A lung cancer combination therapy composition
By combining C1GALT1 inhibitors with Tn antigen-associated immunotherapy agents, the problems of EGFR TKI resistance and ICI combination therapy side effects have been solved, achieving highly effective treatment for EGFR-mutant NSCLC, significantly reducing tumor volume, and improving clinical prognosis.
Patent Information
- Application Number
- CN202310931358.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-26
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2043-07-26
AI Technical Summary
Existing treatments for non-small cell lung cancer (NSCLC) include resistance to EGFR TKIs, side effects and poor efficacy of combined ICI and EGFR TKI therapy, and issues with insufficient lymphocyte infiltration, low tumor mutation burden, and weak immunogenicity in EGFR-mutant NSCLC.
Combining C1GALT1 inhibitors such as EGFR-TKIs (e.g., gefitinib, erlotinib) with Tn antigen-related immunotherapies (e.g., Tn CAR-T cells, Tn antigen vaccines, or monoclonal antibodies targeting Tn antigens) can enhance the efficacy of immunotherapy by inhibiting C1GALT1 expression and glycosylation processes, thereby promoting Tn antigen expression.
It significantly improves the therapeutic efficacy of lung cancer, synergistically reduces tumor volume, improves the clinical prognosis of EGFR-mutant lung cancer, and provides a new treatment option for lung cancer.
Smart Images

Figure CN116808225B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and more specifically, to a combination therapy composition for lung cancer. Background Technology
[0002] Significant progress has been made in the treatment of non-small cell lung cancer (NSCLC) in recent years. For patients with NSCLC harboring epidermal growth factor receptor (EGFR) mutations, EGFR TKIs are currently the first-line treatment. However, data from clinical trials such as ENSURE III showed that erlotinib monotherapy had an objective response rate of 62.7%, meaning that nearly half of EGFR-mutant patients are resistant to EGFR TKI treatment. Patients carrying p53 gene mutations or MET amplification are particularly ineffective against EGFR TKIs. Currently, numerous clinical trials are exploring ways to overcome the limitations of EGFR TKIs in NSCLC.
[0003] In immunotherapy, immune checkpoint inhibitors (ICIs) have become an emerging treatment strategy for NSCLC. Early literature reported that EGFR TKIs may have a promoting effect on the tumor immune microenvironment, thus proposing a strategy of combining ICIs with EGFR TKIs. However, unfortunately, the efficacy of combined ICI and EGFR TKI therapy is unsatisfactory, increasing the side effects of immunotherapy and potentially leading to hyperprogression. Studies of the tumor microenvironment have found that EGFR-mutant NSCLC has insufficient lymphocyte infiltration, low tumor mutational burden, and weak immunogenicity, suggesting that these are the main reasons for ICI treatment failure. However, the immunosuppressive characteristics of EGFR-mutant NSCLC itself suggest that this type of tumor has the potential to benefit from immunotherapy strategies. Immunotherapy, which differs significantly from ICI therapy in principle, includes adoptive cell immunotherapy, tumor vaccines, and monoclonal antibodies that can induce ADCC effects; EGFR-mutant NSCLC may benefit from these immunotherapies.
[0004] Mucin 1 (MUC1) is a highly glycosylated transmembrane protein. In tumor cells, the glycosylation level of MUC1 is abnormally reduced, resulting in various tumor-specific low-glycosylated MUC1 glycopeptide antigens. Among these, Tn antigen is considered the most promising tumor-specific antigen (TSA) for diagnosis and treatment. Since NSCLC cells exhibit relatively stable MUC1 transcriptional expression, Tn antigen-related immunotherapy shows high potential for application in NSCLC. However, taking TnCAR-T cell therapy as an example, several early clinical trials of MUC1 CAR-T have shown unsatisfactory results. Further research indicates that glycosylated MUC1 expression is more prevalent in adenocarcinoma tissues, while Tn antigen expression varies significantly between individuals and within the tumor itself. This reveals the main reason for the limited efficacy of Tn CAR-T cell monotherapy in NSCLC.
[0005] It is noteworthy that EGFR and MUC1 interact to jointly drive tumorigenesis and development. Previous studies have shown that EGFR TKI treatment increases tumor mutational burden, reduces Treg infiltration, and increases the proportion of PDL1+CD8+ T cells, suggesting that the tumor is more "inflammatory," which provides favorable conditions for immunotherapy. Exploring the anti-tumor effects of combining EGFR-related targeted therapies with Tn immunotherapy in lung cancer, and providing a new treatment strategy, product, or method to overcome the shortcomings of existing technologies, is therefore crucial. Summary of the Invention
[0006] The present invention aims to overcome at least one of the shortcomings of the prior art and provide a combination therapy composition for lung cancer, providing a new treatment product and direction for lung cancer treatment.
[0007] One object of the present invention is to provide a combination therapy composition for lung cancer, comprising a C1GALT1 inhibitor and a Tn antigen-related immunotherapeutic agent. In one or more embodiments of the present invention, the inventors have discovered that EGFR-TKI targeted drugs upregulate Tn antigen expression in lung cancer tumor cells by inhibiting C1GALT1 expression, thereby blocking the subsequent glycosylation process of Tn antigen. Furthermore, direct use of the C1GALT1 inhibitor can achieve the same effect. The upregulation of Tn antigen significantly enhances the efficacy of Tn antigen-related immunotherapeutic agents, for example, by promoting the killing effect of Tn CAR-T cells on lung cancer tumor cells. Thus, through the synergistic effect of inhibiting C1GALT1 and the immunotherapeutic agent, the therapeutic efficacy for lung cancer is significantly improved, providing a new treatment option for improving the clinical prognosis of EGFR-mutant lung cancer.
[0008] Furthermore, the C1GALT1 inhibitor includes EGFR-TKIs. In one or more embodiments of the present invention, the inventors discovered that EGFR-TKI-targeting drugs inhibit C1GALT1 expression through the PI3K / AKT / SP1 pathway.
[0009] Furthermore, the EGFR-TKI is one of gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, or ametinib.
[0010] Furthermore, the C1GALT1 inhibitor also includes a combination of itraconazole and erlotinib. In one or more embodiments of the present invention, the inventors found in in vivo and in vitro experimental samples that erlotinib mainly upregulated low-glycosylated MUC1, while the change in fully glycosylated MUC1 was not significant, suggesting that erlotinib has a significant regulatory effect on the glycosylation process of MUC1, thereby increasing the expression of Tn tumor antigens on the cell membrane. Further molecular mechanism studies revealed that erlotinib mainly induces the upregulation of Tn antigen expression on the cell membrane by downregulating the key glycosyltransferase C1GALT1 in the Tn antigen formation process through the PI3K / AKT / SP1 pathway downstream of EGFR. Itraconazole, a specific inhibitor of C1GALT1, can also directly upregulate the expression of Tn antigens, and can produce synergistic effects with erlotinib and erlotinib combined with Tn CAR-T.
[0011] Furthermore, the C1GALT1 inhibitor inhibits the expression of C1GALT1 through the PI3K / AKT / SP1 pathway, or directly promotes the degradation of C1GALT1 protein to downregulate its expression.
[0012] In this technical solution, when the C1GALT1 inhibitor is EGFR-TKI, it inhibits the expression of C1GALT1 through the PI3K / AKT / SP1 pathway; when the C1GALT1 inhibitor is itraconazole and EGFR-TKI, itraconazole directly promotes the degradation of C1GALT1 protein and downregulates its expression.
[0013] Furthermore, the Tn antigen-related immunotherapeutic agent is one of Tn CAR-T cells, a Tn antigen vaccine, or a monoclonal antibody targeting the Tn antigen.
[0014] Furthermore, the EGFR-TKI is formulated for oral administration.
[0015] Furthermore, when the Tn antigen-related immunotherapy agent is Tn CAR-T cells, the immunotherapy agent is formulated for injection. Specifically, the injection is intravenous. In one or more embodiments of the present invention, the inventors selected erlotinib as an example of EGFR TKI and Tn CAR-T cells as an example of Tn antigen-related immunotherapy, using PC9 cells as a cell model of EGFR mutant NSCLC, to explore the synergistic effect of the two in in vivo experiments. A cell-derived xenograft model was constructed by subcutaneously injecting PC9 cells into NOD-SCID mice, erlotinib was administered by gavage, and Tn CAR-T cells or control T cells were infused via the tail vein. The results showed that in mice treated with a combination of erlotinib and Tn CAR-T cells, tumors were reduced by more than 75%, while in mice treated with erlotinib or Tn CAR-T cells alone, tumors were reduced by less than 50%, suggesting that EGFR TKI and Tn CAR-T cells produce a synergistic anti-tumor effect.
[0016] Furthermore, the aforementioned lung cancer is non-small cell lung cancer.
[0017] Another object of the present invention is to provide the use of C1GALT1 inhibitors and Tn antigen-associated immunotherapeutic agents in the preparation of lung cancer therapeutic compositions.
[0018] In exploring the relevant mechanisms, we discovered that EGFR TKIs inhibit C1GALT1 expression through the PI3K / AKT pathway, regulate the glycosylation process of MUC1, and promote Tn antigen expression, thereby synergizing with Tn CAR-T cell immunotherapy or other Tn antigen-related immunotherapies. We revealed the core regulatory role of C1GALT1 in Tn antigen expression. Through further exploration, we found that direct use of C1GALT1 inhibitors can synergize with Tn CAR-T cell immunotherapy by upregulating Tn antigen expression, and that C1GALT1 inhibitors such as itraconazole can further enhance the therapeutic effect of EGFR TKIs combined with Tn immunotherapy. Compared with existing technologies, the beneficial effects of this invention are:
[0019] (1) By inhibiting the synergistic effect of C1GALT1 and Tn-related immunotherapeutic agents, the therapeutic efficacy of lung cancer has been significantly improved, providing a new treatment option for improving the clinical prognosis of EGFR-mutant lung cancer and providing a new research direction for lung cancer treatment.
[0020] (2) It was revealed that EGFR TKI targeted drugs inhibit C1GALT1 expression through the PI3K / AKT / SP1 pathway, block the subsequent glycosylation process of Tn antigen, and upregulate the expression of Tn antigen in tumor cells, suggesting that their combined use with immunotherapy agents can improve the efficacy of anti-lung cancer treatment.
[0021] (3) It was revealed that the combined use of EGFR TKI, itraconazole and immunotherapy agents has a synergistic effect, thereby significantly reducing the tumor volume of lung cancer, which is expected to be used in clinical practice.
[0022] Attached image:
[0023] Figure 1 The results show that erlotinib and MUC1 CAR-T cells exhibit a synergistic antitumor effect. (A-B) Correlation between MUC1 and EGFR expression levels in EGFR-mutant non-small cell lung cancer (NSCLC). (C) Effect of knockdown of MUC1 and erlotinib on PC9 cells. (D) Subcutaneous tumorigenesis of PC9 cells in NOD-SCID mice. On day 7 after tumorigenesis, mice were administered erlotinib or placebo by gavage (50 mg / kg, every other day for 10 days), and PBMC or Tn CAR-T cells were infused once via tail vein. The growth of subcutaneous tumors was observed. The mean ± standard deviation of tumor tissue volume for each group of 7 mice was used in the animal experiments. (E) Tumor tissue was dissected 10 days after CAR-T cell infusion. (F) Tumor weight was the mean ± standard deviation for each group of 7 mice. (G) No significant increase in the proportion of tumor cell death was observed when PC9 cells and HCC827 cells were treated with erlotinib. (H) The cytotoxic effect of PBMCs or Tn CAR-T cells on tumor cells under erlotinib treatment was detected. We constructed a co-culture model of tumor cells and immune cells (PBMCs or Tn CAR-T cells): tumor cells were pretreated with 5 μM erlotinib, labeled with calcein, and then co-cultured with PBMCs or Tn CAR-T cells at an effector-to-target ratio of 5:1. After 24 hours, the cells were harvested, PI staining was performed, and the proportion of tumor cell death was detected. (I-J) Statistical results of tumor cell lysis rate. (K-L) IFN-γ release from each group of PBMCs or Tn CAR-T cells.
[0024] Figure 2Displays: (A) Immunological score results after erlotinib treatment. (B) Effect of erlotinib treatment on the MUC1 O-glycosylation pathway. (C) Effect of erlotinib treatment on most MUC1 O-glycosyltransferases. (D-E) Results of IHC analysis of tumor specimens from animal experiments. (F-G) Changes in gMUC1 and hMUC1 before and after erlotinib treatment detected by flow cytometry. (H) Immunofluorescence staining analysis results of HCC827 cells; (I) Statistical results of immunofluorescence staining analysis of hMUC1 expression in HCC827 cells; (J) Immunofluorescence staining analysis results of PC9 cells; (K) Statistical results of immunofluorescence staining analysis of hMUC1 expression in HCC827 cells.
[0025] Figure 3 The results show that erlotinib primarily regulates MUC1 glycosylation by inhibiting C1GALT1 expression. (A) The formation process of Tn antigen. (B) Changes in the expression of Tn antigen-related glycosyltransferases after erlotinib treatment. (C) Representative immunoblot image of C1GALT1 in PC9 cells after erlotinib treatment. (D) Analysis of the activity of MAPK and PI3K signaling pathways in PC9 cells (EGFR mutant) and A549 cells (EGFR wild type) by immunoblotting. (E) Glycosyltransferase expression profiles after treatment with MAPK and PI3K signaling pathway inhibitors. (F) Assessment of low-glycosylated MUC1 expression using flow cytometry. (G) Experimental statistics on the assessment of low-glycosylated MUC1 expression using flow cytometry.
[0026] Figure 4 The results show that erlotinib inhibits C1GALT1 transcription by blocking the PI3K / AKT / SP1 pathway. (A) qRT-PCR analysis of C1GALT1 expression in PC9 cells after SP1 knockdown. (B) Western blotting analysis of C1GALT1 and SP1 expression in PC9 cells after SP1 knockdown. (C) PC9 cells were transfected with control vector or SP1 plasmid and treated with erlotinib, PI3K inhibitor, and AKT inhibitor, respectively. qRT-PCR analysis of C1GALT1 expression was then performed. (D) Western blotting analysis of protein expression levels of C1GALT1 and SP1 in PC9 cells. (E) Luciferase reporter gene assay analysis of C1GALT1 gene transcriptional activity after SP1 knockdown. (F) Erlotinib treatment reduced C1GALT1 gene transcriptional activity, but this could be reversed by SP1 overexpression. (G) ChIP-PCR showed that the DNA fragment of the C1GALT1 promoter could be enriched by SP1 immunoprecipitation. Erlotinib, PI3K inhibitors, and AKT inhibitors reduced the binding affinity of SP1 to the C1GALT1 promoter. (H)Co-IP showed that erlotinib reduced the binding affinity of SP1 to p-AKT.
[0027] Figure 5 The results show that itraconazole regulates the glycosylation of MUC1 by inhibiting C1GALT1. (A) Representative image of C1GALT1 in PC9 cells after itraconazole treatment. (B) qRT-PCR analysis results of MUC1 and C1GALT1 in PC9 cells after itraconazole treatment. (C) qRT-PCR analysis results of MUC1 and C1GALT1 in A549 cells after itraconazole treatment. (D-E) Results of hMUC1 expression level before and after itraconazole treatment detected by FCM. (FG) Results of gMUC1 expression level before and after itraconazole treatment detected by FCM. (HI) The results of the tumor cell and PBMC co-culture system, and the tumor cell killing ability of PBMC under the treatment of erlotinib and itraconazole respectively and the combined treatment of erlotinib and itraconazole. (JK) A co-culture system of tumor cells and Tn CAR-T was constructed. The results of tumor cell lysis ratio under the combined action of erlotinib and Tn CAR-T are shown in the figure. The results of tumor cell lysis ratio under the combined action of erlotinib, itraconazole and Tn CAR-T are also shown in the figure. (L) Schematic diagram of the process by which erlotinib and itraconazole increase Tn antigen expression. Detailed Implementation
[0028] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0029] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0030] The present invention will now be further illustrated with specific examples. The following embodiments are only for explaining the present invention and do not constitute a limitation thereof. The test samples and test procedures used in the following embodiments include the following (if the specific experimental conditions are not specified in the embodiments, they are usually performed according to conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following embodiments can be obtained commercially unless otherwise specified).
[0031] Example 1
[0032] I. Experimental Materials and Methods:
[0033] (1) Cells and Cell Culture: PC9, HCC827, and A549 cells were obtained from the American Type Culture Collection (ATCC) and cultured in DMEM medium containing 10% FBS using standard methods. CAR-T cells and control T cells were provided by Guangzhou Anjie Biomedical Technology. MUC1 CAR-T cells were cultured in KBM581 medium (88-581-CM, Corning, USA).
[0034] (2) CAR-T cell construction: 293T cells were transfected with the pTRPE-5E5 scFv-41BB-CD3z plasmid carrying gag / pol, env, and vsvg elements (refer to Posey et al., 2016, Immunity 44, 1444-1454). Viral fluid was collected at 24 and 48 hours. After infecting PBMC cells with the viral fluid, their proliferation was stimulated by IL-2, and they were cultured in RPMI-1640 containing 10% fetal bovine serum for 1 week.
[0035] (3) Flow cytometry (FCM): PC9, HCC827, or A549 cells were digested into single cells and suspended in PBS. Following the manufacturer's instructions, the cells were co-incubated with flow cytometry antibodies (concentration 1:100 to 1:200) for 30 minutes. After washing the cells with PBS, they were resuspended in 300 μL of PBS for flow cytometry analysis. For hypoglycosylated MUC1 cells, SM3 antibody (ab22711, Abcam, USA) was used for detection. For glycosylated MUC1 cells, 16A antibody (355604, Biolegend, USA) was used for detection.
[0036] (4) Immunoblotting: Cells were lysed in cell lysis buffer (P0013B, Beyotime, China) containing protease and phosphatase inhibitors (78440, Life Technologies, USA). Protein samples were transferred to PVDF membranes (1620177, Bio-Rad, USA) after 8% SDS-PAGE electrophoresis. The PVDF membranes were then blocked in 5% skim milk for 1 hour. The PVDF membranes were co-incubated with antibodies (concentrations of 1:500 to 1:1000) according to the manufacturer's instructions. Protein-antibody complexes were detected by HRP-conjugated secondary antibody and enhanced chemiluminescence (32106, Thermo Fisher, USA). Bands were visualized using a ChemiDoc MP imaging system (Bio-Rad, USA).
[0037] (5) Immunohistochemistry (IHC): Performed according to standard procedures. After dewaxing and dehydration, slides were treated with hydrogen peroxide (3%) to eliminate endogenous peroxidase. The slides were then incubated overnight at 4°C with primary antibodies against CD8α (ab217344, Abcam) and MUC1 (MA1-06503, Invitrogen, for detecting glycosylated MUC1; ab245695, Abcam, for detecting hypoglycosylated MUC1). Secondary immunohistochemical antibody (SAP-9100, ZSGB-Bio, China) was incubated at room temperature for 1 hour. The signal was detected using a diaminophenylamine (DAB) detection kit (ZLI-9018, ZSGB-Bio). Immunohistochemical staining results were observed using an Olympus BX51 microscope (Olympus, Tokyo, Japan). Staining scores were calculated using a 40x objective lens based on the proportion of positively stained areas in 10 random fields of view. The percentage of positive staining for tumor cells on the slide was scored as follows: 0, no positive staining area; 1, <25% staining area; 2, 25%-50% staining area; 3, >50% staining area. The staining score shown is the sum of the scores from three random fields.
[0038] (6) Killing assay: Tumor cells were treated with 5 μM erlotinib for 8 hours, stained with Calcein-AM (Invitrogen, C3011MP), washed thoroughly, and 2 × 10⁻⁶ cells were collected. 4 One tumor cell and 10×10 4 One T cell, or Tn CAR-T cell, or PBMC cell was co-cultured in a 24-well plate overnight. All cells in the co-culture system were collected the next day, and flow cytometry was used to detect Calcein-AM positive and PI positive tumor cells after PI staining.
[0039] (7) Enzyme-linked immunosorbent assay (ELISA): Using the Human IFN-gamma (Biolegend, 30101) kit, take the supernatant of the above-mentioned tumor cell and T cell or CAR-T cell co-culture system and perform ELISA according to the kit instructions.
[0040] (8) Animal experiments: 6×10 6 PC9 cells were resuspended in 100 mL of sterile PBS and subcutaneously injected into the back of NOD-SCID mice. Once the subcutaneous tumor was palpable, mice were orally administered 50 mg / kg erlotinib or placebo every two days until the end of the experiment. On the second day after tumor formation, 2 × 10⁻⁶ cells were injected into the back of NOD-SCID mice. 7One Tn CAR-T cell or control PBMC cell was injected via the tail vein. The formula V (mm³) was used: V = 0.5 × (length × width). 2 The tumor volume was calculated. Three weeks after Tn CAR-T cell injection, the tumor tissue was dissected, weighed, and fixed with formalin.
[0041] (9) siRNA knockdown experiment: siRNA transfection was performed using Lipofectamine 3000 (L3000001, Invitrogen, USA). The control siRNA sequence is as follows: 5'-UAAGGCUAUGAAGAGAUAC-3'. The siRNA sequences used for SP1 and MUC1 gene knockout are as follows:
[0042] hs-SP1-si-1 5'-GGCUCGAAGUAGCAGCACA-3'
[0043] hs-SP1-si-2 5'-GCAAGUUCUGACAGGACUA-3'
[0044] hs-MUC1-si-1 5'-AAGGTACCATCAATGTCCACG-3'
[0045] hs-MUC1-si-2 5'-AAGTTCAGTGCCCAGCTCTAC-3'.
[0046] (10) Immunofluorescence (IF): Cells were gently washed twice with cold PBS and then fixed for 40 minutes at room temperature with 4% formaldehyde solution (pH 7.4). Next, the fixed cells were perforated on ice with 0.1% Triton X-100 solution for 10 minutes, and then incubated overnight at 4°C with a primary antibody against MUC1 (4053S, CST, USA). Cells were then stained with a secondary antibody conjugated to Alexa Fluor 488 (Z25002, Invitrogen, USA). Cells were subsequently stained with 4',6-diamino-2-phenylindole (DAPI) (D9542-1MG, Sigma, USA). Images were acquired using a laser confocal microscope (Microscopes and Imaging Systems, Leica, Germany).
[0047] (11) Luciferase reporter gene assay: PC9 cells were used at a density of 4 × 10⁻⁶ cells per well. 5Cells were seeded at a density of 1000 g / well in 12-well plates. Using Lipofectamine 3000, 0.8 μg of the pGL4.10 vector carrying the C1GALT1 promoter or the pGL4.10 control plasmid was mixed with 0.8 μg of pcDNA3.1-SP1 or the control plasmid and co-transfected into cells. Forty-eight hours after transfection, cells were lysed and the lysates were collected. The activities of firefly and Renal luciferase were measured using a Dual-Luciferase Reporter Assay System (E1910, Promega, USA). Relative firefly luciferase activity was measured, with Renal luciferase activity used as a transfection control.
[0048] (12) Co-Immunoprecipitation (CoIP): DYKDDDDK-labeled SP1 plasmid was transiently transfected into PC9 cells. 5 μM erlotinib was added to DMEM medium, and incubation continued for 12 hours. Cell lysis buffer, protein A / G magnetic beads (Life Technologies), and antibody were co-incubated at 4°C overnight by rotation, followed by elution in SDS buffer. The eluted proteins were analyzed by Western blot.
[0049] (13) Chromatin immunoprecipitation (ChIP): ChIP experiments were performed using the EZ-ChIP kit according to the manufacturer's instructions (Millipore, USA). The ChIP primer sequences are as follows:
[0050] GCTGAGAATCCCACTCAAGGT CATGAGCCTCAGAATGCCAG. Quantitative real-time PCR was used to quantify the immunoprecipitated DNA. Formula 2 was used. [Input Ct-Target Ct] ×100% calculates ChIP data as a percentage relative to Input DNA.
[0051] II. Experimental Results
[0052] 2.1 Synergistic antitumor effect of erlotinib and MUC1 CAR-T
[0053] Erlotinib was selected as an example of an EGFR TKI, and Tn CAR-T cells as an example of a Tn antigen-related immunotherapy. PC9 cells were used as a cell model of EGFR-mutant NSCLC to explore the synergistic effect of the two in vivo. We established a cell-derived xenograft model by subcutaneously injecting PC9 cells into NOD-SCID mice. Erlotinib was administered by gavage, and Tn CAR-T cells or control T cells were infused via the tail vein. Results showed that in mice receiving combined erlotinib and Tn CAR-T cells, tumors were reduced by more than 75%. Figure 1 DE), while in mice treated with erlotinib or TnCAR-T cells alone, tumor reduction was less than 50% ( Figure 1 DE) suggests that EGFR TKI and Tn CAR-T cells produce a synergistic anti-tumor effect.
[0054] At the cellular level, we constructed a co-culture model of tumor cells and immune cells. PC9 and HCC827 cells were used as a model of EGFR-mutant NSCLC, co-cultured with peripheral blood mononuclear cells (PBMCs) or Tn CAR-T cells. Results showed that erlotinib itself did not directly cause tumor cell death. Figure 1 G). When co-cultured with T cells, erlotinib can induce a moderate proportion of tumor cell death (G). Figure 1 H to Figure 1 J). When co-cultured with Tn CAR-T cells, erlotinib can induce the death of a large number of tumor cells (J). Figure 1 H to Figure 1 J). This indicates that erlotinib elicits an anti-tumor immune response in immune cells, particularly in MUC1 CAR-T cells.
[0055] Specifically, such as Figure 1 As shown in the TCGA database, there is no correlation between the expression levels of MUC1 and EGFR wild-type in EGFR-mutant non-small cell lung cancer (NSCLC). Figure 1 A); The TCGA database shows that in EGFR-mutant NSCLC, the expression levels of MUC1 and EGFR mutants are positively correlated (A); Figure 1 B); Knockdown of MUC1 and erlotinib together have a synergistic lethal effect on PC9 cells. This indicates that in EGFR-mutant NSCLC, MUC1 and EGFR-activated pathways jointly promote tumor growth. The growth curve of the PC9 CDX model shows that erlotinib and Tn CAR-T have a synergistic anti-tumor effect. Figure 1 D to Figure 1F); The killing assay showed that treatment with Tn CAR-T cells and erlotinib had a synergistic cell-killing effect on tumor cells, while Tn CAR-T cells alone or erlotinib + PBMCs only resulted in the death of a moderate number of tumor cells. Figure 1 G to Figure 1 J); When co-cultured with PC9 and HCC827 cells treated with erlotinib, Tn CAR-T cells released large amounts of IFN-γ, while Tn CAR-T cells alone or with erlotinib + PBMCs only increased IFN-γ release by a small amount. Figure 1 K and Figure 2 L).
[0056] 2.2 Erlotinib reduced the glycosylation level of MUC1.
[0057] The above cell co-culture experiments showed that erlotinib pretreatment of tumor cells enhanced the killing effect of PBMCs on tumor cells to some extent, and significantly increased the killing effect of Tn CAR-T cells on tumor cells. Therefore, we hypothesize that erlotinib might upregulate the expression level of Tn antigen, thereby triggering the aforementioned anti-tumor immune response. Figure 2 As shown in Figure A, according to the analysis results of the GEO database (GSE165019), erlotinib treatment upregulated the immune scores of most individuals. The upregulation of dendritic cells (DCs) responsible for antigen presentation and CD4+ T cells responsible for specific immune responses was significant, while the upregulation of NK cells and neutrophils representing innate immune responses, and B cells representing humoral immune responses, was not significant, suggesting that erlotinib may have promoted specific cellular immune responses. Figure 2 As shown in Figure B, according to the analysis results of the GEO database (GSE134836), the MUC1 O-glycosylation pathway was significantly downregulated after erlotinib treatment; according to Figure 2 Analysis of the C, GEO database (GSE165019) showed that the expression of most MUC1 O-glycosyltransferases decreased after erlotinib treatment. According to Figure 2 D and Figure 3 Figure E shows that erlotinib did not significantly upregulate glycosylated MUC1 (gMUC1), but it significantly upregulated hypoglycosylated MUC1 (hMUC1), increasing CD3+ T cell infiltration after erlotinib treatment. Figures F and G show that erlotinib only upregulated hMUC1. Based on these results, we hypothesize that erlotinib may promote anti-tumor immune responses by upregulating hypoglycosylated MUC1, particularly Tn antigen expression, thereby synergizing with Tn antigen-related immunotherapy.
[0058] 3.3 Erlotinib mainly regulates MUC1 glycosylation by inhibiting C1GALT1 expression.
[0059] Furthermore, we explored the core glycosyltransferase that regulates MUC1 glycosylation by erlotinib. The results showed that, as Figure 3 As shown, in PC9 cells, erlotinib downregulated C1GALT1 expression by inhibiting the PI3K / AKT pathway. Figure 3 A briefly explains the generation and consumption pathways of Tn antigen. Figure 3 In section B, we used qPCR to screen the expression of Tn antigen-associated glycosyltransferases in PC9 cells after erlotinib treatment. The results showed that erlotinib treatment significantly reduced the expression of C1GALT1. Figure 3 C was further validated at the protein level. Subsequently, we explored the downstream signaling pathways of erlotinib. Figure 3 D used Western blotting to analyze the activity of the MAPK and PI3K / AKT signaling pathways after erlotinib treatment of PC9 cells (EGFR mutant) and A549 cells (EGFR wild-type). The results showed that erlotinib inhibited the activity of the MAPK and PI3K / AKT pathways in PC9 cells, but did not inhibit the activity of either pathway in A549 cells. To further explore the specific molecular pathways by which erlotinib regulates glycosyltransferases, we conducted further investigations. Figure 3 E represents the glycosyltransferase expression profiles after treatment with MAPK and PI3K signaling pathway inhibitors. This indicates that the changes in the expression profiles of Tn antigen-related glycosyltransferases after treatment with PI3K / AKT pathway inhibitors are similar to those after erlotinib treatment, suggesting that erlotinib regulates the expression of Tn antigen-related glycosyltransferases by inhibiting the PI3K / AKT pathway. Based on... Figure 3 F and Figure 4 G. Flow cytometry was used to assess the expression of hypoglycosylated MUC1: Overexpression of C1GALT1 reversed the upregulation of hypoglycosylated MUC1 induced by erlotinib, PI3K inhibitors, and AKT inhibitors.
[0060] 3.4 Erlotinib inhibits C1GALT1 transcription by blocking the PI3K / AKT / SP1 pathway.
[0061] To clarify the specific molecular mechanism by which PI3K / AKT regulates C1GALT1 expression, we reviewed the literature, which suggests that the downstream transcription factor SP1 of AKT may regulate the transcriptional activity of C1GALT1. Figure 4 As shown, specifically, according to Figure 4 A and Figure 4B. SP1 knockdown downregulated C1GALT1 expression in PC9 cells. To further clarify the transcriptional regulatory role of SP1, we performed the following remedial experiments: Figure 4 C1GALT1 expression was analyzed using qRT-PCR after transfection of PC9 cells with either the control vector or the SP1 plasmid, followed by treatment with erlotinib, a PI3K inhibitor, and an AKT inhibitor, respectively. Figure 4 D. SP1 overexpression can compensate for the downregulation of C1GALT1 by erlotinib, PI3K inhibitors, and AKT inhibitors. Furthermore, we directly verified the transcriptional regulation of the downstream C1GALT1 gene using a luciferase reporter gene assay, and verified the binding of SP1 to the C1GALT1 gene promoter region using ChIP-PCR. Figure 4 E shows that the luciferase reporter gene assay analyzed the transcriptional activity of the C1GALT1 gene after SP1 knockdown. According to Figure 4 F, erlotinib treatment reduced the transcriptional activity of the C1GALT1 gene, but this could be reversed by SP1 overexpression. According to Figure 4 G, ChIP-PCR showed that the DNA fragment of the C1GALT1 promoter could be enriched by SP1 immunoprecipitation. Erlotinib, PI3K inhibitors, and AKT inhibitors reduced the binding affinity of SP1 to the C1GALT1 promoter. According to... Figure 5 H, Co-IP showed that erlotinib reduced the binding of SP1 to p-AKT.
[0062] 3.5 Itraconazole regulates the glycosylation process of MUC1 by inhibiting C1GALT1.
[0063] like Figure 5 As shown in Figure A, we treated PC9 cells with 5 μM itraconazole. After 24 hours, we collected the cell proteins for Western blot analysis. The results showed that the protein level of C1GALT1 in PC9 cells was downregulated after itraconazole treatment. This confirms previous reports that itraconazole can act as an inhibitor of C1GALT1 by reducing its protein degradation. PC9 cells and A549 cells were treated with itraconazole according to the above method. Figure 5 B and Figure 5 C indicates that itraconazole does not affect the transcriptional levels of MUC1 and C1GALT1. Figure 5D-5G and FCM data showed that itraconazole significantly upregulated hMUC1 but had no significant regulatory effect on gMUC1. To explore whether itraconazole could serve as a novel immunotherapeutic sensitizer, we used a co-culture model of tumor cells and PBMCs. Tumor cells were pre-treated with 5 μM erlotinib, 5 μM itraconazole, or 5 μM erlotinib + 5 μM itraconazole, and then labeled with calcein before co-culturing with PBMCs. Figure 5 H and Figure 5 As shown in Figure I, PBMCs approximately doubled the killing rate of tumor cells, while the combined action of erlotinib and itraconazole increased the tumor cell killing rate by approximately nine times. We then constructed a co-culture model of tumor cells and Tn CAR-T cells. Tumor cell pretreatment was as described previously. Figure 5 J and Figure 5 In a co-culture system of tumor cells and Tn CAR-T cells, erlotinib and itraconazole can increase the killing ability of Tn CAR-T cells by about 4 times. However, under the combined action of erlotinib and itraconazole, the killing effect of Tn CAR-T cells on tumor cells can be increased by more than 10 times. This indicates that itraconazole can serve as a sensitizer for novel immunotherapies, especially Tn antigen-related immunotherapies. Erlotinib, an EGFR inhibitor, inhibits C1GALT1 transcription through the PI3K / AKT / SP1 pathway, blocking the glycosylation process of MUC1 and upregulating the cell membrane expression of Tn antigen. Itraconazole, as a direct inhibitor of C1GALT1, can directly reduce MUC1 glycosylation, leading to increased accumulation of Tn MUC1.
[0064] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the technical solution of the present invention, and are not intended to limit the specific implementation of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the claims of the present invention should be included within the protection scope of the claims of the present invention.
Claims
1. Application of erlotinib in the preparation of drugs that enhance the therapeutic effect of Tn CAR-T cells on non-small cell lung cancer.
Citation Information
Patent Citations
Targeting drug for enhancing MUC1 CAR-T cell therapy, application thereof, pharmaceutical composition and molecular marker
CN112023052A