A method for constructing a Foxg1 p.Lys279* point mutation mouse model and its application

The Foxg1 p.Lys279* point mutant mouse model was constructed through CRISPR/Cas9 technology, which solved the problem that the existing model could not accurately simulate the symptoms of FOXG1 syndrome and achieved the accuracy of disease research and diagnostic intervention.

CN116784278BActive Publication Date: 2025-08-19SOUTHEAST UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310568827.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-19
Publication Date
2025-08-19
Estimated Expiration
2043-05-19

AI Technical Summary

Technical Problem

The existing Foxg1 systemic and conditional knockout mouse models cannot accurately simulate the clinical symptoms of patients with FOXG1 syndrome, and there is a lack of effective disease research models to reveal the pathogenic mechanism and develop precise intervention methods.

Method used

The Foxg1 p.Lys279* point mutant mouse model was constructed by CRISPR/Cas9 technology, and the genotype was verified by sgRNA design and microinjection. The genotype was verified by PCR and Southernblot method to ensure the stable inheritance and accuracy of the mutation.

Benefits of technology

A mouse model that can stabilize heredity and truly simulate the development of the disease was established to study the diagnosis and intervention of FOXG1 syndrome and mitochondria-related diseases, providing research conditions that are closer to clinical symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116784278B_ABST
    Figure CN116784278B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for constructing a mouse model with a Foxg1p.Lys279* point mutation and its application, belonging to the field of animal models. Mutations in the FOXG1 gene cause FOXG1 syndrome, a type of autism spectrum disorder. Mutations at different sites and in different forms of this gene result in widely varying clinical symptoms. The method for constructing a mouse model with a point mutation at amino acid position 279 includes the design and construction of Cas9 / sgRNA and its activity detection, the construction of a targeting vector, microinjection of Cas9 / sgRNA, identification of F0 generation mice, and genotyping and Southern blot analysis of F1 generation mice. The present invention performs site-directed mutagenesis on the Foxg1 gene in mice based on clinical cases, enabling the model mice to more accurately simulate the onset and progression of the disease. The present invention can provide a specific model for the study of the FOXG1 amino acid point mutation at position 279 and can be used to develop precise diagnostic and intervention strategies for FOXG1 syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of animal models, and particularly relates to a method for constructing a Foxg1 p.Lys279* point mutation mouse model and its application. Background Art

[0002] FOXG1 syndrome is a neurodevelopmental disorder caused by mutations in the forkhead box transcription factor FOXG1. Patients exhibit core symptoms of autism, including intellectual disability, language impairment, stereotyped behaviors, and poor social skills. Numerous cases of FOXG1 mutations have been reported, and patients with different mutations exhibit distinct clinical manifestations, suggesting that mutations at different sites in FOXG1 lead to varying degrees of brain developmental defects. However, the underlying mechanisms remain unclear, and precise clinical interventions are lacking.

[0003] Currently established Foxg1 systemic and conditional knockout mice fail to accurately mimic the symptoms of clinical patients. Homozygous Foxg1 knockout mice lack ventral structures in the telencephalon and are lethal at birth. Heterozygous Foxg1 mice survive to adulthood, but their symptoms differ significantly from those of patients with clinical heterozygous mutations. Various Foxg1 conditional knockout mice developed using the Cre-loxp system fail to accurately mimic the clinical symptoms and pathogenic mechanisms of patients. Therefore, establishing disease mouse models targeting different mutation sites that accurately mimic the clinical symptoms of patients, revealing their distinct pathogenesis, and developing effective therapeutic drugs and precise interventions are urgent challenges in the current study of FOXG1 syndrome. Summary of the Invention

[0004] To address the shortcomings of the existing technology, the present invention aims to provide a method for constructing a mouse model with the Foxg1 p.Lys279* point mutation. This method uses the CRISPR / Cas9 method to construct a novel, stably inherited Foxg1 point mutation mouse model targeting the FOXG1 amino acid point mutation at position 279. Amino acid position 279 is located in the functional region of FOXG1 that allows it to enter the mitochondria. This point mutation mouse model not only allows researchers to further study the biological functions of FOXG1 but also has applications in the study of mitochondrial diseases and the development of precise diagnostic and intervention methods for FOXG1 syndrome and other mitochondrial diseases.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] A method for constructing a Foxg1 p.Lys279* point mutation mouse model and its application, comprising the following steps:

[0007] Step 1: Cas9 / sgRNA design and construction

[0008] The Foxg1 gene is located on the plus strand of chromosome 12, with a size of 3.985 kb, NCBI ID: 15228;

[0009] The mutation sites in FOXG1 syndrome cases were analyzed, and a stop codon was chosen to be introduced after amino acid position 278;

[0010] The sgRNA was designed within a non-conserved sequence downstream of Intron1 and the 3' UTR, with homology arms of approximately 1.3 kb at the 5' and 1.3 kb at the 3' ends, respectively. Point mutation knock-in mouse models were generated using the CRISPR / Cas9-based EGE system.

[0011] In order to screen gene-targeted mice with correct recombination, we used PCR and Southern blot methods for verification, and simultaneously used 3'Probe and LRProbe to verify F1 generation positive mice.

[0012] Based on the design principles of sgRNA: eight sgRNAs were designed in the 5' target site (Intron1) and 3' target site (3'UTR) regions respectively;

[0013] The designed sgRNA sequence was synthesized into Oligos and connected into the pCS-4G vector by Gibson method. The ligation product was transformed and sent for sequencing.

[0014] Step 2: Detection of Cas9 / sgRNA activity

[0015] By UCA TM The activity of sgRNA was detected by this method, and sgRNA7 at the 5' target site and sgRNA16 at the 3' target site were comprehensively selected for the next experiment.

[0016] Step 3: Construction of targeting vector

[0017] Primers were designed to construct the targeting vector, and enzyme digestion and sequencing were performed to confirm that the construction of the targeting vector was complete.

[0018] Step 4: Microinjection of Cas9 / sgRNA

[0019] Cas9 / sgRNA and targeting vectors were microinjected into mouse fertilized eggs, and then the F0 mice were waited for to be born.

[0020] Step 5: Genotype identification of F0 generation founder mice

[0021] Because early embryonic cleavage is rapid, the resulting F0 mice are chimeric. Therefore, the F0 genotype determined by PCR analysis of the F0 mouse tail is for reference only and does not guarantee a heritable genetic mutation. Heritable genotypes must be determined after genotyping the F1 mice.

[0022] Step 6: Genotyping and Southern blot identification of F1 generation mice

[0023] The F0 generation Founder mice were selected and mated with wild-type mice to produce F1 generation mice. The DNA of the F1 generation PCR-positive mice was subjected to Southern blot detection and sequencing to confirm that the mutant alleles were correctly recombined and there was no random insertion, indicating that the Foxg1 gene point mutation mouse model was successfully constructed.

[0024] Furthermore, the method for constructing a Foxg1 gene point mutation mouse model is characterized in that,

[0025] 5' target site of sgRNA7: AGGCTAGGAGACAGCGATCGAGG

[0026] 3' target site of sgRNA16: TAGCCAACCTGCTTCTCTACTGG

[0027] The inserted mutant allele adds a T base at position 834 in the coding region, causing it to stop coding at amino acid position 279.

[0028] Furthermore, the method for constructing a Foxg1 gene point mutation mouse model is characterized in that, wherein, the sequences of two pairs of primers for identifying F0 generation mice are as shown in SEQ ID NO.17-20: FOXG1-279-F1: TATCAAGACTGAGAGATCATTTAGC;

[0029] FOXG1-279-R1:AACCTGCTTCTCTCATGACCATGGT;

[0030] FOXG1-279-F2:CCTCGAACGCGTAGTACTGATATCT;

[0031] FOXG1-279-R2: TTATGTGCCATCTCTTTGGGGGTGA.

[0032] Furthermore, the method for constructing a Foxg1 gene point mutation mouse model is characterized in that the primer sequences for genotyping and sequencing of the F1 generation mice are as shown in SEQ ID NOs. 21-24:

[0033] FOXG1-279-WT-F:GAGTTACTGAAGTGATCACCTGTTG;

[0034] FOXG1-279-GT-R:AACCTGCTTCTCTCATGACCATGGT;

[0035] FOXG1-279-GT-F(in):AACCTGTCCCTCAACAAGTGCTTCG;

[0036] FOXG1-279-GT-R(in): GGTGGAGAAGGAGTGGTTGTTGCC.

[0037] Beneficial effects of the present invention:

[0038] The present invention constructs a mouse model with a point mutation at amino acid position 279 in the FOXG1 gene, a risk gene for autism spectrum disorder (ASD). By using site-directed mutagenesis of the Foxg1 gene, the mice undergo genomic alterations, allowing the disease to develop naturally after birth. This allows disease research in model mice to be conducted under conditions that more closely resemble the onset and progression of real diseases, making the results of such research more valuable. This model mouse can be used not only for the study of FOXG1 syndrome, but also for the study of neurodevelopmental diseases including autism, microcephaly, intellectual disability, and mitochondrial-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0040] Figure 1 Schematic diagram of the design of the Foxg1 p.Lys279* point mutation mouse model of the present invention;

[0041] Figure 2 Schematic diagram of the Southern blot screening strategy for the Foxg1 p.Lys279* point mutation mouse model of the present invention;

[0042] Figure 3 The targeting sequences corresponding to the eight sgRNAs designed in the 5' and 3' target regions of the present invention are as follows;

[0043] Figure 4 This is the map of the pCS-4G vector of the present invention;

[0044] Figure 5 is the activity detection result of the sgRNA of the present invention;

[0045] Figure 6 This is a diagram of the construction of the targeting vector of the present invention;

[0046] Figure 7 This is a PCR identification diagram of the F0 generation mice with the Foxg1 p.Lys279* point mutation of the present invention;

[0047] Figure 8 This is a PCR identification diagram of the F1 generation mice with the Foxg1 p.Lys279* point mutation of the present invention;

[0048] Figure 9 This is a Southern blot test result of PCR-positive mice of the F1 generation of the present invention;

[0049] Figure 10 This is the gene sequencing map of the F1 generation mouse with the Foxg1 p.Lys279* point mutation of the present invention: c.834dupT, p.Lys279*. DETAILED DESCRIPTION

[0050] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0051] A method for constructing a Foxg1 p.Lys279* point mutation mouse model,

[0052] Example 1:

[0053] 1. Target construction:

[0054] Using CRISPR / Cas9 gene targeting technology, sgRNA targeting the target gene is constructed and transcribed into mRNA in vitro, so that the Cas9 protein can cut the DNA double strand at a specific site.

[0055] (1) Genetic information

[0056] Gene Bank Gene ID: 15228

[0057] (2) Design concept

[0058] First, the mutation sites and clinical symptoms of FOXG1 syndrome cases were analyzed. This clinical case had a base mutation at amino acid position 287, which continued to encode 168 bases before stopping the coding. Its symptoms included epilepsy, delayed myelination, and incomplete corpus callosum development. Next, the coding region of the gene was known based on the species and gene name, and the genomic structure corresponding to that of humans was analyzed to determine that a stop codon was introduced after amino acid position 278 of the mouse Foxg1 gene. The sgRNA was designed in the non-conserved sequence downstream of IntronⅠ and 3'UTR. The homology arms at the 5' and 3' ends were 1.3kb and 1.3kb, respectively, and were designed as follows. Figure 1 In order to screen gene-targeted mice with correct recombination, we used PCR and Southern blot to verify, and simultaneously used 3'Probe and LR Probe to verify F1 generation positive mice. The specific design is as follows Figure 2 shown.

[0059] (3) Target design

[0060] Based on the design principle of sgRNA, we designed 8 sgRNAs in the 5' and 3' target regions respectively. The sequences of the 8 sgRNAs are as follows: Figure 3 Oligos was synthesized according to the designed sgRNA sequence and linked into the pCS-4G vector by Gibson method. The map of the pCS-4G vector is shown in Figure 4 After the ligation product is sequenced correctly, use UCA TM The activity of sgRNA was detected by Figure 5 As shown, the following two sgRNAs with the highest activity were finally selected for the next experiment. The targeting plasmids were as follows Figure 6 As shown in SEQ ID NO.1-16.

[0061] 5' target site

[0062] SgRNA1: AATCAGTGCCGCCGGCGTGCAGG

[0063] SgRNA2:CAGACGTCCTGCACGCCGGCGG

[0064] SgRNA3:TGCACGCCGGCGGCACTGATTGG

[0065] SgRNA4:GCACTGATTGGTTCGGCAGTAGG

[0066] SgRNA5:GCCGAACCAATCAGTGCCGCCGG

[0067] SgRNA6:CCGAGCTACAGGCGCACACTAGG

[0068] SgRNA7: AGGCTAGGAGACAGCGATCGAGG

[0069] SgRNA8:CTGGGCCCCGATTGGTCGACGG

[0070] 3' target site

[0071] SgRNA9: TGGATCCTGTGGTGATTCTGTGG

[0072] SgRNA10:TCCTGTGGTGATTCTGTGGAAGG

[0073] SgRNA11: CTGTTGTAATGATTTATAGACGG

[0074] SgRNA12:CGTCTAATAAATCATTACAACAGG

[0075] SgRNA13:GTACCTCTATGATGTAAAAATGG

[0076] SgRNA14:TCTATGATGTAAAAATGGAGGGG

[0077] SgRNA15:TCTGCAGTAATGCAATAAGCTGG

[0078] SgRNA16: TAGCCAACCTGCTTCTCTACTGG

[0079] 5' target site of sgRNA7: AGGCTAGGAGACAGCGATCGAGG

[0080] 3' target site of sgRNA16: TAGCCAACCTGCTTCTCTACTGG

[0081] 2. Superovulation of Embryo Donor Mice (C57BL / 6)

[0082] Donor female mice were treated with PMSG (pregnant mare serum gonadotropin), injected with hCG (human chorionic gonadotropin) 48 hours later, and mated with male mice in the same cage. The fertilized eggs were collected for microinjection the next day.

[0083] 3. Microinjection

[0084] Oligos were synthesized according to the designed sgRNA sequence and ligated into the pCS-4G vector containing Cas9 via Gibson Assembly. Primers were designed to construct the targeting vector, which was purified and then injected pronuclearly into fertilized mouse eggs along with Cas9 and sgRNA at a 50:1 ratio.

[0085] 4. Genotype Identification of F0 Generation Founder Mice

[0086] Since the embryonic cleavage rate is very fast in the early stage, the F0 mice obtained are chimeras. Therefore, the F0 genotype obtained by PCR identification of the F0 mouse tail is for reference only. The identification results are as follows: Figure 7 As shown: PCR products and sequencing indicate that E11Y13-0040 and 11Y13-0042 are F0 mice with positive point mutations; E11Y13-0057 and 11Y13-0064 are F0 mice with suspected positive point mutations. However, this does not guarantee that the mice obtained have heritable gene mutations; heritable genotypes must be confirmed after genotyping of the F1 mice.

[0087] 5. Genotype and Southern blot identification of F1 mice

[0088] The above-mentioned positive and suspected positive F0 generation Founder mice were selected to mate with wild-type mice, and the mice born were the F1 generation. The DNA of the F1 generation PCR-identified positive mice was subjected to Southern blot detection and sequencing. The primer design principles were consistent with those of the F0. The results of this part are shown in Figures 8, 9, and 10. The results of PCR identification and point mutation site sequencing showed that 1E11Y13-0002, 1E11Y13-0003, 1E11Y13-0006, 1E11Y13-0019, 1E11Y13-0021, 1E11Y13-0023, 1E11Y13-0028, 1E11Y13-0032, 1E11Y13-0057, and 1E11Y13-0068 were the F1 mice with positive point mutations in the initial screening. Tail DNA of some F1 mice that were initially screened for point mutations was extracted for Southern Blot analysis and sequencing. The results showed that 1E11Y13-0002, 1E11Y13-0003, 1E11Y13-0006, 1E11Y13-0019, 1E11Y13-0021, 1E11Y13-0023, 1E11Y13-0028, 1E11Y13-0032, 1E11Y13-0057 and 1E11Y13-0068 were all correctly recombined, and there were no random mutations, indicating that the Foxg1 gene point mutation mouse model was successfully constructed.

[0089] Example 2:

[0090] Application of a mouse line harboring the Foxg1 c.834dupT, p.Lys279* point mutation. After sequencing, sexually mature mice were mated and bred. This mouse model exhibits characteristics such as corpus callosum hypoplasia in adulthood. This mouse model allows investigation of the critical period of corpus callosum midline crossing at different developmental times. Compared to wild-type mice, the abnormalities in the gene networks caused by this mutation can be constructed to analyze its pathogenic mechanisms.

[0091] Example 3:

[0092] Using a mouse line harboring the Foxg1 c.834dupT, p.Lys279* point mutation, we observed behavioral characteristics of these mutant mice and attempted to investigate drug interventions. FOXG1 syndrome often presents with stereotyped behaviors, social withdrawal, and epilepsy, but there are currently no effective treatments for this condition. This mutant mouse model provides support for the development of related drugs.

[0093] Throughout this specification, references to terms such as "one embodiment," "example," or "specific example" indicate that the specific features, structures, materials, or characteristics described in conjunction with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, schematic representations of these terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0094] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention, and such changes and modifications fall within the scope of the invention as claimed.

Claims

1. A method for constructing a Foxg1p.Lys279* point mutation mouse model, characterized in that: The following steps are involved: The Foxg1 gene was selected, and a stop codon was introduced after amino acid position 278. sgRNAs were designed in the non-conserved sequences downstream of Intron1 and the 3' UTR. Eight sgRNAs were designed in the 5' and 3' target regions, respectively. Activity was tested, and the most active sgRNAs for the 5' target site, sgRNA7, and the sgRNA for the 3' target site were selected for the next step of the experiment. Oligos were synthesized according to the designed sgRNA sequence and linked into the pCS-4G vector containing Cas9 via the Gibson Assembly method. Primers were designed to construct a targeting vector, which was purified and then microinjected pronuclearly into fertilized mouse eggs along with Cas9 and sgRNA to obtain F0 generation mice, which were then genotyped. F0 generation mice were mated with wild-type mice to obtain F1 generation mice, and genotyping and Southern blot analysis confirmed that the Foxg1 gene point mutation mouse model was successfully constructed.

2. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The sequences of the 8 5' target site sgRNAs are SEQ ID NOs. 1-8, and the sequences of the 8 3' target site sgRNAs are SEQ ID NOs. 9-16; The sgRNA sequence for the 5' target site with the highest activity is shown in SEQ ID NO.7, and the sgRNA sequence for the 3' target site with the highest activity is shown in SEQ ID NO.

16.

3. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The activity detection is specifically performed by detecting the activity of sgRNA using the UCATM method.

4. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: When constructing the targeting vector, enzyme digestion identification and sequencing are performed to confirm that the targeting vector construction is complete.

5. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The genotype of F0 generation mice was identified by PCR on the tail of F0 generation mice.

6. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The genotype and Southern blot identification of the F1 generation mice were performed, and the DNA of the F1 generation mice identified as PCR-positive mice was subjected to Southern blot detection and sequencing to confirm that the mutant alleles were correctly recombined and there was no random insertion, indicating that the Foxg1 gene point mutation mouse model was successfully constructed.

7. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The stop codon adds a T base at position 834 of the coding region, so that the coding is terminated at amino acid position 279.

8. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The primer sequences for PCR identification of F0 generation mice are shown in SEQ ID NOs. 17-20.

9. The method for constructing a Foxg1p.Lys279* point mutation mouse model according to claim 1, characterized in that: The primer sequences for genotyping and sequencing of F1 generation mice are shown in SEQ ID NOs. 21-24.

10. Use of the method for constructing a Foxg1p.Lys279* point mutation mouse model according to any one of claims 1 to 9 in the study of neurodevelopmental diseases.

Citation Information

Patent Citations

  • Method for constructing KARS-gene-mutated mouse models and application of KARS-gene-mutated mouse models

    CN106929533A

  • Alzheimer's disease lesion FoxG1 overexpression mouse model construction method and application

    CN110622921A