared using distilled water as a solvent and preferably comprises the following components at the following mass concentrations: sucrose 10 g / L, yeast extract 2.0 g / L, peptone 2 g / L, and agar powder 20 g / L. In this invention, the pH of the solid 1 / 4 SDAY culture medium is preferably 5.0 to 7.5, more preferably 6.0 to 7.0, and even more preferably 6.5.

[0066] In this invention, the plate culture time is preferably 7–14 days, more preferably 12.5–14.0 days, and even more preferably 13 days. In this invention, the plate culture temperature is preferably 26–28°C, more preferably 26–27°C, and even more preferably 26°C. The plate culture of this invention is preferably a constant temperature culture. The plate culture of this invention is preferably a dark culture carried out in an incubator. In the plate culture of this invention, culture is stopped after a large number of green conidia appear on the surface of the culture medium (see preferred fermentation time), yielding *Metarhizium anisopliae* NMMa198 conidia.

[0067] After plate culture, conidia of *Metarhizium anisopliae* NMMa198 were obtained. Preferably, the conidia of *Metarhizium anisopliae* NMMa198 are prepared by inoculating a conidial suspension into a microsclerotium induction culture medium for fermentation to obtain microsclerotia. The preferred spore concentration in the conidial suspension is 1 × 10⁻⁶. 8 ~1×10 9 1 spore / mL. The conidial suspension of the present invention is preferably prepared using sterile water. Tween-80 is added to the sterile water of the present invention, preferably at an amount of 0.1% of the sterile water volume. The inoculation method for the fermentation culture of the present invention is preferably the pouring method.

[0068] In this invention, the microsclerotium induction culture medium is preferably composed of sucrose, yeast extract, peptone, and inorganic salts. The microsclerotium induction culture medium is preferably prepared using distilled water as the solvent and preferably includes the following components at the following mass concentrations: 10–40 g / L sucrose, 5–20 g / L yeast extract, 5–20 g / L peptone, 3–6 g / L KH₂PO₄, 0.5–1.0 g / L CaCl₂·2H₂O, 0.3–1.0 g / L Mg₂SO₄·7H₂O, 0.01–0.05 g / L ZnSO₄·7H₂O, and 0.05–0.2 g / L FeSO₄. The preferred concentrations are: 4 g / L sucrose, 0.01–0.06 g / L CoCl2·6H2O, and 0.01–0.05 g / L LmnSO4·H2O; more preferably, the concentrations include: 20 g / L sucrose, 10 g / L yeast extract, 10 g / L peptone, 4 g / L KH2PO4, 0.6 g / L CaCl2·2H2O, 0.5 g / L Mg2SO4·7H2O, 0.02 g / L ZnSO4·7H2O, 0.1 g / L FeSO4·7H2O, 0.03 g / L CoCl2·6H2O, and 0.02 g / L LmnSO4·H2O. In this invention, the pH of the microsclerotium induction culture medium is preferably 5.0–7.5, more preferably 6.0–7.0, and even more preferably 6.5.

[0069] In this invention, a conidial suspension prepared from the *Metarhizium anisopliae* NMMa198 conidia is inoculated into a microsclerotium-inducing culture medium for fermentation to obtain a fermentation product containing microsclerotia. When inoculating the conidia into the microsclerotium-inducing culture medium for fermentation, the preferred volume ratio of the conidial suspension to the microsclerotium-inducing culture medium is 1 L:10 L. The fermentation time in this invention is preferably 5–7 days, more preferably 5–6 days, and even more preferably 5 days; the fermentation temperature is preferably 25–28°C, more preferably 25.5–26.5°C, and even more preferably 26°C; the fermentation speed is preferably 200–250 rpm, more preferably 220–240 rpm, and even more preferably 230 rpm.

[0070] The fermentation culture for preparing microsclerotia according to this invention preferably includes small-scale or pilot-scale fermentation cultures. The small-scale fermentation culture for preparing microsclerotia according to this invention is preferably carried out using 1L Erlenmeyer flasks, with each 1L flask containing 200mL of microsclerotia induction culture medium. The filling volume of the Erlenmeyer flask is 20% of its volume. The small-scale fermentation culture is preferably carried out on a shaker. The pilot-scale fermentation culture for preparing microsclerotia according to this invention is preferably carried out using a 30L liquid fermenter, with the filling volume of the liquid fermenter being 80% of its volume. The fermentation parameters for the pilot-scale and small-scale fermentation cultures described in this invention are the same, and have been discussed above and will not be repeated here.

[0071] After obtaining the fermentation product containing microsclerotia, the present invention preferably mixes the fermentation product containing microsclerotia with a carrier matrix and then dries it to obtain microsclerotia mother powder; the carrier matrix of the present invention preferably includes one or more of diatomaceous earth, kaolin, attapulgite and clay, more preferably diatomaceous earth, and the volume ratio of the fermentation product containing microsclerotia to the carrier matrix during mixing is preferably 1:(1-3), more preferably 1:2.

[0072] The microsclerotium-type Metarhizium anisopliae granules provided by this invention preferably include 3-5 parts of adjuvants, more preferably 3.5-5 parts, and even more preferably 4-5 parts. The parameters of the adjuvants described in this invention are the same as those of the adjuvants in the spore-type Metarhizium anisopliae granules, and will not be repeated here. Adding adjuvants is beneficial to the environmental survival of Metarhizium anisopliae NMMa198 microsclerotia and their stress resistance, ensuring the insecticidal activity of the Metarhizium anisopliae granules.

[0073] Based on the mass fraction of the adjuvant, the Metarhizium anisopliae microsclerotium granules provided by the present invention include 10 to 20 parts of Metarhizium anisopliae NMMa198 microsclerotium master powder, more preferably 15 parts.

[0074] Based on the mass fraction of the adjuvant, the Metarhizium anisopliae microsclerotium granules provided by the present invention comprise 75-90 parts of matrix, preferably 80-85 parts, and more preferably 81 parts.

[0075] In this invention, the matrix in the *Metarhizium anisopliae* granules preferably includes a fermentation matrix and / or a carrier matrix, more preferably a carrier matrix or a fermentation matrix, and even more preferably a fermentation matrix; the carrier matrix includes one or more of diatomaceous earth, kaolin, attapulgite, and clay, and even more preferably diatomaceous earth. The fermentation matrix of this invention is preferably the solid fermentation material remaining after extracting conidia of *Metarhizium anisopliae* NMMa198; the initial fermentation material of this invention preferably includes wheat bran or rice.

[0076] The *Metarhizium anisopliae* NMMa198 described in this invention utilizes liquid fermentation to produce microsclerotia as the active ingredient. Compared to conidia, microsclerotia exhibit better resistance to adverse conditions and can maintain their viability for extended periods under drought and strong ultraviolet radiation.

[0077] In this invention, the sum of the mass parts of the active substance (conidia or microsclerotia) of Metarhizium anisopliae NMMa198, the adjuvant, and the matrix is ​​preferably 100 parts.

[0078] The preferred preparation method for the Metarhizium anisopliae granules of this invention involves mixing the active ingredient of Metarhizium anisopliae NMMa198 with an adjuvant, and then mixing it with a matrix to obtain the Metarhizium anisopliae preparation. This invention does not impose any particular limitation on the mixing method; conventional methods are acceptable.

[0079] The present invention also provides the application of Metarhizium anisopliae NMMa198 or the Metarhizium anisopliae preparation described in the above technical solution in the control of pasture pests.

[0080] The pasture pests described in this invention include one or more of the target pests, such as the sand onion leaf beetle, pasture leaf beetle, flea beetle, and grub. The pasture leaf beetle mentioned in this invention refers to a general term for a class of leaf beetles that can harm pasture.

[0081] The application method of this invention includes uniformly mixing the Metarhizium anisopliae granules and dispersant before application. The mass ratio of the Metarhizium anisopliae granules to the dispersant during mixing is 1:10 to 1:20. The dispersant includes organic fertilizer or fine soil. Preferably, the mass ratio of the Metarhizium anisopliae granules to the dispersant is 1:10 to 1:20, more preferably 1:12 to 1:17, and even more preferably 1:15. In this invention, the pH value of the dispersant is less than 8. The function of the dispersant in this invention is to ensure uniform application of the Metarhizium anisopliae granules: the dosage of Metarhizium anisopliae granules is small, and direct application is difficult to achieve uniform application.

[0082] The Metarhizium anisopliae granules of this invention are applied without any added chemical agents; they are used alone. After 10 days of treatment with these granules, the control efficacy reaches levels comparable to that of the chemical agent lambda-cyhalothrin and the commonly used biological agent matrine, with a relative control efficacy exceeding 80%. Furthermore, it provides sustained control.

[0083] The application described in this invention is preferably accomplished using a motorized duster. This invention does not impose any special limitations on the source or model of the application equipment; conventional products are acceptable. This invention selects the mixing method of the *Metarhizium anisopliae* granules and dispersant based on the application equipment, ensuring that the recommended dosage of *Metarhizium anisopliae* granules is evenly applied to the grassland.

[0084] This invention does not specifically limit the organic fertilizer used as a dispersant; any organic fertilizer product is acceptable, as long as the pH value is less than 8. In this embodiment, the organic fertilizer is preferably cow or sheep manure. The fine soil or organic fertilizer particle size should be less than 1.0 mm to facilitate spraying by a dusting machine. This invention does not specifically limit the source of the fine soil; conventional fine soil is sufficient.

[0085] Using the Metarhizium anisopliae granules of this invention for insect control can reduce or eliminate the need for chemical pesticides, thereby lowering pesticide pollution in grasslands. The Metarhizium anisopliae granules of this invention also promote forage growth, improving forage quality and yield per unit area.

[0086] The *Metarhizium anisopliae* granules of this invention can be used alone for the control of the firefly beetle in *Allium tuberosum*. However, it is not excluded that they can be used in combination with other biological or chemical agents, such as mixing with matrine, abamectin, and lambda-cypermethrin powder in appropriate proportions and reduced amounts, which can increase the insecticidal spectrum and accelerate the knockdown speed of pests. Other insecticides or biochemical agents involved in the mixture should be non-aqueous and have a pH value less than 8.0.

[0087] The conidia and microsclerotia of Metarhizium anisopliae of the present invention can also be made into various dosage forms, such as powder or wettable powder, according to product requirements, as long as the corresponding auxiliary ingredients are added, and no specific limitation is made here.

[0088] The Metarhizium anisopliae granules of this invention can not only kill the firefly leaf beetle of the sand onion, but also infect and cause disease in other grass leaf beetles besides the firefly leaf beetle. At the same time, it can also promote the growth of grass roots and has an ecological function of restoring grassland vegetation.

[0089] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0090] Example 1: Isolation and identification of the highly efficient infectious strain of the safflower leaf beetle, Metarhizium anisopliae NMMa198

[0091] (1) Isolation of Metarhizium anisopliae strain from the leaf beetle:

[0092] Under aseptic conditions, use an inoculation needle to collect spores from the surface of the leaf beetle *Metarhizium anisopliae* and spot-inoculate them onto a 90mm diameter 1 / 4 SDAY agar plate (10g / L sucrose, 2.0g / L yeast extract, 2g / L peptone, 20g / L agar). Alternatively, use sterile tweezers to gently shake the sporulating beetle on the agar plate to dislodge the spores (shaking method). Incubate the agar plate in the dark at 26℃ for 3 days. After 3 days, transfer edge fragments of colonies exhibiting typical characteristics of *Metarhizium anisopliae* from the agar plate to a new 90mm 1 / 4 SDAY agar plate and incubate again in the dark at 26℃ for 3 days. Repeat this process three times to obtain a purified *Metarhizium anisopliae* strain.

[0093] The purified *Metarhizium anisopliae* strain was inoculated onto PDA (potato starch 200 g / L, sucrose 20 g / L, agar powder 20 g / L; pH 6.0–6.5) solid medium and incubated in the dark at 26–28°C for 15 days. Colony diameter was then measured. A 5×5 mm sterile coverslip was embedded at the edge of each colony, and the culture was continued for another week under the same conditions. The coverslips were then removed, and the morphology and size of the mycelium, conidiophores, and conidia of the tested strain were observed under a microscope (Table 1). The purified conidia were inoculated onto 1 / 4 SDAY slant agar and incubated in the dark at 26°C for 2 weeks. After the production of green conidia, the colonies were stored on 1 / 4 SDAY slant agar at 4°C for short-term preservation and / or frozen at 20°C with the addition of 20% glycerol for long-term preservation.

[0094] Table 1. Identification results of morphological characteristics of Metarhizium anisopliae.

[0095]

[0096]

[0097] (2) Identification of the characteristics of strain culture

[0098] On PDA medium, the initial colony growth is characterized by white, downy hyphae, which turn yellowish-green to dark green during conidiophore formation, producing clusters of conidia. Conidiophores are solitary, aggregated, or densely arranged, with broom-like branches or whorled arrangement. Later, the colonies become dry and shell-like. On PDA medium at 25°C, colonies of the strain can grow to a diameter of 2.5–3.0 cm in 7 days; at 35°C, the growth rate slows down, and the colony diameter is 2.4 cm in 15 days. Microscopic examination of stained colony slides reveals branched and septate hyphae, 1.4–2.1 μm in diameter. The phial-shaped conidiophore cells range in size from (5.6–7.9) μm to (1.7–2.8) μm; basal-maturing conidial chains arise from the phial tip; the junctions of the conidial chains have a slight inclination; the conidia are unicellular, oblong, with blunt ends, and the diameter and length of the conidia are (4.3–5.2) μm × (10.9–12.6) μm, respectively. Conidia are sometimes also solitary at the ends of the hyphal branching phorates; this fungus is designated NMMa198. A morphological image of the mummified insect produced by NMMa198 infection of the *Allium tuberosum* leaf beetle is shown below. Figure 1 .

[0099] (3) Molecular sequencing of ribosomal genes of Metarhizium anisopliae strains

[0100] NMMa198 was cultured in 1 / 4 SDY liquid medium (10 g / L sucrose, 2.0 g / L yeast extract, and 2 g / L peptone) in shake flasks for 72 h (250 rpm, 26 °C). Mycelia or cells were collected using four layers of sterile filter cloth, ground into powder with liquid nitrogen, and total DNA was extracted from the strain using a DNA kit. The total DNA was amplified, cloned, transformed, and the characteristic sequence of ITS1-5.8S rDNA-ITS2 of the *Metarhizium anisopliae* strain was determined. Bidirectional deoxygenation sequencing was performed by a biotechnology company. The amplification primers were the universal primers for fungal ITS sequences: TW815'-gtttccgtagctgaacctgc-3' (SEQ ID No. 2) and AB28:5'-atatgcttaagttcagcgggt-3' (SEQ ID No. 3). The amplified ITS sequence and 16S rDNA were compared with known sequences in the NCBI database using BLAST. A homology of 98% or higher and an E value of 0.0 were considered to be the same sequence.

[0101] The nucleotide sequence of the ITS of *Metarhizium anisopliae* NMMa198, as determined, is shown below (SEQ ID No. 1): TTTTATGCTTTAATTCAGCGGGTAGTCCTACCTGATTCGAGGTCAACT ATAAAAAGTTGGGGGTTTTTACGGCAGTGGACCGCGCCGGGCTCCTGTTGCGAGTGTTTTACTACTGCGCAGAGGAGGGCCACGGCGAGACCGCCAATCAATTTAAGGGACGGCTGTGCTGGAAAACCAGCCTCGCCGATCCCCAACACCAAGTCCACAGGGGACTTGAGGGGCGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGACGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGA ATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTTTTTTTAACCACTCAGAAGATACTTATTAAAAAATTCAGAAGGTTTGGGTCCCCGGCGGGCGCGAAGTCCCGCCGAAGCAACAATGAAAGGTATAATTCACAGGGGTTGGGAGTTGGATAACTCGGTAATGATCCCTCCGCAGGTTCACTAAACGGAAACA.

[0102] (4) Conclusion of strain identification:

[0103] The *Metarhizium anisopliae* strain NMMa198, initially white with yellowish-brown pigment on the reverse side on 1 / 4 SDAY medium, turns dark green after conidia production. Its conidia are clustered, a characteristic that clearly distinguishes it from the nearly spherical or broadly fusiform conidia of the closely related *Metarhizium flvoviride*. The optimal growth temperature for this strain is 25-30℃; the suitable culture medium is potato dextrose agar (PDA). Based on the combined cultural characteristics, morphological features, and ITS1-5.8-ITS2 rDNA molecular cloning and sequencing results, this strain was identified as *Metarhizium anisopliae*, with the strain preservation number CGMCC No. 40148, and named NMMa198. The active ingredient is mainly present in conidia and microsclerotia; its biological activity is broad-spectrum insecticidal; the optimal storage temperature is 4℃.

[0104] Example 2: Determination of the bioactivity of Metarhizium anisopliae NMMa198 against the leaf beetle *Metarhizium anisopliae*.

[0105] The insecticidal activity of *Metarhizium anisopliae* NMMa198 on scarab beetles was determined. The specific procedure is as follows: Mature conidia of *Metarhizium anisopliae* NMMa198 strain were obtained by culturing on 1 / 4 SDAY medium at 28℃ for 14 days. Tween-80 was added to sterile water at a volume of 0.1% of the sterile water volume to obtain a 0.1% sterile aqueous solution of Tween-80. The conidia were then prepared using the 0.1% Tween-80 solution to contain 1×10⁻⁶ spores. 7 A spore suspension of 1 spore / mL.

[0106] Third-instar larvae of the sand onion leaf beetle of uniform size were treated with intravenous drips using a micropipette. Treatment 1: 10 μL of spore suspension was dripped per larva, with three replicates of 10 larvae per replicate. Treatment 2: 5 μL of spore suspension was dripped per larva, with three replicates of 10 larvae per replicate. Treatment 3: 15 μL of spore suspension was dripped per larva, with three replicates of 10 larvae per replicate.

[0107] After inoculating the spore suspension, the firefly beetle of the sand onion was reared at room temperature of 25℃ and humidity of 50-60%, with a 0.1% Tween 80 solution without conidia as a blank control.

[0108] After inoculation, the insects were raised using standard methods. Their growth was observed daily for 10 consecutive days. The number of dead insects was counted and removed.

[0109] The corrected mortality rate for Example 2 was calculated according to the following formula, as shown in Table 2.

[0110] Cumulative mortality rate (%) = (Cumulative number of dead insects in 10 days / Number of *Metarhizium anisopliae* inoculated insects) * 100

[0111] Corrected mortality rate (%) = (treatment mortality rate - control mortality rate) / (1 - control mortality rate) × 100%

[0112] Table 2. Bioactivity assay of Metarhizium anisopliae NMMa198 from *Metarhizium anisopliae*.

[0113]

[0114] Example 3: Liquid-solid two-phase fermentation of conidia of Metarhizium anisopliae NMMa198

[0115] The modified SDY liquid culture medium consisted of 10 g / L sucrose, 1.5 g / L yeast extract, and 2 g / L peptone.

[0116] 1. Liquid-phase fermentation (inoculum culture)

[0117] The *Metarhizium anisopliae* strain NMMa198 was inoculated onto solid 1 / 4 SDAY medium and cultured in the dark at 26°C for 2 weeks. Under aseptic conditions, mature conidia were scraped and prepared into 1×10⁻⁶ spores in 0.1% Tween-80 sterile water. 8 ~1×10 9 A spore suspension of 1 spore / mL was prepared. 20 mL of the spore suspension was inoculated into a 1 L Erlenmeyer flask containing 200 mL of modified SDY liquid medium. After inoculation, the Erlenmeyer flask was incubated at 27 °C and 250 rpm for 72 h with shaking to obtain the liquid seed culture of Metarhizium anisopliae NMMa198.

[0118] 2. Solid-state fermentation

[0119] The initial solid-state fermentation material was rice, which was mixed with water at a volume ratio of 2:1 and soaked for 2 hours to absorb water. After absorbing water, the rice was packed into 500g bags (50cm x 40cm) of polyethylene fermentation material, the bags were tied tightly with string, and then placed in an autoclave for sterilization at 121℃ for 30 minutes. After the sterilized rice cooled naturally, the liquid seed culture obtained in step 1 was inoculated into the sterilized rice at an inoculation ratio of 10kg:1L on a clean bench. The fermentation bags were sealed, and the culture solution and rice were mixed thoroughly and placed in a single layer on a culture rack. The mixture was then statically fermented for 15 days at a temperature of 25–27℃ and a relative humidity of 80–90%. After 15 days, the fermentation culture was collected, dried indoors, and then conidial powder was collected using a 150-mesh vibrating sieve.

[0120] The spore yield of the collected conidial powder was calculated using the following formula: Spore yield = (dry weight of conidia) / (dry weight of solid fermentation material) × 100%. The spore yield of Metarhizium anisopliae strain NMMa198 was 1.8%.

[0121] 0.1 g of dried spore powder was weighed and suspended in 5 mL of 0.5% Tween-80 solution, then dispersed and mixed thoroughly. The number of conidia per gram of spore powder of strain NMMa198 was counted using a hemocytometer. The conidia content of the spore powder obtained in this example was 40 billion / g.

[0122] Preparation of granules containing conidia of Metarhizium anisopliae (3 scarab beetles)

[0123] The granules of *Metarhizium anisopliae* conidia were prepared according to the following components and mass parts: 4g of *Metarhizium anisopliae* conidia powder obtained in Example 3, 2g of mineral-derived fulvic acid and 3g of xanthan gum, and 91g of solid fermentation material after conidia extraction. The conidia of *Metarhizium anisopliae*, together with the adjuvants and fermentation substrate, were mixed evenly in a mixer to prepare *Metarhizium anisopliae* conidia granules, wherein the effective insecticidal active ingredient NMMa198 conidia content is ≥1 billion spores / g.

[0124] Example 4: Microsclerotium-induced fermentation culture of Metarhizium anisopliae and preparation of microsclerotium granules

[0125] 1. Microsclerotium-induced fermentation culture of Metarhizium anisopliae

[0126] Metarhizium anisopliae strain NMMa198 was inoculated onto solid 1 / 4 SDAY medium and cultured in the dark at 26°C for 2 weeks. Under aseptic conditions, mature conidia were scraped and prepared into 1×10⁻⁶ spores in 0.1% Tween-80 sterile water. 8 ~1×10 9A spore suspension of 1 spore / mL was inoculated into a 200mL Erlenmeyer flask containing sclerotium induction culture medium at a spore suspension:microsclerotium induction culture medium volume ratio of 1:10 and then cultured with shaking. The microsclerotium induction culture medium had the following components (g / L): sucrose 20g / L, yeast extract 10g / L, peptone 10g / L, 4g / L KH₂PO₄, 0.6g / L CaCl₂·2H₂O, 0.5g / L Mg₂SO₄·7H₂O, 0.02g / L ZnSO₄·7H₂O, 0.1g / L FeSO₄·7H₂O, 0.03g / L CoCl₂·6H₂O, and 0.02g / L MnSO₄·H₂O. The pH of the medium was 6.5. The volume of the Erlenmeyer flask was 1L (i.e., the fermentation broth volume in the Erlenmeyer flask was 20%). After shaking culture at 26℃ and 250 rpm for 5 days, a fermentation broth containing *Metarhizium anisopliae* microsclerotia (a mixture of microsclerotia and a small amount of mycelium) was obtained. The microsclerotia yield was 50% of the culture broth (microsclerotia yield was the ratio of microsclerotia wet weight to fermentation broth volume). Commercially available 200-mesh diatomaceous earth (matrix) was added at a ratio of 1:2 (V:V), and the mixture was air-dried to obtain microsclerotia mother powder.

[0127] 2. Preparation of Metarhizium anisopliae microsclerotium granules

[0128] The *Metarhizium anisopliae* microsclerotium granules were formulated according to the following components and mass: 15g of *Metarhizium anisopliae* microsclerotium masterbatch powder obtained in step 1, plus 2g of mineral-derived fulvic acid and 2g of xanthan gum, and 81g of the remaining solid fermentation material after conidial extraction in Example 3. The *Metarhizium anisopliae* microsclerotium, along with the adjuvants and fermentation substrate, were mixed thoroughly in a mixer to prepare *Metarhizium anisopliae* microsclerotium granules, wherein the effective insecticidal active ingredient NMMa198 microsclerotium content is ≥0.1 billion microsclerotia / g.

[0129] Example 5: Control test of Metarhizium anisopliae conidial granules against the firefly beetle on scallops.

[0130] The conidial granules of *Metarhizium anisopliae* obtained in Example 3 were used to control the leaf beetle *Onionia spp.* in grassland areas. The test site was Xilinhot City, Inner Mongolia Autonomous Region. The specific method is as follows:

[0131] 1. Materials and Methods

[0132] Experimental design: Fifteen 10m×10m experimental plots were randomly selected in areas with moderate to severe occurrence of the sand onion leaf beetle in the Xilin Gol Grassland of Inner Mongolia. Each experimental plot was spaced at least 50m apart to prevent mutual interference between experimental plots. The pasture growth and soil conditions were kept basically consistent across all experimental plots.

[0133] Five treatments were established in the experimental plots: three groups with different application rates of the *Metarhizium anisopliae* conidial granules of this invention, a control group with a mass concentration of 0.3% matrine aqueous solution, and a blank control group. Each treatment was replicated three times, resulting in a total of 15 experimental plots. The *Metarhizium anisopliae* conidial granules were mixed evenly with 25 kg of organic fertilizer before being applied by broadcasting. The pH value of the organic fertilizer was below 8.

[0134] Treatment 1: Mix 1 kg / mu of the above-mentioned Metarhizium anisopliae granules with organic fertilizer and then apply it.

[0135] Treatment 2: Mix 2.5 kg / mu of the above-mentioned Metarhizium anisopliae granules with organic fertilizer and then apply.

[0136] Treatment 3: Mix 5 kg / mu of the above-mentioned Metarhizium anisopliae granules with cow and sheep manure organic fertilizer and spread evenly.

[0137] Treatment 4: 15 mL of 0.3% matrine aqueous solution was diluted with water to 300 mL for ultra-low volume spraying, serving as a control group for conventional insecticides;

[0138] Treatment 5: Blank control (CK), with only 25 kg of organic fertilizer applied as a blank control group.

[0139] Experimental survey: Surveys were conducted on the grassland before pesticide application and at 5, 7, and 10 days after treatment, for a total of three surveys. The number of pests in each plot was surveyed, and the growth of sand onions and other forage grasses was observed and recorded. The relative control effect was calculated using the following formula.

[0140] Insect population reduction rate (%) = (Insect population before pesticide application - Insect population after pesticide application) / (Insect population before pesticide application) × 100

[0141] Relative control effect (%) = (Pest population reduction rate in the control area - Pest population reduction rate in the blank control area) / (1 - Pest population reduction rate in the blank control area) × 100

[0142] The statistical results of the number of *Metarhizium anisopliae* granules at different dosages in the experimental group, control group, and blank group are shown in Table 3.

[0143] Table 3. Statistical analysis of the control efficacy of different doses of Metarhizium anisopliae conidial granules against the firefly beetle (May 10-20, 2022)

[0144]

[0145]

[0146] Note: M represents the average value, 1 represents parallel experiment 1, 2 represents parallel experiment 2, 3 represents parallel experiment 3, and the relative efficacy represents the relative efficacy value calculated from the control group 10 days after drug administration.

[0147] 2. Results and Analysis

[0148] Table 3 shows that in areas with moderate to severe infestation of the firefly leaf beetle in *Allium tuberosum*, the control agent matrine aqueous solution rapidly killed the pest and reduced the insect population in the field, with a reduction rate of 86.79% by day 10. However, the insect population showed a tendency to recover and rise again after day 10. *Metarhizium anisopliae* granules, after different dosage treatments, showed lower initial efficacy than matrine, but the efficacy rapidly increased after 7 days of treatment. Experimental group 2, with 2.5 kg / mu of *Metarhizium anisopliae* granules, and experimental group 3, with 5 kg / mu of *Metarhizium anisopliae* granules, showed the best control effect on the firefly leaf beetle in *Allium tuberosum*, with insect population reduction rates of 67.36% and 73.58% respectively 7 days after treatment. After 10 days of treatment, the efficacy of *Metarhizium anisopliae* granules reached the control level of matrine, with a relative efficacy exceeding 80%. This indicates that treatment with matrine and application rates of 2.5 kg / mu and 5 kg / mu of Metarhizium anisopliae granules were effective in controlling the firefly beetle on the sand onion. Furthermore, the Metarhizium anisopliae granules provided good and sustained control of the firefly beetle in the later stages. Field surveys also showed that the Metarhizium anisopliae granules significantly promoted the growth of sand onion and other forage grasses. This suggests that the Metarhizium anisopliae granules can be used for the green control of the firefly beetle on the sand onion. Considering cost factors, the recommended application rate of the Metarhizium anisopliae granules is 2 kg–4.0 kg / mu, with 2.5 kg / mu being more preferred.

[0149] Example 6: Control Test of Metarhizium anisopliae Microsclerotium Granules on Onion Leaf Beetle

[0150] The micro-sclerotium granules of Metarhizium anisopliae obtained in Example 4 were used for the control of the leaf beetle on grassland onion. The specific test site was Xilinhot City, Inner Mongolia Autonomous Region, and the specific method is as follows:

[0151] Experimental method: Fifteen 10×10m experimental plots were randomly selected in areas with moderate to severe occurrence of the firefly beetle in the grasslands of Inner Mongolia. Each experimental plot was spaced at least 50m apart to prevent mutual interference between plots. The pasture growth and soil conditions in all experimental plots were made as consistent as possible.

[0152] Five treatments were arranged in the experimental plots: three different dosage groups of the Metarhizium anisopliae microsclerotium granules of this invention, a chemical agent control group, and a blank control group. Each treatment was repeated three times in parallel, for a total of 15 experimental plots. The Metarhizium anisopliae microsclerotium granules were added to 25 kg of organic fertilizer, mixed evenly, and then sprayed using a motorized duster. The pH value of the organic fertilizer was below 8.

[0153] Treatment 1: Mix 1 kg / mu of the above-mentioned Metarhizium anisopliae granules with organic fertilizer and spray.

[0154] Treatment 2: Mix 2.5 kg / mu of the above-mentioned Metarhizium anisopliae granules with organic fertilizer and spray.

[0155] Treatment 3: Mix 5 kg / mu of the above-mentioned Metarhizium anisopliae granules with cow and sheep manure organic fertilizer and spray evenly;

[0156] Treatment 4: 12 mL of 4.5% high-efficiency cypermethrin was diluted with water to 300 mL for ultra-low volume spraying, serving as the chemical agent control group;

[0157] Treatment 5: Blank control (CK), with only 25 kg of organic fertilizer applied as a blank control group.

[0158] Experimental survey: Surveys were conducted on the grassland before pesticide application and at 5, 7, 10, and 15 days after treatment, for a total of 5 surveys. The number of pests in each plot was surveyed, and the growth of sand onions and other forage grasses was observed and recorded. The relative control effect was calculated using the following formula.

[0159] Insect population reduction rate (%) = (Insect population before pesticide application - Insect population after pesticide application) / (Insect population before pesticide application) × 100;

[0160] Relative control efficacy (%) = (Insect population reduction rate after pesticide application - Insect population reduction rate in blank control) / (1 - Insect population reduction rate in blank control) × 100.

[0161] The statistical results of the number of firefly beetles on the sand sedge were investigated at 5, 7, 10 and 15 days after treatment with different dosages of Metarhizium anisopliae microsclerotium granules in the experimental group, control group and blank group.

[0162] Table 4. Statistical analysis of the control efficacy of Metarhizium anisopliae microsclerotium granules against Onion leaf beetle in demonstration trials (May 10-25, 2022)

[0163]

[0164] Note: M represents the average value, 1 represents parallel experiment 1, 2 represents parallel experiment 2, 3 represents parallel experiment 3, and the relative efficacy represents the relative efficacy value calculated from the control group 15 days after drug administration.

[0165] Table 4 shows that in areas with moderately severe infestations of the firefly leaf beetle in sand onions, the control pesticide, high-efficiency cypermethrin, could rapidly kill the pests and reduce their population in the field. However, the pest population showed a tendency to recover and increase 10 days after application. The insecticidal effect of *Metarhizium anisopliae* microsclerotium granules on scarab beetles was slower, with a pest population reduction rate of about 30% after 5 days of treatment, far lower than that of the control pesticide, high-efficiency cypermethrin. However, after 7 days of treatment, the efficacy of *Metarhizium anisopliae* microsclerotium granules continued to improve. By day 10, the pest population reduction rate in the low-dose group reached over 55%, and in the high-dose group, it exceeded 80%. By day 15, the pest population reduction rates for both 2.5 kg and 5 kg dose granules were over 80%, with a relative efficacy exceeding that of the control pesticide, high-efficiency cypermethrin. This shows that both the chemical treatment and the treatments with 2.5 kg / mu and 5 kg / mu of Metarhizium anisopliae microsclerotium granules were effective in controlling the firefly beetle on the sand onion. The treatment with Metarhizium anisopliae granules provided good and sustained control of the firefly beetle on the sand onion in the later stages.

[0166] Field surveys showed that the Metarhizium anisopliae microsclerotium granules also significantly promoted the growth of sand onion and other forage grasses. This indicates that Metarhizium anisopliae granules can be used for the green control of sand onion leaf beetles. Considering cost factors, the recommended application rate of Metarhizium anisopliae granules is preferably 2 kg to 4.0 kg / mu, more preferably 2.5 kg / mu.

[0167] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Metarhizium anisopliae NMMa198, characterized in that, The preservation number of the *Metarhizium anisopliae* NMMa198 is CGMCC No. 40148.

2. A preparation of Metarhizium anisopliae for scarab beetles, characterized in that, The active ingredients of the Metarhizium anisopliae preparation include the conidia of Metarhizium anisopliae NMMa198 as described in claim 1 and / or the microsclerotia of NMMa198.

3. The Metarhizium anisopliae preparation according to claim 2, characterized in that, The number of conidia in the *Metarhizium anisopliae* preparation is greater than or equal to 1.0 × 10⁻⁶. 9 Conidia / g; the number of microsclerotia in the *Metarhizium anisopliae* preparation is greater than or equal to 1.0 × 10⁻⁶. 7 microsclerotia / g.

4. The *Metarhizium anisopliae* preparation according to claim 2 or 3, characterized in that, The method for preparing the conidia of Metarhizium anisopliae NMMa198 includes the following steps: Liquid seed culture was obtained by liquid-phase fermentation of conidia of Metarhizium anisopliae NMMa198. The liquid seed culture was then inoculated onto solid fermentation material for solid fermentation culture, and conidia powder was obtained by separation. The volume-to-mass ratio of the liquid seed solution to the solid fermentation material is 1L:10Kg; The liquid-phase fermentation culture is carried out at a temperature of 26–28°C, a rotation speed of 200–250 rpm, and a time of 56–72 h; the solid-phase fermentation culture is carried out at a temperature of 25–27°C and a time of 10–15 d.

5. The *Metarhizium anisopliae* preparation according to claim 2 or 3, characterized in that, The preparation method of the Metarhizium anisopliae NMMa198 microsclerotia includes the following steps: Conidia were obtained by plate culture of Metarhizium anisopliae NMMa198. The obtained conidia were inoculated into microsclerotium induction culture medium for induced fermentation culture to obtain fermentation products containing microsclerotia. The spore concentration of the conidial suspension inoculated into the microsclerotium induction culture medium was 1×10⁻⁶. 8 ~1×10 9 1 spore / mL; the temperature of the induced fermentation culture is 25-28℃, the rotation speed of the induced fermentation culture is 200-250 rpm, and the time of the induced fermentation culture is 5-7 days; The plate culture temperature is 26–28°C, and the plate culture time is 7–14 days.

6. The *Metarhizium anisopliae* preparation according to claim 2 or 3, characterized in that, The dosage forms of the Metarhizium anisopliae preparation include granules, powders, or wettable powders; When the dosage form is granules and the active ingredient of the Metarhizium anisopliae preparation is the conidia of Metarhizium anisopliae NMMa198, the Metarhizium anisopliae preparation is a spore-type Metarhizium anisopliae granule. By weight, the spore-type Metarhizium anisopliae granules comprise the following components: 1-6 parts of Metarhizium anisopliae NMMa198 conidia powder, 3-5 parts of adjuvants, and 90-94 parts of fermentation substrate; When the dosage form is granules and the active ingredient of the Metarhizium anisopliae preparation is the microsclerotium of Metarhizium anisopliae NMMa198, the Metarhizium anisopliae preparation is a microsclerotium type Metarhizium anisopliae granules. By weight, the micro-sclerotium type Metarhizium anisopliae granules comprise the following components: 10-20 parts of Metarhizium anisopliae NMMa198 micro-sclerotium mother powder, 3-5 parts of adjuvants, and 75-85 parts of matrix; the matrix includes fermentation matrix and / or carrier matrix; The Metarhizium anisopliae NMMa198 microsclerotium mother powder is a mixture of fermentation products containing Metarhizium anisopliae NMMa198 microsclerotiums and a carrier matrix. The fermentation substrate includes the solid fermentation material remaining after extracting the conidia of Metarhizium anisopliae NMMa198; The carrier matrix includes one or more of diatomaceous earth, kaolin, attapulgite, and clay.

7. The Metarhizium anisopliae preparation according to claim 6, characterized in that, The additives include potassium humate and / or xanthan gum.

8. The application of the Metarhizium anisopliae NMMa198 as described in claim 1 or the Metarhizium anisopliae preparation as described in any one of claims 2 to 7 in the control of pasture pests; The pest mentioned is the sand onion leaf beetle.

9. The application according to claim 8, characterized in that, The application method includes uniformly mixing the Metarhizium anisopliae granules and the dispersant and then applying them. The mass ratio of Metarhizium anisopliae granules to the dispersant during mixing is 1:10 to 1:

20. The dispersant includes organic fertilizer or fine soil.

Citation Information

Patent Citations

  • Application of Metarhizium anisopliae strain in preparation of insecticide for vegetable pest insects

    CN104611240A

  • Microbial preparation for underground pest control and application thereof

    CN114747596A