Application of PLPP3 in regulating cellular oxidative stress in human ovarian granulosa cells

Abstract

The present invention discloses the application of PLPP3 in regulating cellular oxidative stress in human ovarian granulosa cells, belonging to the field of cell engineering and genetic engineering technology. The present invention first discovered that overexpression of the PLPP3 gene can significantly increase the level of oxidative stress in human ovarian granulosa cells, inhibit granulosa cell proliferation, and promote granulosa cell apoptosis; while interfering with the expression of the PLPP3 gene can significantly reduce the level of oxidative stress in human ovarian granulosa cells, promote granulosa cell proliferation, inhibit granulosa cell apoptosis, and thus promote follicle development. The present invention has great application value in studying the mechanism of the influence of oxidative stress regulation on ovarian follicle development, reproductive capacity and ovarian-related diseases, and has important clinical value in protecting ovarian function and treating ovarian-related diseases.

Description

Technical Field

[0001] The present invention belongs to the technical fields of cell engineering and genetic engineering, and particularly relates to the application of PLPP3 in regulating cellular oxidative stress in human ovarian granulosa cells. Background Art

[0002] Oxidative stress is a major driver of cellular aging. When reactive oxygen species (ROS) in the body exceed the antioxidant and scavenging capacity of cells, oxidative stress levels increase. Studies have shown that oxidative stress levels are positively correlated with female age. Oxidative stress induces follicular atresia, a gradual decline in oocyte quantity and quality, and ultimately leads to ovarian aging and ovarian-related diseases such as polycystic ovary syndrome. Ovarian aging is associated with inactivated antioxidant pathways, increased ROS levels, and apoptosis in mammalian granulosa cells. Superoxide dismutase (SOD1), a major endogenous antioxidant, protects against oxidative stress caused by excessive ROS accumulation. Studies have shown that SOD1 knockout mice exhibit suppressed follicular development compared to normal mice. Excessive ROS accumulation leads to granulosa cell apoptosis, telomere shortening, and mitochondrial dysfunction, promoting corpus luteum degeneration, reducing ovarian oocyte quality, and ultimately leading to follicular atresia and accelerated ovarian aging. These findings highlight the role of oxidative stress in regulating granulosa cell apoptosis and follicular development.

[0003] Phospholipid phosphatase, a glycoprotein localized to the cytoplasmic membrane, hydrolyzes lysophosphatidic acid and short-chain phosphatidic acid, converting it into diacylglycerol, playing a role in the de novo synthesis of glycerolipids and receptor activation signaling pathways. Furthermore, PLPP3 has been reported to hydrolyze phosphoceramide and phosphatol. Through the production of these products, the PLPP3 gene is involved in cell adhesion, cell-cell interactions, angiogenesis, and related inflammatory responses and cell invasion in related diseases. Despite these important biological functions, the role of PLPP3 in the development of ovarian granulosa cells and follicles remains unclear. Summary of the Invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the object of the present invention is to provide an application of PLPP3 in regulating oxidative stress in human ovarian granulosa cells.

[0005] PLPP3 regulates cellular oxidative stress in human ovarian granulosa cells.

[0006] The present invention constructed the PLPP3 gene overexpression plasmid pcDNA3.1-PLPP3 (OE-PLPP3) and synthesized its interference sequence si-PLPP3 (synthesized by Dongze Company). Then, overexpression and interference efficiency tests were performed respectively, and 1000ng pcDNA3.1-PLPP3 and 100nM si-PLPP3 were selected for subsequent transfection experiments. The effect of PLPP3 gene on ROS level in granulosa cells was detected by ROS detection kit; qRT-PCR and Western blotting were used to detect the effect of PLPP3 gene on ROS level in granulosa cells. Western blotting (WB) protein assay was used to detect the effect of PLPP3 gene on the mRNA and protein levels of oxidative stress signaling pathway marker genes. RNA immunoprecipitation (RIP) and co-immunoprecipitation (Co-IP) experiments were used to detect the interaction between PLPP3 protein and oxidative stress signaling pathway marker genes at the mRNA and protein levels. The CDS of key antioxidant genes were truncated (divided into 5'UTR, 5 exon regions and 3'UTR regions, and quantitative primers were designed for the corresponding regions for amplification) to detect their specific binding regions with PLPP3 protein. RNA and protein nucleocytoplasmic fractionation experiments were used to detect the interaction between PLPP3 gene and oxidative stress signaling pathway marker genes. The expression localization and interaction of PLPP3 in the cytoplasm and nucleus were investigated. Using the bioinformatics website, it was discovered that the PLPP3 protein contains an acidPPc domain (130aa-271aa) and two transmembrane regions (TransR). Therefore, GFP-PLPP3 segmented fusion proteins were constructed: Full (containing the full-length PLPP3 protein, 1aa-311aa), TransR-acidPPc (1aa-275aa), and TransR (1aa-125aa). Specific sites of interaction between key oxidative stress proteins and PLPP3 were detected. Tissue immunofluorescence experiments were used to detect the interaction between the PLPP3 gene and key oxidative stress proteins at the ovarian tissue level. The effects of PLPP3 on the proliferation and cell viability of human ovarian granulosa cells were detected using EdU and CCK8 assays. The effect of PLPP3 on the apoptosis of human ovarian granulosa cells was investigated using the Annexin V / PI assay.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The use of PLPP3 in regulating oxidative stress in human ovarian granulosa cells, wherein the use is any one or more of the following:

[0009] I. Application of overexpression of exogenous PLPP3 gene to promote oxidative stress in ovarian granulosa cells in vitro;

[0010] II. Application of inhibiting PLPP3 gene expression to suppress oxidative stress in ovarian granulosa cells in vitro.

[0011] Furthermore, overexpression of the exogenous PLPP3 gene significantly increased the ROS level in ovarian granulosa cells, and significantly decreased the mRNA and protein levels of endogenous antioxidant genes SOD1, SOD2, and CAT; inhibition of PLPP3 gene expression significantly decreased the ROS level in ovarian granulosa cells, and significantly increased the mRNA and protein levels of endogenous antioxidant genes SOD1, SOD2, and CAT.

[0012] The use of PLPP3 in regulating cellular oxidative stress in human ovarian granulosa cells is any one or more of the following:

[0013] III. In vitro, overexpression of the exogenous PLPP3 gene increased oxidative stress in ovarian granulosa cells and inhibited their proliferation.

[0014] IV. In vitro, inhibition of PLPP3 gene expression reduced oxidative stress in ovarian granulosa cells and promoted their proliferation.

[0015] V. In vitro, overexpression of exogenous PLPP3 gene increased the oxidative stress level in ovarian granulosa cells and promoted apoptosis of ovarian granulosa cells;

[0016] VI. In vitro environment, inhibiting PLPP3 gene expression, reducing the oxidative stress level of ovarian granulosa cells, and inhibiting ovarian granulosa cell apoptosis.

[0017] Furthermore, overexpression of exogenous PLPP3 gene significantly decreased the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA and p65 in ovarian granulosa cells, while the protein levels of CDK4 and PCNA genes were significantly increased; inhibition of PLPP3 gene expression significantly increased the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA and p65 in ovarian granulosa cells, while the protein levels of CDK4, PCNA and p65 genes were significantly decreased.

[0018] Furthermore, overexpression of exogenous PLPP3 gene significantly increased the mRNA levels of apoptosis signaling pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX and BIM in ovarian granulosa cells, while the mRNA levels of MCL1 and CREB1 significantly decreased. Among them, the protein levels of BIM, BAX and CASP9 significantly increased, while the protein level of MCL1 significantly decreased. Inhibition of PLPP3 gene expression significantly decreased the mRNA levels of apoptosis signaling pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX and BIM in ovarian granulosa cells, while the mRNA levels of MCL1 and CREB1 significantly increased. Among them, the protein levels of BIM, BAX and CASP9 significantly decreased, while the protein level of MCL1 significantly increased.

[0019] The use of PLPP3 in regulating the transcription and / or translation activity of the SOD1 gene in human ovarian granulosa cells, wherein the use is any one or more of the following:

[0020] VII. Application of overexpression of exogenous PLPP3 gene to inhibit the transcription and / or translation activity of SOD1 gene in vitro;

[0021] VIII. Application of inhibiting PLPP3 gene expression to promote SOD1 gene transcription and / or translation activity in vitro.

[0022] Furthermore, the overexpression of the exogenous PLPP3 gene is achieved through gene overexpression technology.

[0023] Furthermore, the gene overexpression plasmid used in the gene overexpression technology is prepared by the following method:

[0024] (1) cDNA was extracted from ovarian granulosa cells and PCR amplified using the cDNA as a template to obtain the target fragment;

[0025] (2) The target fragment was ligated to the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpnl to obtain a recombinant plasmid.

[0026] Furthermore, the primers used for PCR amplification in step (1) are as follows:

[0027] Forward: 5′-GG GGTACC CCATGCTGATGGTCCTCCTTGTATC-3′;

[0028] Reverse:5′-GC TCTAGAG CCTACACCATGTTGTGGTGATTGTT-3′.

[0029] Furthermore, the inhibition of PLPP3 gene expression is achieved through RNA interference technology.

[0030] Furthermore, the small interfering fragment sequence used in the RNA interference technology is as follows:

[0031] si-PLPP3: 5′-CTGATGGGTCCTCCTTGTAT-3′.

[0032] Use of an agent for inhibiting PLPP3 gene expression in the preparation of a drug for promoting follicle development.

[0033] Furthermore, the agent for inhibiting PLPP3 gene expression is a small interfering fragment, the sequence of which is as follows:

[0034] si-PLPP3: 5′-CTGATGGGTCCTCCTTGTAT-3′.

[0035] This study, focusing on protein-protein interactions, employed cell biology methods to investigate the role of PLPP3 in regulating cellular oxidative stress in granulosa cells. Specifically, the study examined the effects of PLPP3 on oxidative stress in granulosa cells, focusing on its regulation of ROS levels and marker genes of the oxidative stress signaling pathway. Granulosa cells were transfected with a PLPP3 overexpression plasmid and found to increase oxidative stress levels in these cells. Furthermore, RIP and Co-IP experiments revealed that PLPP3 interacted with SOD1 at both the mRNA and protein levels, negatively regulating SOD1 expression. Furthermore, Co-IP experiments with a GFP-PLPP3 fusion protein confirmed the interaction between SOD1 and the acidPPC domain of PLPP3. Finally, the study demonstrated that overexpression of PLPP3 inhibited proliferation and viability of human ovarian granulosa cells and promoted apoptosis. This study explores how PLPP3 regulates the oxidative stress level in granulosa cells by interacting with SOD1, thereby affecting the function of human ovarian granulosa cells. This study has great application value in studying the molecular mechanism of PLPP3 gene involvement in follicle development regulation and ovarian aging.

[0036] The verification results of the present invention are as follows:

[0037] In vitro, overexpression of the PLPP3 gene can significantly increase the ROS level in human ovarian granulosa cells; while interfering with the expression of the PLPP3 gene can significantly reduce the ROS level in granulosa cells.

[0038] In vitro, overexpression of the PLPP3 gene can significantly reduce the mRNA and protein levels of endogenous antioxidant genes SOD1, SOD2 and CAT; while interference with the PLPP3 gene can significantly increase the mRNA and protein levels of SOD1, SOD2 and CAT.

[0039] In vitro, anti-PLPP3 antibodies can significantly enrich SOD1 mRNA and SOD1 protein; and anti-SOD1 antibodies can significantly enrich PLPP3 protein.

[0040] In vitro, anti-PLPP3 antibodies can significantly enrich exon 2, exon 3, exon 5 and 3'UTR regions of the SOD1 gene.

[0041] In vitro, the PLPP3 gene can co-localize with SOD1 mRNA and SOD1 protein in the cytoplasm and nucleus, and negatively regulate the expression of the SOD1 gene.

[0042] In vitro, SOD1 protein can specifically bind to the acidPPc domain of PLPP3 protein.

[0043] In vitro, anti-PLPP3 antibodies can significantly enrich SOD1 protein in human ovarian tissue. PLPP3 and SOD1 proteins co-localize in human ovarian tissue. In the ovarian tissue of middle-aged individuals (approximately 40 years old), PLPP3 protein expression is low, but SOD1 protein expression is high; in the ovarian tissue of elderly individuals (approximately 60 years old), PLPP3 protein expression is high, but SOD1 protein expression is low.

[0044] In vitro, overexpression of the PLPP3 gene can significantly reduce the proliferation rate of human ovarian granulosa cells; while interfering with the expression of the PLPP3 gene can significantly increase the proliferation rate of granulosa cells.

[0045] In vitro, overexpression of PLPP3 can significantly reduce the viability of human ovarian granulosa cells, while interfering with the expression of the PLPP3 gene can significantly increase the viability of granulosa cells.

[0046] In vitro, overexpression of PLPP3 can significantly reduce the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA and p65 in granulosa cells, and significantly reduce the protein levels of CDK4 and PCNA genes; while interfering with the expression of the PLPP3 gene significantly increased the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA and p65, and significantly increased the protein levels of CDK4, PCNA and p65 genes.

[0047] In vitro, overexpression of PLPP3 can significantly increase the apoptosis rate of granulosa cells, while interfering with the expression of the PLPP3 gene can significantly reduce the apoptosis rate of granulosa cells.

[0048] In vitro, overexpression of PLPP3 can significantly increase the mRNA levels of apoptosis signaling pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX and BIM, and reduce the mRNA levels of MCL1 and CREB1 in granulosa cells; while interfering with the expression of PLPP3 can significantly reduce the mRNA levels of apoptosis signaling pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX and BIM, and increase the mRNA levels of MCL1 and CREB1; overexpression of PLPP3 can significantly increase the expression of pro-apoptotic marker proteins BIM, BAX and CASP9, and reduce the expression of anti-apoptotic marker protein MCL1, while si-PLPP3 can significantly reduce the expression of pro-apoptotic marker proteins BIM, BAX and CASP9, and increase the expression of anti-apoptotic marker protein MCL1.

[0049] The present invention has the following advantages and effects compared to the prior art:

[0050] The present invention's technical solution is well-designed and yields reliable results. To confirm the effect of PLPP3 on the function of human ovarian granulosa cells through regulation of cellular oxidative stress, the present invention conducted multi-level and multi-faceted validation. First, PLPP3's regulation of oxidative stress levels was verified by regulating cell phenotype and the mRNA and protein levels of oxidative stress signaling pathway marker genes. Next, RIP, Co-IP, and the construction of a GFP-PLPP3 fusion protein were used to verify the interaction between PLPP3 and oxidative stress signaling pathway marker proteins, identifying specific regions where PLPP3 interacts with key oxidative stress proteins. Finally, the effect of PLPP3 on granulosa cell proliferation, cell viability, and apoptosis was examined to confirm the effect of PLPP3 on granulosa cell function.

[0051] The present invention discovered for the first time that overexpression of the PLPP3 gene can significantly increase the oxidative stress level of human ovarian granulosa cells, inhibit granulosa cell proliferation, and promote granulosa cell apoptosis; while interfering with the expression of the PLPP3 gene can significantly reduce the oxidative stress level of human ovarian granulosa cells, promote granulosa cell proliferation, inhibit granulosa cell apoptosis, and thus promote follicle development.

[0052] The present invention has great application value in studying the influence mechanism of oxidative stress regulation on ovarian follicle development, reproductive capacity and ovarian-related diseases, and has important clinical reference value in protecting ovarian function and treating ovarian-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 Figure 3 is a graph showing the effect of PLPP3 gene on ROS level in granulosa cells; a and b are the detection of overexpression efficiency of PLPP3 gene; c and d are the detection of interference efficiency of PLPP3 gene; e is the effect of overexpression of PLPP3 gene and interference of PLPP3 gene expression on ROS level in granulosa cells respectively; f is the effect of OE-PLPP3 and si-PLPP3 on mRNA levels of oxidative stress signaling pathway marker genes CYP2E1, AHR, CYP1B1, SOD1, SOD2 and CAT; g is the effect of PLPP3 on protein levels of endogenous antioxidant enzymes SOD1, SOD2 and CAT.

[0054] Figure 2 The figures are the results of the study on the interaction between PLPP3 and SOD1 genes at the mRNA and protein levels; among them, a is the mRNA enrichment of oxidative stress signaling pathway marker genes on anti-PLPP3 antibodies in the RIP experiment; b is the protein enrichment of oxidative stress signaling pathway marker proteins on anti-PLPP3 antibodies in the Co-IP experiment; c is the protein enrichment of PLPP3 protein on anti-SOD1 antibodies in the Co-IP experiment; d is the mRNA enrichment of CDS region truncated fragments of SOD1 gene on anti-PLPP3 antibodies in the RIP experiment; e and f are the interaction between PLPP3 gene and SOD1 gene in mRNA (e) and protein (f) in the cytoplasm and nucleus in RNA and protein nuclear-cytoplasmic separation experiments.

[0055] Figure 3 Figure 1 is a study result of the specific site binding between SOD1 protein and PLPP3 protein; wherein, a is a schematic diagram of the protein domain of PLPP3 and the truncation treatment of GFP-PLPP3 fusion protein; b and c are the fluorescence image (b) and WB protein level detection of GFP-PLPP3 fusion protein in granulosa cells; d is the binding of SOD1 protein to the specific site of PLPP3 protein in the Co-IP experiment.

[0056] Figure 4 Figure 2 shows the results of a study on the interaction between PLPP3 and SOD1 proteins in human ovarian tissue. Figure a shows the enrichment of SOD1 protein in human ovarian granulosa cells in response to anti-PLPP3 antibodies. Figure b shows the co-localization and interaction of PLPP3 and SOD1 proteins in ovarian tissues of middle-aged (approximately 40 years old) and elderly (approximately 60 years old) individuals in tissue immunofluorescence experiments.

[0057] Figure 5Figure 5 is a study result of the effect of PLPP3 on granulosa cell proliferation and cell viability; among them, a and b are the fluorescence images (a) and cell proliferation rate statistics (b) of the effects of OE-PLPP3 and si-PLPP3 on the proliferation rate of granulosa cells in the EdU experiment; c and d are the effects of OE-PLPP3 (c) and si-PLPP3 (d) on the activity of granulosa cells; e is the effect of OE-PLPP3 and si-PLPP3 on the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA and p65; f is the effect of OE-PLPP3 and si-PLPP3 on the protein levels of proliferation pathway marker genes CDK4, PCNA and p65.

[0058] Figure 6 Figure 3 is a study result on the effect of PLPP3 on the apoptosis level of granulosa cells; among them, a and b are the effects of OE-PLPP3 (a) and si-PLPP3 (b) on the apoptosis rate of granulosa cells; c is the effect of OE-PLPP3 and si-PLPP3 on the mRNA levels of apoptosis pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX, BIM, MCL1 and CREB1; d is the effect of OE-PLPP3 and si-PLPP3 on the protein levels of apoptosis pathway marker genes BIM, BAX and CASP9. DETAILED DESCRIPTION

[0059] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0060] The experimental methods in the following examples without specific conditions are generally based on conventional conditions.

[0061] In the following examples, statistical methods were applied to analyze the results of three independent experiments in each example, and the "mean ± standard deviation" was calculated. The significance of the differences was analyzed using one-way analysis of variance ("*" indicates P < 0.05, and "**" indicates P < 0.01 in the figure).

[0062] Example 1: Cultivation of human ovarian cancer granulosa cell line COV434

[0063] The COV434 cell line (ATCC) used in the present invention is cultured in a complete culture medium (containing 10% calf serum and 1% double antibody) at 37°C and 5% CO2 incubator. Transfection or drug treatment is performed when the cell confluence reaches 50%-70%, and subsequent experiments can be performed after 24 hours.

[0064] Example 2: Construction of PLPP3 gene overexpression plasmid

[0065] (1) Primers were designed using the NCBI website, and the CDS region of the PLPP3 gene (Gene ID: 8613) was amplified using cDNA extracted from human granulosa cells as a template. The amplified fragment was purified, recovered, ligated to the pMD18T vector (Takara, Japan), transformed, screened, and sequenced to extract the common plasmid.

[0066] (2) Xba I and Kpn I restriction site sequences were added to the upstream and downstream primers of the PLPP3 gene, respectively. PCR amplification was performed using the recombinant pMD18T common plasmid of the PLPP3 gene CDS region as a template. The fragment was purified, recovered, double-enzyme digested, ligated to the pcDNA3.1 vector, transformed, screened, and sequenced to confirm its correctness. The endotoxin-free plasmid was extracted using the endotoxin-free plasmid rapid extraction kit (Magen, USA) and named pcDNA3.1-PLPP3.

[0067] The PLPP3 gene CDS region primers used in the present invention are:

[0068] Forward: 5'-GG GGTACC CCATGCTGATGGTCCTCCTTGTATC-3';

[0069] Reverse: 5'-GC TCTAGAG CCTACACCATGTTGTGGTGATTGTT-3'.

[0070] (3) Designed and commissioned Dongze Company to synthesize the small interfering fragment sequence of the PLPP3 gene:

[0071] si-PLPP3: 5′-CTGATGGGTCCTCCTTGTAT-3′.

[0072] (4) Observe the cell status. When the cell confluence reaches about 50%-70%, 1000 ng / mL of PLPP3 overexpression vector (OE-PLPP3) and overexpression control (OE-NC) and 100 nmol / L of PLPP3 interference fragment (si-PLPP3) and interference control (si-NC) are transfected into the cells, respectively. Subsequent experiments can be carried out after 24 h.

[0073] Example 3: qRT-PCR

[0074] The qRT-PCR detection of the genes in the present invention was performed using the YEASEN SYBR Green qPCR Master Mix (2X) kit. The experiment uses the comparative Ct value method to detect the content of sample genes. The specific calculation formula is as follows:

[0075] Relative gene expression level = 2-{〈﹙Ct value of target gene in experimental group﹚-﹙Ct value of internal reference gene in experimental group﹚〉-〈﹙Ct value of target gene in control group﹚-﹙Ct value of internal reference gene in control group﹚〉}

[0076] GAPDH was used as an internal reference for the detection gene. The qRT-PCR primers used in the present invention were:

[0077] qPLPP3 Forward: 5′-GGAGGAGCAGGAGGAGCCG-3′;

[0078] Reverse: 5′-AGTCCAAGGGGAAGAGAGC-3′;

[0079] qSOD1 Forward: 5′-CTCACTCTCAGGAGACCATTGC-3′;

[0080] Reverse: 5′-CCACAAGCCAAACGACTTCCAG-3′;

[0081] qCAT Forward: 5′-GTGCGGAGATTCAACACTGCCA-3′;

[0082] Reverse: 5′-CGGCAATGTTCTCACACAGACG-3′;

[0083] qSOD2 Forward: 5′-CTGGACAAACCTCAGCCCTAAC-3′;

[0084] Reverse: 5′-AGCCTTGGACACCAACAGATGCA-3′;

[0085] qCYP1B1 Forward: 5′-GCCACTATCACTGACATCTTCGG-3′;

[0086] Reverse: 5′-CACGACCTGATCCAATTCTGCC-3′;

[0087] qCYP2E1 Forward: 5′-GAGCACCATCAATCTCTGGACC-3′;

[0088] Reverse: 5′-CACGGTGATACCGTCCATTGTG-3′;

[0089] qGAPDH Forward: 5′-TCACCAGGGCTGCTTTTAACT-3′;

[0090] Reverse: 5′-CTTGACTGTGCCGTGGAACT-3′;

[0091] The total RNA of cells was extracted according to the instructions of the RNA fast 200-total RNA rapid extraction kit of Shanghai Feijie Company. The specific steps are as follows:

[0092] (1) Add 500 μl of RA2 solution to the granulosa cells digested with trypsin and mix thoroughly by inversion for 1 minute.

[0093] (2) Aspirate or pour the sample lysate into the inner tube and centrifuge for 1 minute.

[0094] (3) Discard the liquid in the outer cannula, add 500 μl of washing solution to the inner cannula, centrifuge for 1 minute, and repeat this washing process once more.

[0095] (4) Remove the inner cannula, discard the liquid in the outer cannula, put it back into the inner cannula without adding washing solution, and centrifuge for 1 minute.

[0096] (5) Move the inner cannula into a new eppendorf tube, add 25-50 μl of elution buffer (or DEPC-treated water with a pH greater than 7.0) to the center of the membrane, let it stand at room temperature for 1 min, and centrifuge for 1 min to obtain total RNA.

[0097] Using PrimeScript from TaKaRa TM Total RNA was reverse transcribed using the RT Master Mix (Perfect Real Time) cDNA Reverse Transcription Kit.

[0098] Example 4: Western Blot

[0099] (1) Total cell protein extraction

[0100] ① Prepare protein lysis buffer: Add 1% proteasome inhibitor to RIPA protein lysis buffer (White Shark Company) and mix thoroughly by inverting.

[0101] ② Add 120 μl of protein lysis buffer to each well (six-well plate), place on ice for 10-15 minutes, take out and shake gently in the middle to promote cell detachment.

[0102] ③ Collect the lysed blood cells, centrifuge at 12,000g, 4℃ for 10 min, carefully aspirate the supernatant, and remove the lower precipitate.

[0103] (2)SDS-PAGE:

[0104] ① Protein quantification (Biyuntian BCA protein quantification kit): A multifunctional microplate reader was used to measure A 562The OD value of each wavelength was used to draw a standard curve, and the concentration of each protein sample was calculated by the regression equation and the average OD value of each protein standard;

[0105] ②Sample preparation: Mix 20 μg of total protein with 5× loading buffer at a ratio of 5:1 and boil for 10 min;

[0106] ③ Preparation of gel sample: Add 20 μg protein to each well and run the gel at 120-150 V for about 40 minutes (stop electrophoresis when bromofen blue runs to about 1-2 cm from the bottom of the gel; or adjust the running voltage and time according to the specific situation);

[0107] ④ Cut the gel strip containing the target protein according to the molecular weight standard of the protein marker and select the transfer current of 300mA for 20min;

[0108] ⑤ After transfer, rinse the membrane gently with TBST for 5 minutes and block with 5% skim milk powder at room temperature for 2 hours;

[0109] ⑥ Gently rinse the membrane twice with TBST, 5 min each time, dilute the primary antibody PLPP3 (purchased from Beijing Biosun Company) with TBST according to the antibody instructions, and incubate at 4°C overnight;

[0110] ⑦ Gently rinse the membrane with TBST three times, 10 minutes each time, and incubate with the secondary antibody Goat anti-rabbit IgG (purchased from SAB) at a dilution of 1:10,000 at room temperature for 2 hours;

[0111] ⑧ Gently rinse the membrane with TBST three times, 10 min each time;

[0112] ⑨ The ultra-sensitive ECL chemiluminescence kit (Biyuntian, China) was used for color development, and the protein bands were observed and photographed using the Tianneng gel forming system (Tianneng, China). The protein bands in the film were analyzed using Image J software.

[0113] Example 5: RIP experiment

[0114] RIP assays were performed using the EZ-Magna RIP kit (Millipore, USA) according to the manufacturer's instructions. Pellets were collected from 6-well plates using trypsin and lysed with the lysis buffer provided in the kit. The cells were then divided into three groups: IP, IgG, and input. The IP group was immunoprecipitated overnight at 4°C using an anti-PLPP3 antibody, with homologous IgG used as a control. After washing and elution, the enriched RNA samples were analyzed by RT-qPCR. Specific primers for RT-qPCR are detailed in Example 3.

[0115] Example 6: Co-IP experiment

[0116] Co-IP experiments were performed using the EZ-Magna Co-IP Kit (Millipore, USA). Harvested cells were immunoprecipitated overnight at 4°C with antibodies against PLPP3 (Boaosen, China) or CAT (Affinity, USA), SOD1 (Affinity, USA), CYP1B1 (Affinity, USA), and CYP2E1 (Affinity, USA). Negative validation was performed using IgG as a control. Enriched proteins were detected by Western blotting.

[0117] Example 7: RNA nuclear-cytoplasmic separation experiment

[0118] Cytoplasmic and nuclear RNA extraction kits (Norgen Biotek, Canada) were used to extract and purify cytoplasmic and nuclear RNA. The specific steps are as follows:

[0119] ① Transfer the digested cells to an RNase-free tube and centrifuge for 10 minutes to collect the cell pellet. Add Lysis Buffer J to the pellet and vortex to fully lyse the cells.

[0120] ② Transfer the lysate to a new RNase-free microcentrifuge tube and centrifuge at maximum speed for 10 minutes. Transfer the supernatant containing the cytoplasmic RNA to another RNase-free tube. The precipitate is the nuclear RNA fraction.

[0121] ③ Extract and purify RNA. Add buffer to the supernatant containing cytoplasmic RNA and the pellet containing nuclear RNA, respectively. Vortex and mix for 10 seconds. Then add 96%-100% ethanol and vortex and mix for 10 seconds. Centrifuge for 1 minute, wash three times with Wash Solution A, and elute the purified RNA with Elution Buffer E.

[0122] ④ After the purified RNA is reverse transcribed into cDNA, the expression level of the target gene is detected by qRT-PCR.

[0123] Example 8: Protein nuclear-cytoplasmic separation experiment

[0124] NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, USA) were used to extract and purify cytoplasmic and nuclear proteins. The specific steps are as follows:

[0125] ① Add ice-cold Cytoplasmic Extraction Reagent I (CER I) to the collected cell pellet, vortex for 15 seconds to completely suspend the cell pellet, and incubate on ice for 10 minutes.

[0126] ② Add ice-cold Cytoplasmic Extraction Reagent (IICER II), vortex for 5 seconds, and incubate on ice for 1 minute. Vortex again and centrifuge to collect the supernatant, which is the cytoplasmic protein. Transfer it to a new centrifuge tube and store until further use. The cell pellet at the bottom is the nucleus.

[0127] ③ Add ice-cold nuclear extraction reagent NER to the nuclear pellet, vortex for 15 seconds every 10 minutes, vortex 4 times in total, and continue for 40 minutes.

[0128] ④ Centrifuge for 10 minutes, transfer the supernatant, i.e. nuclear protein, to a clean pre-cooled tube and store for later use.

[0129] ⑤ Add SDS to the extracted cytoplasm and cytoplasmic proteins for denaturation and use in subsequent WB experiments to detect the expression level of the target protein.

[0130] Example 9: Tissue Immunofluorescence

[0131] The specific steps are as follows:

[0132] ① Paraffin sections of human ovaries (obtained from the Gynecological Reproductive Medicine Center of the First Affiliated Hospital of Sun Yat-sen University, approved by the Medical Ethics Committee) were placed in dewaxing solution and anhydrous ethanol for 10-15 minutes respectively.

[0133] ② Place the washed ovarian slices in a retrieval box filled with citric acid antigen retrieval solution and perform antigen retrieval in a microwave oven.

[0134] ③ After cooling naturally, wash the slides three times with PBS on a decolorizing shaker for 5 minutes each. Use a histochemical pen to draw a circle around the tissue to prevent liquid loss.

[0135] ④ After sealing the slides with 3%-5% BSA for 30 minutes, incubate with the primary antibody at 4°C overnight and the secondary antibody at 37°C for 3 hours.

[0136] ⑤ Add DAPI dye solution and incubate at room temperature for 5 minutes in a dark environment to locate the target protein. Then seal the section with a resin sealant and observe and collect images of the section under a fluorescence microscope.

[0137] Example 10: Cell proliferation detection

[0138] The present invention uses EdU kit (Ruibo, China) to detect granulosa cell proliferation, referring to the Cell-Light TM EdU Apollo 567 In vitro Kit instructions. The specific steps are as follows:

[0139] (1) Cells were seeded into 48-well plates and cultured until the confluence reached 50-80%.

[0140] (2) Prepare 50 μM EdU culture medium by diluting the EdU solution 1000:1 with cell culture medium. Add 200 μL of 50 μM EdU culture medium to each well and incubate for 2 h. Wash the cells with PBS for 3–5 min each time.

[0141] (3) Cell fixation: Add 200 μL of cell fixative (80% acetone diluted with PBS) to each well and incubate at room temperature for 15–30 min. Wash the cells with PBS for 3–5 min each time.

[0142] (4) Cell permeabilization: 200 μL of permeabilization agent (0.5% Triton X-100 in PBS) was added to each well to permeabilize the cells. The cells were incubated for 10 min and then washed with PBS.

[0143] (5) EdU detection: Add 200 μL of 1× The staining reaction solution (prepared in a dark place) was incubated in the cell culture in the dark for 30 min, and the cells were washed with PBS;

[0144] (6) Cell permeabilization again: add 200 μL of permeabilization agent (0.5% TritonX-100 in PBS) to each well to permeabilize the cells, incubate for 10 min, and then wash the cells with PBS;

[0145] (7) DNA staining: Add 200 μL of DAPI reaction solution to each well and incubate at room temperature for 30 min in the dark;

[0146] (8) Fluorescence microscopy (three replicates per group).

[0147] Example 11: Granulocyte activity detection

[0148] The present invention uses CCK-8 detection kit (Biyuntian, China) to detect cell activity. The specific operation steps are as follows:

[0149] (1) Cells were seeded in 96-well plates. When the cell confluence reached 50-70%, PLPP3 overexpression vectors and interference fragments were transfected using lip3000 reagent (Thermo Fisher Scientific, USA) and cultured for 24 h.

[0150] (2) Add 10 μL of CCK-8 solution (culture medium: CCK8 solution = 10:1) to each well, place in a cell culture incubator and incubate for 1 h, and measure the OD value using an A450 microplate reader.

[0151] Example 12: Granulocyte apoptosis detection

[0152] The present invention uses Annexin V-FITC technology to detect cell apoptosis. Referring to the instructions of the Annexin V-FITC Apoptosis Detection Kit of BioVision, the specific operation steps are as follows:

[0153] (1) Cells were seeded in 6-well plates and cultured until the confluence reached 50%–70%. PLPP3 overexpression plasmids and interference fragments were transfected using the lip3000 reagent (Thermo Fisher Scientific, USA) and cultured for 24 h.

[0154] (2) Digest the cells with EDTA-free trypsin and wash the cells with 2 mL of PBS solution;

[0155] (3) Take 0.5 mL of cell suspension (about 5×10 5 cells), add 500 μL 1× Binding Buffer;

[0156] (4) Add 5 μL Annexin V-FITC and 5 μL Propidium Iodide at room temperature and incubate at room temperature in the dark for 5 min;

[0157] (5) Immediately analyze the cells using flow cytometry (3 replicates per group).

[0158] result:

[0159] 1. PLPP3 significantly increased the level of oxidative stress in granulosa cells

[0160] The PLPP3 overexpression plasmid pcDNA3.1-PLPP3 (OE-PLPP3) and the PLPP3 interference fragment si-PLPP3 (Dongze Pharmaceuticals, sequence CTGATGGTCCTCCTTGTAT) were constructed. A ROS detection kit (Bio Vision, USA) was used to examine the effect of PLPP3 on ROS levels in human ovarian granulosa cells. qRT-PCR and Western blot were used to examine the effects of PLPP3 on the mRNA and protein levels of marker genes in the oxidative stress signaling pathway.

[0161] qRT-PCR and Western Blot results showed that the optimal transfection concentrations of overexpression plasmid pcDNA3.1-PLPP3 (OE-PLPP3) and interference fragment si-PLPP3 were 1000 ng ( Figure 1 a, b) and 100 nM ( Figure 1 c, d);

[0162] The results of ROS detection showed that OE-PLPP3 significantly increased the ROS level in granulosa cells ( Figure 1 e), while si-PLPP3 significantly reduced the ROS level in granulosa cells ( Figure 1 e) in the.

[0163] qRT-PCR results showed that OE-PLPP3 significantly reduced the mRNA levels of antioxidant genes SOD1 and SOD1 in the oxidative stress signaling pathway, but increased the mRNA levels of CAT and pro-oxidative genes CYP2E1, AHR, and CYP1B1 ( Figure 1 f). si-PLPP3 significantly increased the mRNA levels of antioxidant genes SOD1, SOD1, and CAT in the oxidative stress signaling pathway, and decreased the mRNA levels of pro-oxidative genes CYP2E1, AHR, and CYP1B1 ( Figure 1 f) in the above example.

[0164] Western Blot results showed that OE-PLPP3 significantly reduced the protein levels of endogenous antioxidant enzymes SOD1, SOD2 and CAT ( Figure 1 g); while si-PLPP3 significantly increased the protein levels of SOD1, SOD2 and CAT ( Figure 1 g) in the .

[0165] 2. PLPP3 protein interacts with SOD1 gene at the mRNA and protein levels

[0166] RIP, Co-IP and nucleocytoplasmic separation experiments were used to detect the interaction between the PLPP3 gene and oxidative stress pathway marker genes at the mRNA and protein levels.

[0167] The results of RIP and Co-IP showed that compared with other marker genes of oxidative stress signaling pathway, anti-PLPP3 antibody significantly enriched a large amount of SOD1 mRNA ( Figure 2 a) and SOD1 protein ( Figure 2 b), and anti-SOD1 antibody significantly enriched a large amount of PLPP3 protein ( Figure 2 c) in the

[0168] The CDS region of the SOD1 gene was truncated, and the RIP results further showed that the anti-PLPP3 antibody was significantly enriched in exon 2, exon 3, exon 5 and 3'UTR region of the SOD1 CDS region ( Figure 2 d) in the above.

[0169] The results of nuclear-cytoplasmic separation experiments showed that in granulosa cells, PLPP3 interacted with the SOD1 gene in both the cytoplasm and the nucleus and exhibited a negative regulatory relationship. OE-PLPP3 mainly inhibited the transcription of SOD1 in the nucleus ( Figure 2 e), inhibiting the translation of SOD1 in the cytoplasm ( Figure 2 f) in the above example.

[0170] 3. SOD1 protein binds to the acidPPc domain of PLPP3

[0171] By truncation of GFP-PLPP3 fusion protein ( Figure 3 a) and Co-IP experiments verified the specific region of interaction between PLPP3 and SOD1 proteins.

[0172] Cell immunofluorescence ( Figure 3 b) and WB experiment ( Figure 3 Panel c) shows that the GFP-PLPP3 fusion protein is normally expressed in granulosa cells.

[0173] Co-IP experiments showed that SOD1 protein specifically binds to the acid-PPc domain of PLPP3 protein ( Figure 3 d) in the above.

[0174] 4. PLPP3 interacts with SOD1 protein in human ovarian tissue

[0175] Co-IP and tissue immunofluorescence techniques were used to detect the localization and interaction of PLPP3 protein and SOD1 protein in ovarian tissues of middle-aged and elderly people.

[0176] Co-IP experiments showed that anti-PLPP3 antibodies significantly enriched a large amount of SOD1 protein in human ovarian granulosa cells ( Figure 4 a) in the

[0177] Tissue immunofluorescence experiments showed that PLPP3 protein and SOD1 protein were co-localized in human ovarian tissue, and in the ovarian tissue of middle-aged people (about 40 years old), the expression level of PLPP3 protein was low, but the expression level of SOD1 protein was high ( Figure 4 b); In the ovarian tissue of the elderly (about 60 years old), the expression of PLPP3 protein is high, but the expression of SOD1 protein is low ( Figure 4 c) in the above example.

[0178] 5. PLPP3 gene significantly inhibited granulosa cell proliferation and cell viability

[0179] The effects of PLPP3 on the proliferation rate and cell viability of granulosa cells were detected using EdU (5-Ethynyl-2'-deoxyuridine) kit (Ribo, China) and CCK8 kit (Biyuntian, China), respectively. The effects of PLPP3 on the mRNA and protein levels of marker genes of cell proliferation signaling pathways were detected by qRT-PCR and Western Blot experiments.

[0180] The results of EdU experiments showed that OE-PLPP3 significantly reduced the proliferation rate of granulosa cells ( Figure 5 a, b), while si-PLPP3 significantly increased the proliferation rate of granulosa cells ( Figure 5 a, b) in the above.

[0181] The results of CCK8 experiments showed that OE-PLPP3 significantly reduced the viability of granulosa cells ( Figure 5 c), while si-PLPP3 significantly increased the viability of granulosa cells ( Figure 5 d) in the above.

[0182] qRT-PCR results showed that OE-PLPP3 significantly reduced the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA, and p65 in granulosa cells, while si-PLPP3 significantly increased the mRNA levels of proliferation signaling pathway marker genes CDK4, SP1, PCNA, IKBA, and p65 ( Figure 5 c); Western Blot results showed that OE-PLPP3 significantly reduced the protein levels of CDK4 and PCNA, but had no significant effect on the protein expression of p65; si-PLPP3 significantly increased the protein levels of CDK4, PCNA and p65 ( Figure 5 d) in the above.

[0183] 6. PLPP3 gene significantly increased the apoptosis level of ovarian granulosa cells

[0184] Annexin V / PI was used to detect the effect of PLPP3 on the apoptosis rate of granulosa cells; qRT-PCR and Western Blot experiments were used to detect the effect of PLPP3 on the mRNA and protein levels of marker genes of the cell apoptosis signaling pathway.

[0185] Annexin V / PI experimental results showed that OE-PLPP3 significantly increased the apoptosis rate of granulosa cells ( Figure 6 a), while si-PLPP3 significantly reduced the apoptosis rate of granulosa cells ( Figure 6 b) in the above example.

[0186] qRT-PCR results showed that OE-PLPP3 significantly increased the mRNA levels of apoptosis signaling pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX, and BIM, and decreased the mRNA levels of MCL1 and CREB1 ( Figure 6 c), while si-PLPP3 significantly reduced the mRNA levels of apoptosis signaling pathway marker genes CASP3, CASP8, CASP9, BID, p53, PLCY1, BAX and BIM, and increased the mRNA levels of MCL1 and CREB1 ( Figure 6 c); OE-PLPP3 significantly increased the expression of pro-apoptotic marker proteins BIM, BAX, and CASP9, and decreased the expression of anti-apoptotic marker protein MCL1 ( Figure 6 d), while si-PLPP3 significantly reduced the expression of pro-apoptotic marker proteins BIM, BAX and CASP9, and increased the expression of anti-apoptotic key protein MCL1 ( Figure 6 d) in the above.

[0187] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. PLPP3 The application of the invention in regulating oxidative stress in human ovarian granulosa cells is characterized by: The application is any one or more of the following applications: I. Overexpression of exogenous PLPP3 The application of genes to promote oxidative stress in ovarian granulosa cells in vitro; II. Inhibition PLPP3 The application of gene expression to inhibit oxidative stress in ovarian granulosa cells in vitro; The overexpression of exogenous PLPP3 Genes were expressed through gene overexpression technology; The inhibition PLPP3 Gene expression was achieved through RNA interference technology.

2. PLPP3 The application of regulating cellular oxidative stress in human ovarian granulosa cells is characterized by: The application is any one or more of the following applications: III. Overexpression of exogenous PLPP3 Gene, the oxidative stress level of ovarian granulosa cells increases, inhibiting the proliferation of ovarian granulosa cells; IV. In vitro inhibition PLPP3 Gene expression, decreased oxidative stress levels in ovarian granulosa cells, and promoted ovarian granulosa cell proliferation; V. Overexpression of exogenous PLPP3 Gene, the oxidative stress level of ovarian granulosa cells increases, promoting ovarian granulosa cell apoptosis; VI. In vitro inhibition PLPP3 Gene expression, decreased oxidative stress levels in ovarian granulosa cells, and inhibition of ovarian granulosa cell apoptosis; The overexpression of exogenous PLPP3 Genes were expressed through gene overexpression technology; The inhibition PLPP3 Gene expression was achieved through RNA interference technology.

3. The use according to claim 1 or 2, characterized in that: The gene overexpression plasmid used in the gene overexpression technology is prepared by the following method: (1) Extract cDNA from ovarian granulosa cells and perform PCR amplification using cDNA as a template to obtain the target fragment; (2) The target fragment was ligated to the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpnl to obtain a recombinant plasmid; The primers used for PCR amplification in step (1) are as follows: Forward:5′- GG GGTACC CCATGCTGATGGTCCTCCTTGTATC -3′; Reverse:5′- GC TCTAGAG CCTACACCATGTTGTGGTGATTGTT -3′。 4. The use according to claim 1 or 2, characterized in that: The small interfering fragment sequence used in the RNA interference technology is as follows: si-PLPP3: 5′-CTGATGGGTCCTCCTTGTAT-3′.

5. Inhibition PLPP3 The use of a gene expression reagent in the preparation of a drug for promoting follicle development is characterized by: The inhibition PLPP3 The reagent for gene expression is a small interfering fragment with the following sequence: si-PLPP3: 5′-CTGATGGGTCCTCCTTGTAT-3′.

Images