Biomarkers, nucleic acid products and kits for gastric cancer

Abstract

The present application relates to a kind of biomarker of gastric cancer, nucleic acid product and kit.The biomarker is GNGT1 gene.Diagnose gastric cancer by detecting the methylation level of the biomarker, with higher sensitivity and specificity, can effectively improve the detection rate of gastric cancer.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a biomarker, nucleic acid product, and reagent kit for gastric cancer. Background Technology

[0002] Stomach cancer is one of the most common malignant tumors in the world. According to statistics, more than one million people worldwide were diagnosed with stomach cancer in 2020, and about 770,000 people died from stomach cancer. Stomach cancer seriously threatens human health and imposes a huge medical burden on patients' families.

[0003] The stage of gastric cancer is a crucial prognostic factor. The 5-year survival rate for early-stage gastric cancer is as high as 95%, while the 5-year survival rate for late-stage gastric cancer is around 20%, with a median survival of only about 9-10 months. Due to the lack of early screening programs, gastric cancer patients are often diagnosed at a late stage, resulting in a poor prognosis. Therefore, early screening and diagnosis are of paramount importance for the prevention and treatment of gastric cancer.

[0004] Currently, commonly used screening methods include imaging examinations, electronic fiberoptic gastroscopy, and serological tests. Among these, the combined use of fiberoptic endoscopy and biopsy is the standard clinical method for diagnosing gastric cancer. Imaging screening for gastric cancer, such as computed tomography (CT), is usually used to check the development and metastasis of gastric cancer. However, gastric cancer patients often do not have obvious clinical symptoms in the early stages, so imaging examinations alone are insufficient for accurate diagnosis. Electronic fiberoptic gastroscopy, as an invasive procedure, heavily relies on laboratory equipment and endoscopists. Due to the nonspecificity and diversity of early gastric cancer manifestations, as well as differences in the experience and skills of physicians in different regions, its false negative rate fluctuates between 8% and 35%. For patients, the gastroscopy procedure is painful and has low acceptance. Serological tests for tumor markers such as carcinoembryonic antigen (CEA), carbohydrate antigens (CA19-9, CA72-4), and pepsinogen have low detection sensitivity, thus limiting their clinical application value. Summary of the Invention

[0005] Therefore, it is necessary to provide a biomarker for gastric cancer to address the problem of low sensitivity of tumor markers in serological screening. By detecting the methylation level of this biomarker, gastric cancer can be diagnosed, which can improve the problem of low sensitivity of traditional biomarkers for gastric cancer detection.

[0006] In addition, the invention provides the application of the above-mentioned biomarkers in the preparation of reagents or kits for diagnosing gastric cancer, as well as nucleic acid products and kits for diagnosing gastric cancer.

[0007] A biomarker for gastric cancer, characterized in that the biomarker is the GNGT1 gene, and gastric cancer is diagnosed by detecting the methylation level of the biomarker.

[0008] This study found that using the GNGT1 gene as a biomarker for gastric cancer, and detecting the methylation level of the GNGT1 gene to diagnose or assist in the diagnosis of gastric cancer, has high sensitivity and specificity, and can effectively improve the detection rate of early gastric cancer.

[0009] Application of reagents used to detect methylation levels of biomarkers such as those described above in the preparation of products for diagnosing gastric cancer.

[0010] A nucleic acid product comprising a detection primer pair for detecting methylation levels in the GNGT1 gene.

[0011] In one embodiment, with reference to GRCh38.p13, the nucleic acid product includes a detection primer pair for detecting the methylation level of the Chr7:93890055–93890872 region.

[0012] In one embodiment, the nucleic acid product includes a detection primer pair for detecting the methylation level of the Chr7 region from 93890055 to 93890731.

[0013] In one embodiment, the nucleic acid product further includes a detection probe corresponding to the detection primer pair, the detection probe having a fluorescent group attached to it.

[0014] In one embodiment, the detection primer pair includes at least one set of the following primer pairs:

[0015] The following primer pairs are used to detect the positive methylation level in the Chr7 region: 93890057–93890181; the second primer pair is used to detect the positive methylation level in the Chr7 region: 93890190–93890344; the third primer pair is used to detect the positive methylation level in the Chr7 region: 93890354–93890523; the fourth primer pair is used to detect the positive methylation level in the Chr7 region: 93890536–93890731; and the fifth primer pair is used to detect the positive methylation level in the Chr7 region: 93890734–93890871. The following primer pairs are used to detect the methylation level of the negative strand in the region Chr7: 93890860–93890751, 93890744–93890658, 93890653–93890493, 93890468–93890300, and 103890288–9389055.

[0016] In one embodiment, the nucleotide sequences of the first primer pair are as shown in SEQ ID NO: 1 to SEQ ID NO: 2; and / or, the nucleotide sequences of the second primer pair are as shown in SEQ ID NO: 3 to SEQ ID NO: 4; and / or, the nucleotide sequences of the third primer pair are as shown in SEQ ID NO: 5 to SEQ ID NO: 6; and / or, the nucleotide sequences of the fourth primer pair are as shown in SEQ ID NO: 7 to SEQ ID NO: 8; and / or, the nucleotide sequences of the fifth primer pair are as shown in SEQ ID NO: 9 to SEQ ID NO: 10; and / or, the nucleotide sequences of the sixth primer pair are as shown in SEQ ID NO: 11 to SEQ ID NO: 12; and / or, the nucleotide sequences of the seventh primer pair are as shown in SEQ ID NO: 13 to SEQ ID NO: 14; and / or, the nucleotide sequences of the eighth primer pair are as shown in SEQ ID NO: 15 to SEQ ID NO: 16; and / or, the nucleotide sequences of the ninth primer pair are as shown in SEQ ID NO: 17 to SEQ ID NO: 18. As shown in NO: 18; and / or, the nucleotide sequence of the tenth primer pair is shown in SEQ ID NO: 19 to SEQ ID NO: 20.

[0017] In one embodiment, the nucleotide sequence of the detection probe corresponding to the first primer pair is shown in SEQ ID NO: 21; and / or, the nucleotide sequence of the detection probe corresponding to the second primer pair is shown in SEQ ID NO: 22; and / or, the nucleotide sequence of the detection probe corresponding to the third primer pair is shown in SEQ ID NO: 23; and / or, the nucleotide sequence of the detection probe corresponding to the fourth primer pair is shown in SEQ ID NO: 24; and / or, the nucleotide sequence of the detection probe corresponding to the fifth primer pair is shown in SEQ ID NO: 25; and / or, the nucleotide sequence of the detection probe corresponding to the sixth primer pair is shown in SEQ ID NO: 26; and / or, the nucleotide sequence of the detection probe corresponding to the seventh primer pair is shown in SEQ ID NO: 27; and / or, the nucleotide sequence of the detection probe corresponding to the eighth primer pair is shown in SEQ ID NO: 28; and / or, the nucleotide sequence of the detection probe corresponding to the ninth primer pair is shown in SEQ ID NO: 29; and / or, the nucleotide sequence of the detection probe corresponding to the tenth primer pair is shown in SEQ ID NO: 29. NO:30 is shown.

[0018] A diagnostic kit for gastric cancer, comprising the aforementioned nucleic acid product.

[0019] In one embodiment, the kit further includes at least one of nucleic acid extraction reagents, methylation conversion reagents, quality control reagents, PCR reaction reagents, and sequencing reagents. Attached Figure Description

[0020] Figure 1 To test the ROC curves of plasma samples from gastric cancer patients and healthy individuals in three GNGT1 gene regions 1-4;

[0021] Figure 2 To test the ROC curves of plasma samples from gastric cancer patients and healthy individuals in the GNGT1 gene regions 5-8;

[0022] Figure 3 To test the ROC curves of plasma samples from gastric cancer patients and healthy individuals, the GNGT1 gene region 9-10 was analyzed. Detailed Implementation

[0023] To facilitate understanding of the present invention, a more complete description will be provided below. The invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of the present invention will be more thorough and complete.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0025] The terms “first,” “second,” etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance. The term “and / or” includes any and all combinations of one or more of the related listed items.

[0026] The term "gastric cancer" (which has the same meaning as stomach cancer) is a cancer that originates from the gastric mucosal epithelium and can occur in the lining of the stomach, as well as in the cardia, body, and antrum.

[0027] The term "diagnosis" includes aspects such as auxiliary diagnosis, recurrence risk assessment, assessment of cancer risk and degree, and prognosis.

[0028] The term "gene" refers to a segment of DNA that encodes a polypeptide chain that produces amino acids. It includes coding and non-coding regions involved in gene transcription / translation and transcription / translation regulation. The coding region includes exon and intron sequences.

[0029] The term "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the final function or use of the oligonucleotide. Oligonucleotides can be produced in any way, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine, and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine, and guanine.

[0030] The term "methylation" is a form of DNA chemical modification that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in a CpG dinucleotide of the genome, under the action of DNA methyltransferases. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

[0031] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides within a DNA sequence is methylated, or the frequency / proportion / percentage of methylation. It represents both a qualitative and quantitative concept. In practical applications, different detection indicators can be used to compare DNA methylation levels depending on the specific circumstances. For example, in some cases, comparisons can be made based on the Ct values ​​of the samples; in others, the proportion of gene methylation in the sample can be calculated as (number of methylated molecules / (number of methylated molecules + number of unmethylated molecules)) × 100, and then compared; in still others, statistical analysis and integration of various indicators are necessary to arrive at a final judgment criterion.

[0032] The term "CpG island" refers to a region on DNA rich in cytosine and guanine linked by phosphate ester bonds. CpG dinucleotides are typically concentrated in promoter regions and exons of human genes. In the normal human genome, CpG sites outside CpG islands are usually methylated, while CpG sites within CpG islands are usually unmethylated. This form of methylation is stably inherited with cell division. When tumors develop, the degree of unmethylation of CpG sites outside CpG islands increases, while CpG sites within CpG islands become hypermethylated, leading to increased chromosome helicalization, transcriptional repression, and loss of gene expression.

[0033] The term "CpG island methylation level" refers to the methylation level of cytosine in one or more CpG dinucleotides within a CpG island.

[0034] The term "methylation site" refers to at least one CpG dinucleotide site in the region, and more particularly to cytosine in at least one CpG dinucleotide site in the region.

[0035] The term "primer" refers to an oligonucleotide that can be used in amplification methods (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific to that polynucleotide sequence. The exact length of a primer depends on many factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least 10, 15, 20, 25, or more nucleotides, depending on the complexity of the target sequence, but can also contain fewer nucleotides.

[0036] The term "primer pair" refers to a pair of primers that can hybridize with the double strand of the target DNA molecule or with regions on either side of the nucleotide sequence to be amplified in the target DNA molecule.

[0037] The term "TaqMan probe" refers to an oligonucleotide sequence containing a 5' fluorescent group and a 3' quencher group. When the probe binds to the corresponding site on DNA, it does not fluoresce because of the presence of the quencher group near the fluorescent group. During amplification, if the probe binds to the strand being amplified, the 5'-3' exonuclease activity of a DNA polymerase (such as Taq polymerase) digests the probe. Since the fluorescent group is far from the quencher group, its energy is not absorbed, thus producing a fluorescent signal. With each PCR cycle, the fluorescence signal, like the target fragment, undergoes a synchronous exponential growth process.

[0038] The term "methylation-specific PCR" is one of the most sensitive experimental techniques for studying methylation, capable of detecting methylation in as little as approximately 50 pg of DNA. After single-stranded DNA undergoes bisulfite conversion, all unmethylated cytosine is deaminated and converted to uracil, while methylated cytosine at CpG sites remains unchanged. Therefore, by designing two pairs of primers targeting methylated and unmethylated sequences, methylated and unmethylated DNA sequences can be distinguished through PCR amplification.

[0039] The term "AUC" is an abbreviation for "Area Under the Curve." Specifically, it refers to the area under the Receiver Operating Characteristic (ROC) curve. An ROC curve is a graph comparing the true positive rate to the false positive rate at different possible cut-off points of a diagnostic test. It depends on the trade-off between sensitivity and specificity at the chosen cut-off point (any increase in sensitivity will be accompanied by a decrease in specificity). The area under the ROC curve (AUC) is a measure of the accuracy of a diagnostic test (a larger area is better; the optimal value is 1; randomized tests will have an ROC curve located diagonally with an area of ​​0.5).

[0040] GNGT1 (G protein subunit gamma transducing 1) plays a role in various tissues, regulating cell proliferation, migration, adhesion, and apoptosis. Furthermore, GNGT1 can be used to differentiate between gastrointestinal stromal tumors and leiomyosarcomas, two cancers with similar histopathology but requiring different treatments.

[0041] Gastric cancer is a complex and heterogeneous disease, involving multiple genetic and epigenetic alterations from the normal gastric mucosa to phenotypic changes, tissue deformation, adenomatous hyperplasia, and finally, gastric adenocarcinoma. Abnormal gene methylation can silence tumor suppressor gene expression or promote oncogene expression, playing a crucial role in tumor development and progression. Abnormal methylation of certain DNA molecules can occur in the early stages of tumor formation. Therefore, using these abnormally methylated DNA molecules as targets for liquid biopsy techniques can effectively distinguish normal tissue from cancerous tissue, paving the way for non-invasive, highly sensitive, and highly specific gastric cancer diagnosis. This study found that using the GNGT1 gene as a biomarker, and detecting the methylation level of the GNGT1 gene to diagnose or assist in the diagnosis of gastric cancer, has high sensitivity and specificity, and can effectively improve the detection rate of gastric cancer.

[0042] Based on this, one embodiment of this application provides a biomarker for gastric cancer, namely the GNGT1 gene, which is used to diagnose gastric cancer by detecting the methylation level of the biomarker. Specifically, the chromosomal location of the GNGT1 gene is 7q21.3. In the NCBI database, the Gene ID of the GNGT1 gene is 2792, and with GRCh38.p13 as a reference, the location of the GNGT1 gene is NC_000007.14 (93906567~93911265).

[0043] In some embodiments, the target region (hereinafter referred to as the "target region") for detecting the methylation level of the GNGT1 gene is the CpG island of the GNGT1 gene.

[0044] In some embodiments, the target region is Chr7: 93890055 to 93890872. Further, the target region is Chr7: 93890055 to 93890731. Using Chr7: 93890055 to 93890731 as the target region results in higher detection sensitivity and specificity.

[0045] In some embodiments, the target region is at least one of the following regions: Chr7: 93890057~93890181, Chr7: 93890190~93890344, Chr7: 93890354~93890523, Chr7: 93890536~93890731, Chr7: 93890734~93890871, Chr7: 93890860~93890751, Chr7: 93890744~93890658, Chr7: 93890653~93890493, Chr7: 93890468~93890300 and Chr7: 93890288~93890055.

[0046] In some embodiments, the target region is at least one of the following regions: positive chains of Chr7: 93890057 to 93890181, positive chains of Chr7: 93890190 to 93890344, positive chains of Chr7: 93890354 to 93890523, positive chains of Chr7: 93890536 to 93890731, positive chains of Chr7: 9389073 ... The positive chain of 93890871, the negative chains of Chr7: 93890860~93890751, the negative chains of Chr7: 93890744~93890658, the negative chains of Chr7: 93890653~93890493, the negative chains of Chr7: 93890468~93890300, and the negative chains of Chr7: 93890288~93890055.

[0047] In some embodiments, gastric cancer is diagnosed by detecting the methylation level of methylation sites in the target region. In an optional specific example, the target region is the positive chain of the Chr7:93890057–93890181 region, and the methylation sites are at least one of the following sites: Chr7:93890060, Chr7:93890073, Chr7:93890092, Chr7:93890095, Chr7:93890104, Chr7:93890106, Chr7:93890158, and Chr7:93890161.

[0048] In one optional specific example, the target region is the positive strand of Chr7: 93890190 to 93890344, and the methylation site is at least one of the following sites: Chr7: 93890191, Chr7: 93890200, Chr7: 93890209, Chr7: 93890309 and Chr7: 93890311.

[0049] In one optional specific example, the target region is the positive strand of Chr7:93890536–93890731, and the methylation site is at least one of the following sites: Chr7:93890538, Chr7:93890543, Chr7:93890552, Chr7:93890555, Chr7:93890691, Chr7:93890695, Chr7:93890700, Chr7:93890716, Chr7:93890724, and Chr7:93890731.

[0050] In one optional specific example, the target region is the negative chain of Chr7: 93890653 to 93890493, and the methylation site is at least one of the following sites: Chr7: 93890650, Chr7: 93890629, Chr7: 93890544, Chr7: 93890539, Chr7: 93890516 and Chr7: 93890502.

[0051] In an optional specific example, the target region is the negative chain of Chr7: 93890468 to 93890300, and the methylation site is at least one of the following sites: Chr7: 93890456, Chr7: 93890415, Chr7: 93890395, Chr7: 93890312, Chr7: 93890310.

[0052] In an optional specific example, the target region is the negative chain of Chr7: 93890288 to 93890055, and the methylation site is at least one of the following sites: Chr7: 93890282, Chr7: 93890272, Chr7: 93890162, Chr7: 93890159, Chr7: 93890074, Chr7: 93890061, Chr7: 93890056.

[0053] It is understandable that when detecting the methylation level of a target region, detection can be performed on the entire target region or on a portion of the target region.

[0054] Based on the above, one embodiment of this application also provides the application of a reagent for detecting the methylation level of the above-mentioned biomarkers in the preparation of products for diagnosing gastric cancer.

[0055] Based on the above, one embodiment of this application also provides a kit for diagnosing gastric cancer, the kit including reagents for detecting the methylation level of the GNGT1 gene.

[0056] In some embodiments, the kit includes a nucleic acid product. This nucleic acid product is used to detect the methylation level of the GNGT1 gene.

[0057] Specifically, the nucleic acid product includes a detection primer pair for detecting the methylation level of the GNGT1 gene. In some embodiments, the nucleic acid product includes a detection primer pair for detecting the methylation level of the Chr7 region: 93890055–93890872. Further, the nucleic acid product includes a detection primer pair for detecting the methylation level of the Chr7 region: 93890055–93890731.

[0058] Optionally, the detection primer pair used to detect the methylation level of the GNGT1 gene includes at least one of the following primer pairs: a primer pair for detecting the methylation level in the region Chr7: 93890057–93890181, a primer pair for detecting the methylation level in the region Chr7: 93890190–93890344, a primer pair for detecting the methylation level in the region Chr7: 93890354–93890523, a primer pair for detecting the methylation level in the region Chr7: 93890536–93890731, and a primer pair for detecting the methylation level in the region Chr7: 93890734–93890523. Primer pairs for detecting methylation levels in the region 3890871, primer pairs for detecting methylation levels in the region Chr7: 93890860~93890751, primer pairs for detecting methylation levels in the region Chr7: 93890744~93890658, primer pairs for detecting methylation levels in the region Chr7: 93890653~93890493, primer pairs for detecting methylation levels in the region Chr7: 93890468~93890300, and primer pairs for detecting methylation levels in the region Chr7: 93890288~93890055.

[0059] In some embodiments, the detection primer pair for detecting the methylation level of the GNGT1 gene includes at least one of the following primer pairs: a first primer pair for detecting the positive methylation level in the region Chr7: 93890057–93890181; a second primer pair for detecting the positive methylation level in the region Chr7: 93890190–93890344; a third primer pair for detecting the positive methylation level in the region Chr7: 93890354–93890523; a fourth primer pair for detecting the positive methylation level in the region Chr7: 93890536–93890731; and a fourth primer pair for detecting the positive methylation level in the region Chr7: 93890734–93890181. The following primer pairs were used: the fifth primer pair for detecting the methylation level of the positive strand in the 871 region; the sixth primer pair for detecting the methylation level of the negative strand in the Chr7 region (93890860–93890751); the seventh primer pair for detecting the methylation level of the negative strand in the Chr7 region (93890744–93890658); the eighth primer pair for detecting the methylation level of the negative strand in the Chr7 region (93890653–93890493); the ninth primer pair for detecting the methylation level of the negative strand in the Chr7 region (93890468–93890300); and the tenth primer pair for detecting the methylation level of the negative strand in the Chr7 region (93890288–93890055).

[0060] Optionally, the nucleotide sequences of the first primer pair are as shown in SEQ ID NO: 1–SEQ ID NO: 2. The nucleotide sequences of the second primer pair are as shown in SEQ ID NO: 3–SEQ ID NO: 4. The nucleotide sequences of the third primer pair are as shown in SEQ ID NO: 5–SEQ ID NO: 6. The nucleotide sequences of the fourth primer pair are as shown in SEQ ID NO: 7–SEQ ID NO: 8. The nucleotide sequences of the fifth primer pair are as shown in SEQ ID NO: 9–SEQ ID NO: 10. The nucleotide sequences of the sixth primer pair are as shown in SEQ ID NO: 11–SEQ ID NO: 12. The nucleotide sequences of the seventh primer pair are as shown in SEQ ID NO: 13–SEQ ID NO: 14. The nucleotide sequences of the eighth primer pair are as shown in SEQ ID NO: 15–SEQ ID NO: 16. The nucleotide sequences of the ninth primer pair are as shown in SEQ ID NO: 17–SEQ ID NO: 18. The nucleotide sequences of the tenth primer pair are as shown in SEQ ID NO: 19–SEQ ID NO: 20.

[0061] In some embodiments, the above-described diagnostic kit for gastric cancer utilizes quantitative real-time fluorescence to detect the methylation level of the GNGT1 gene. Specifically, the above-described nucleic acid product further includes a detection probe corresponding to the detection primer pair, the detection probe being attached with a fluorescent group.

[0062] Optionally, the nucleotide sequence of the detection probe corresponding to the first primer pair is shown in SEQ ID NO: 21. The nucleotide sequence of the detection probe corresponding to the second primer pair is shown in SEQ ID NO: 22. The nucleotide sequence of the detection probe corresponding to the third primer pair is shown in SEQ ID NO: 23. The nucleotide sequence of the detection probe corresponding to the fourth primer pair is shown in SEQ ID NO: 24. The nucleotide sequence of the detection probe corresponding to the fifth primer pair is shown in SEQ ID NO: 25. The nucleotide sequence of the detection probe corresponding to the sixth primer pair is shown in SEQ ID NO: 26. The nucleotide sequence of the detection probe corresponding to the seventh primer pair is shown in SEQ ID NO: 27. The nucleotide sequence of the detection probe corresponding to the eighth primer pair is shown in SEQ ID NO: 28. The nucleotide sequence of the detection probe corresponding to the ninth primer pair is shown in SEQ ID NO: 29. The nucleotide sequence of the detection probe corresponding to the tenth primer pair is shown in SEQ ID NO: 30.

[0063] In some embodiments, the above-mentioned nucleic acid product further includes an internal reference primer pair and an internal reference probe corresponding to the internal reference primer pair. Optionally, the internal reference primer pair is an ACTB primer pair designed for the ACTB gene. In one optional specific example, the nucleotide sequence of the ACTB primer pair is shown in SEQ ID NO: 31-32, and the nucleotide sequence of the internal reference probe corresponding to the ACTB primer pair is shown in SEQ ID NO: 33. It is understood that in other embodiments, other genes can also be selected as internal reference genes, in which case the internal reference primer pair and internal reference probe can be designed accordingly.

[0064] In some embodiments, the detection probe and the internal control probe are Taqman probes. Specifically, both the detection probe and the internal control probe are attached with a fluorescent group and a quencher group. Optionally, the fluorescent group is located at the 5' end of the probe, and the quencher group is located at the 3' end of the probe. Optionally, the fluorescent groups attached to the detection probe and the internal control probe are independently selected from one of FAM, HEX, VIC, CY5, ROX, Texsa Red, JOE, and Quasar 705. Of course, when there are more than two probes in the same reaction system, the fluorescent groups attached to the different probes are different. It is understood that the fluorescent groups attached to the detection probe and the internal control probe are not limited to the above and can also be other fluorescent groups.

[0065] In some embodiments, the kit further includes at least one of nucleic acid extraction reagent, methylation conversion reagent, quality control reagent, PCR reaction reagent, and sequencing reagent. The nucleic acid extraction reagent is used to extract nucleic acids; the methylation conversion reagent is used to deaminate unmethylated cytosine in DNA to uracil, while methylated cytosine remains unchanged; the quality control reagent is used for quality control; the PCR reaction reagent is used to construct the PCR amplification reaction system; and the nucleic acid sequencing reagent is used for sequencing.

[0066] In one embodiment, the methylation conversion agent is a sulfite conversion agent or an enzymatic conversion agent.

[0067] In one embodiment, the PCR reaction reagents include PCR buffer, dNTPs, MgCl2, and DNA polymerase.

[0068] In one embodiment, the quality control materials include positive and negative reference materials.

[0069] It is understood that in other embodiments, the method for detecting GNGT1 gene methylation levels in the above-described gastric cancer diagnostic kit is not limited to the quantitative fluorescence method described above, but may also be other methods. For example, methylation-specific PCR, quantitative methylation-specific PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, or methylation-sensitive restriction endonuclease method, etc. Correspondingly, the above-described gastric cancer diagnostic kit includes the corresponding reagents.

[0070] In some embodiments, the samples for which the above-described diagnostic kit for gastric cancer is applicable include, but are not limited to, blood samples, tissue samples, and stool samples.

[0071] The above-mentioned diagnostic kit for gastric cancer, used to detect the methylation level of the Chr7 region (93890055–93890872), has been verified to achieve a detection sensitivity of over 76% and a specificity of over 80% in tissue samples; and a detection sensitivity of over 64% and a specificity of over 81% in plasma samples. Preferably, the above-mentioned diagnostic kit for gastric cancer, used to detect the methylation level of the Chr7 region (93890055–93890731), achieves a detection sensitivity of over 83% and a specificity of over 80% in tissue samples; and a detection sensitivity of over 76% and a specificity of over 84% in plasma samples, which is beneficial for the early diagnosis of gastric cancer. Specific Implementation

[0073] The following detailed description is provided with reference to specific embodiments. Unless otherwise specified, the embodiments do not include components other than unavoidable impurities. Unless otherwise specified, the reagents and instruments used in the embodiments are conventionally selected in the art. Experimental methods not specifying specific conditions in the embodiments are implemented according to conventional conditions, such as those described in literature, books, or methods recommended by the manufacturer.

[0074] In the following examples, nucleic acid combination 11 consists of an internal reference primer pair with nucleotide sequences as shown in SEQ ID NO: 31-32, and a probe with a corresponding nucleotide sequence as shown in SEQ ID NO: 33. The 5' reporter group of the probe with the nucleotide sequence as shown in SEQ ID NO: 33 is VIC, and the 3' quencher group is BHQ1. Additionally, the probes with nucleotide sequences as shown in SEQ ID NO: 21-30 in Examples 1-10 are all Taqman probes, with a 5' reporter group of FAM and a 3' quencher group of MGB.

[0075] Example 1

[0076] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 1 and nucleic acid combination 11. Nucleic acid combination 1 consists of primer pairs with nucleotide sequences as shown in SEQ ID NO: 1-2 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 21, the specific sequences of which are shown in Table 1. Nucleic acid combination 1 can detect the methylation level of the positive strand of the Chr7: 93890057-93890181 region (region 1) on the GNGT1 gene. The positive strand base sequence of region 1 is as follows (5'-3'):

[0077] AGACGTGGGAAACTGGCGAAGCTGCTACCAGCCGCCGGCGCAAGGAGCGCGAGAGTCCTGGGT GCGCGCAGGGCACTTACTTTCTATCCTCCAGCAAGCATCGTCGCAAGCCTCCCAGGTGTAGA.

[0078] Nucleic acid combination 1 can detect methylation of cytosine at positions Chr7:93890060, Chr7:93890073, Chr7:93890092, Chr7:93890095, Chr7:93890104, Chr7:93890106, Chr7:93890158, and Chr7:93890161 on the positive strand of region 1.

[0079] Example 2

[0080] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 2 and nucleic acid combination 11. Nucleic acid combination 2 consists of primer pairs with nucleotide sequences as shown in SEQ ID NO: 3-4 and probes with corresponding nucleotide sequences as shown in SEQ ID NO: 22, the specific sequences of which are shown in Table 1. Nucleic acid combination 2 can detect the methylation level of the positive strand of the Chr7 region (region 2) on the GNGT1 gene: 93890190-93890344. The positive strand base sequence of region 2 is as follows (5'-3'):

[0081] GCGTTGCCCTCGCAGCCCCCGTACAGGAACTGGCGGCAGCTCTGCGTGTACCTGTCGTAGTAGTAACGGAGAAGTAGGGCCCGGCAGGGTCCGTAGTCTAGGGGCAGGAGACAGATCTCCGCGTTATTTCCTGAAGAAGGGGCAGAAGGAGAGCA.

[0082] Nucleic acid combination 2 can detect methylation of cytosine at positions Chr7:93890191, Chr7:93890200, Chr7:93890209, Chr7:93890309, and Chr7:93890311 on the positive strand of region 2.

[0083] Example 3

[0084] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 3 and nucleic acid combination 11. Nucleic acid combination 3 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 5-6 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 23, the specific sequences of which are shown in Table 1. Nucleic acid combination 3 can detect the methylation level of the positive strand of the Chr7 region (region 3) on the GNGT1 gene, which is from 93890354 to 93890523 bp. The positive strand base sequence of region 3 is as follows (5'-3'):

[0085] GAAAGTGGTCAGGCGTAGCTCCTAGGAGGAAAGAACATCCCGGGGAGTTCTGTCCCCTTCCGAGCGGAGGGGCCTCTGCAGAGAAAGTGCAAACTTGGGAGCGAGTCCCCCCTGCCAGCGGAGCGCGGCAGGGACCTGGAGAAAGCGAGGCTTGGAGGGCGCCTACAC.

[0086] Nucleic acid combination 3 can detect methylation of cytosine at positions Chr7:93890367, Chr7:93890472, Chr7:93890477, Chr7:93890479, Chr7:93890481, Chr7:93890515, and Chr7:93890523 on the positive strand of region 3.

[0087] Example 4

[0088] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 4 and nucleic acid combination 11. Nucleic acid combination 4 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 7-8 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 24, the specific sequences of which are shown in Table 1. Nucleic acid combination 4 can detect the methylation level of the positive strand of the Chr7 region (region 4) on the GNGT1 gene. The positive strand base sequence of region 4 is as follows (5'-3'):

[0089] CCCGCTGCGCCCTCTCCGCCGGTTGGGGAGAGAAGCTCCTGGAGCGGCCAGATACCTGTTGGCTCCTGAGCAGCATCGCCCAGTGCAGCCTCCGTCAGGAAAAGCAGCAGAATCGACAGCCCCAGGGGGCGAGCGGGGTCCATGGTGCAGGGGGTCGGGCGGCCCGCTGGGCAAGGCGTCCGAGAAAGCGCCTGGC.

[0090] Nucleic acid combination 4 can detect methylation of cytosine at positions Chr7:93890538, Chr7:93890543, Chr7:93890552, Chr7:93890555, Chr7:93890691, Chr7:93890695, Chr7:93890700, Chr7:93890716, Chr7:93890724, and Chr7:93890731 on the positive strand of region 4.

[0091] Example 5

[0092] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 5 and nucleic acid combination 11. Nucleic acid combination 5 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 9-10 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 25, the specific sequences of which are shown in Table 1. Nucleic acid combination 5 can detect the methylation level of the positive strand of the Chr7 region (region 5) on the GNGT1 gene: 93890734-93890871. The positive strand base sequence of region 5 is as follows (5'-3'):

[0093] GAGGAGGTGCGCGGCTTTCTGCTCCAGGCGGCCCGGGTGCCCGCTTTATGCGGGGCGAGCGTCCCGGCCGACCCCCGCCGGGGCGGAGCCTGAGGGGTGGCTGATTCATGCACGGGGACTGTCACCCCGCCGCCCCCGC.

[0094] Nucleic acid combination 5 can detect methylation of cytosine at positions Chr7:93890743, Chr7:93890745, Chr7:93890808, Chr7:93890811, Chr7:93890816, Chr7:93890860, Chr7:93890863, Chr7:93890869, and Chr7:93890871 on the positive strand of region 5.

[0095] Example 6

[0096] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 6 and nucleic acid combination 11. Nucleic acid combination 6 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 11-12 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 26, as detailed in Table 1. Nucleic acid combination 6 can detect the methylation level of the negative strand of the Chr7 region (region 6) on the GNGT1 gene. The negative strand base sequence of region 6 is as follows (5'-3'):

[0097] GGGGTGACAGTCCCGTGCATGAATCAGCCACCCCTCAGGCTCCGCCCCGGCGGGGGTCGGCCGGACGCTCGCCCGCATAAAGCGGGCACCCGGGCCGCCTGGAGCAGA.

[0098] Nucleic acid combination 6 can detect methylation of cytosine at positions Chr7:93890846, Chr7:93890809, Chr7:93890802, Chr7:93890798, Chr7:93890794, Chr7:93890768, and Chr7:93890763 on the negative strand of region 6.

[0099] Example 7

[0100] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 7 and nucleic acid combination 11. Nucleic acid combination 7 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 13-14 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 27, as detailed in Table 1. Nucleic acid combination 7 can detect the methylation level of the negative strand of the Chr7 region (region 7) on the GNGT1 gene. The negative strand base sequence of region 7 is as follows (5'-3'):

[0101] CGCACCTCCTCCCGCCAGGCGCTTTCTCGGACGCCTTGCCCAGCGGGCCGCCCGACCCCCTGCACCATGGACCCCGCTCGCCCCCTG.

[0102] Nucleic acid combination 7 can detect methylation of cytosine at positions Chr7:93890744, Chr7:93890732, Chr7:93890725, Chr7:93890717, Chr7:93890713, Chr7:93890701, Chr7:93890696, Chr7:93890670, and Chr7:93890666 on the negative strand of region 7.

[0103] Example 8

[0104] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 8 and nucleic acid combination 11. Nucleic acid combination 8 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 15-16 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 28, the specific sequences of which are shown in Table 1. Nucleic acid combination 8 can detect the methylation level of the negative strand of the Chr7 region (region 8) on the GNGT1 gene. The negative strand base sequence of region 8 is as follows (5'-3'):

[0105] TGTCGATTCTGCTGCTTTTCCTGACGGAGGCTGCACTGGGCGATGCTGCTCAGGAGCCAAGGTATCTGGCCGCTCCAGGAGCTTCTCTCCCCAACCGGCGGAGAGGGCGCAGCGGGCCATGGGGCCCCGTGTAGGCGCCCTCCAAGCCTCGCTTTCTCC.

[0106] Nucleic acid combination 8 can detect methylation of cytosine at positions Chr7:93890650, Chr7:93890629, Chr7:93890544, Chr7:93890539, Chr7:93890516, and Chr7:93890502 on the negative strand of region 8.

[0107] Example 9

[0108] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 9 and nucleic acid combination 11. Nucleic acid combination 9 consists of a primer pair with nucleotide sequences as shown in SEQ ID NO: 17-18 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 29, the specific sequences of which are shown in Table 1. Nucleic acid combination 9 can detect the methylation level of the negative strand of the Chr7 region (region 9) on the GNGT1 gene. The negative strand base sequence of region 9 is as follows (5'-3'):

[0109] GCAGGGGGGACTCGCTCCCAAGTTTGCACTTTCTCTGCAGAGGCCCCTCCGCTCGGAAGGGGACAGAACTCCCCGGGATGTTCTTTCCTCCTAGGAGCTACGCCTGACCACTTTCCCTCTCTTTTGCTCTCCTTCTGCCCCTTCTTCAGGAAATAACGCGGAGATCTGT.

[0110] Nucleic acid combination 9 can detect methylation of cytosine at positions Chr7:93890456, Chr7:93890415, Chr7:93890395, Chr7:93890312, and Chr7:93890310 on the negative strand of region 9.

[0111] Example 10

[0112] This embodiment provides a kit for the diagnosis or auxiliary diagnosis of gastric cancer, comprising nucleic acid combination 10 and nucleic acid combination 11. Nucleic acid combination 10 includes a primer pair with nucleotide sequences as shown in SEQ ID NO: 19-20 and a probe with the corresponding nucleotide sequence as shown in SEQ ID NO: 30, the specific sequences of which are shown in Table 1. Nucleic acid combination 10 can detect the methylation level of the negative strand of the Chr7 region (region 10) on the GNGT1 gene. The negative strand base sequence of region 10 is as follows (5'-3'):

[0113] AGACTACGGACCCTGCCGGGCCCTACTTCTCCGTTACTACTACGACAGGTACACGCAGAGCTGCCGCCAGTTCCTGTACGGGGGCTGCGAGGGCAACGCCAACAATTTCTACACCTGGGAGGCTTGCGACGATGCTTGCTGGAGGATAGAAAGTAAGTGCCCTGCGCGCACCCAGGACTCTCGCGCTCCTTGCGCCGGCGGCTGGTAGCAGCTTCGCCAGTTTCCCACGTCTCG.

[0114] Nucleic acid combination 10 can detect methylation of cytosine at positions Chr7:93890282, Chr7:93890272, Chr7:93890162, Chr7:93890159, Chr7:93890074, Chr7:93890061, and Chr7:93890056 on the negative strand of region 10.

[0115] Table 1

[0116]

[0117]

[0118] Test 1

[0119] 1. Extraction of DNA template

[0120] Collect cancer tissue samples and corresponding 30 adjacent tissue samples of 30 gastric cancer patients in a hospital in Wuhan. All samples are formalin-fixed and paraffin-embedded tissue samples. The collection process of all samples has been approved by the ethics committee. All volunteers have signed informed consent forms, and all samples have been anonymized. Use QIAamp DNA FFPETissue Kit (56404) to extract the tissue DNA of each sample. For specific operations, refer to the kit instructions.

[0121] 2. Bisulfite conversion

[0122] Perform bisulfite conversion on the entire genome of each extracted sample. The nucleic acid conversion kit used is the nucleic acid conversion reagent of Wuhan AmyJet Scientific Co., Ltd. (E Han Xie Bei 20200843). For specific experimental operations, refer to the kit instructions.

[0123] 3. Methylation fluorescence quantitative PCR reaction

[0124] Perform methylation fluorescence quantitative PCR reactions on the DNA of each sample after bisulfite conversion to detect the methylation levels of regions 1-10 of the GNGT1 gene region in each sample. Each gene region is detected separately, that is, only the detection primers and probes for one gene region are added to each PCR tube each time, and at the same time, the detection primers and probes for the internal reference gene ACTB are added. The upstream and downstream primer and probe sequences for each gene region and the ACTB gene are shown in Table 1.

[0125] Use Invitrogen Platinum II Taq hot start DNA polymerase for PCR amplification. The PCR reaction solution preparation system is shown in Table 2.

[0126] Table 2

[0127] Platinum II PCR Buffer 5× 5 dNTPs 2.5mM each 3 upstream primer of GNGT1 region 10μM 0.5 GNGT1 downstream primer 10μM 0.5 GNGT1 region probe 10μM 0.5 ACTB upstream primer 10μM 0.5 ACTB downstream primers 10μM 0.5 ACTB probe 10μM 0.5 Taq enzyme / 0.5 DNA of the sample to be tested / 5 Purified water / Add to 25

[0128] As shown in Table 2, when detecting the methylation status of any region of 1-10 of the GNGT1 gene in a sample, just add the corresponding primer-probe for a certain region, ACTB primer-probe, buffer, dNTP, DNA polymerase, and sample DNA, etc. to the reaction system according to the volumes in the table.

[0129] The PCR reaction conditions are shown in Table 3.

[0130] Table 3

[0131]

[0132] Negative and positive controls: When detecting different regions of the target gene separately, negative and positive controls should be detected simultaneously. The negative control is purified water. The positive control is prepared as follows: the sequence corresponding to the amplified region of ACTB after complete bisulfite conversion is artificially synthesized and cloned into a vector to form a synthetic plasmid. The sequences corresponding to the fully methylated GNGT1 gene regions 1-10 after bisulfite conversion are artificially synthesized and cloned into vectors to form synthetic plasmids. The positive control for GNGT1 gene regions 1-10 is 10. 3 Copies / µL of artificially synthesized ACTB plasmid and 10 3 The artificially synthesized plasmids for regions 1–10 were mixed 1:1. For example, the positive control for region 1 was 10. 3 Copies / µL of artificially synthesized ACTB plasmid and 10 3 The artificially synthesized plasmid of region 1 was mixed 1:1 with copies / µL.

[0133] Ct value reading: After PCR is completed, adjust the baseline. Set the fluorescence value 1 to 2 cycles in advance of the minimum Ct value of the sample in one PCR as the baseline value. Set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.

[0134] Quality control: The negative control should show no amplification, the positive control should show a clear exponential growth phase, and the Ct value of the positive control should be between 26 and 30. The Ct value of the internal reference gene in the sample to be tested should be ≤35. If the negative control, positive control, and internal reference gene all meet the above requirements, the experiment is considered valid, and the next step of sample result determination can be carried out. Otherwise, the experiment is invalid and must be repeated.

[0135] 4. PCR Result Analysis

[0136] Results analysis and interpretation method: For tissue samples, when the Ct value of a certain detection area on the sample is ≤38, it is considered that methylation has been detected in this area of ​​the sample. If the Ct value of a certain detection area on the sample is >38, it is considered that the sample is methylation negative in this detection area.

[0137] The methylation detection results of the samples were compared with the pathological results to calculate the sensitivity and specificity of the methylation detection. The results are shown in Table 4. In this embodiment, sensitivity is the proportion of gastric cancer samples with positive methylation detection results, and specificity is the proportion of adjacent normal samples with negative methylation detection results.

[0138] Table 4

[0139]

[0140] Table 4 shows that the detection efficacy of GNGT1 gene regions 1-10 varies between gastric cancer tissue samples and adjacent normal tissue samples. Overall, GNGT1 gene regions 1-10 exhibit good sensitivity and specificity in gastric cancer tissue samples, with a detection sensitivity of ≥70% and a specificity of ≥70% in adjacent normal tissue samples. Furthermore, regions 1, 2, 4, 8, 9, and 10 show significantly better detection sensitivity and specificity than other regions, with detection rates exceeding 83.3% in gastric cancer tissue samples and specificities of ≥80% in adjacent normal tissue samples.

[0141] Test 2

[0142] 1. Sample collection, DNA template extraction, and bisulfite conversion are the same as in Test 1.

[0143] 2. PCR amplification and sequencing

[0144] Degenerate primer pairs were designed, as detailed in Table 5. Using bisulfite-converted genomic DNA as templates, PCR reactions were performed to amplify the GNGT1 gene region Chr7: 93890055–93890872. The PCR reaction system is shown in Table 6, and the PCR amplification procedure is shown in Table 7. After PCR amplification, the amplified products were sequenced using the degenerate primer pairs (sent to a sequencing company), with sequencing performed simultaneously from the 5' and 3' ends.

[0145] Table 5

[0146]

[0147] Table 6

[0148]

[0149]

[0150] Table 7

[0151]

[0152] 3. Results Analysis

[0153] The methylation status of CpG sites in the amplicon of each sample was analyzed based on the sequencing peak diagram. If the sequencing result of cytosine in the CpG dinucleotide is thymine, it is unmethylated. If the sequencing result of cytosine in the CpG dinucleotide is still cytosine, it is fully methylated. If the sequencing result of cytosine in the CpG dinucleotide is both cytosine and thymine (bimodal), it is partially methylated. If more than 95% of the CpG dinucleotides in the amplicon are methylated, the sample is considered methylated positive in that gene region. For the GNGT 1 gene region Chr7:93890055~93890872, there are 70 CpG dinucleotides. If at least 66 CpG dinucleotides in this region of a sample are methylated, the sample is considered methylated positive in that region. The methylation detection results of the samples were compared with the pathological results, and the sensitivity and specificity of the methylation detection were calculated, as shown in Table 8.

[0154] Table 8

[0155]

[0156] In summary, in addition to using methylation-based quantitative PCR, the bisulfite sequencing method can also effectively distinguish between gastric cancer tissue samples and adjacent normal tissue samples by detecting the methylation level of the CpG island Chr7:93890055~93890872 of the GNGT1 gene. The sensitivity of the detection is greater than 76% and the specificity is 80%.

[0157] Test 3

[0158] Considering that using methylation-based quantitative PCR to detect the methylation level of subject samples is more convenient and time-saving, blood samples were collected from the subjects. The methylation status of plasma cfDNA was detected using the primer pairs and probes shown in Table 1 to determine whether the subjects were cancer-positive. The specific procedures were as follows: Plasma samples from patients diagnosed with gastric cancer by tissue biopsy and plasma samples from healthy individuals were collected from a hospital in Wuhan. 5 mL was collected from each person, resulting in 64 plasma samples from gastric cancer patients and 53 plasma samples from healthy individuals. All sample collection processes were approved by the ethics committee, all volunteers signed informed consent forms, and all samples were anonymized. Plasma cfDNA was extracted using the magnetic bead-based serum / plasma cell-free DNA (cfDNA) extraction kit (DP709) from Tiangen Biotech (Beijing) Co., Ltd. Specific procedures were described in the kit instructions. Bisulfite conversion was performed according to the method provided in Test 1. Methylation-specific PCR experiments were conducted using the primer and probe combinations for the GNGT1 gene based on 10 regions, as shown in Table 1. PCR results were analyzed using 2... -ΔΔCtROC analysis was performed to calculate the sensitivity, specificity, and AUC value of each region when the Youden's index was maximized in gastric cancer patients, where ΔCt = (Ct) / (Ct) 待检区域 -Ct ACTB ) 样本 -(Ct 待检区域 -Ct ACTB ) 阳性对照 The results are shown in Table 9 and Figures 1-3 As shown.

[0159] Table 9

[0160]

[0161]

[0162] As shown in Table 9, GNGT1 gene regions 1-10 can effectively distinguish between gastric cancer plasma samples and healthy human plasma samples. The detection sensitivity of each region is above 64%, and the specificity is above 81%. Among them, the AUC values ​​of GNGT1 gene regions 1, 2, 4, 8, 9, and 10 are significantly higher than those of other regions. Furthermore, in plasma samples, the detection sensitivity of these six regions for gastric cancer is above 76%, and the specificity is above 84%.

[0163] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0164] The embodiments described above are merely illustrative of several implementations of the present invention, facilitating a detailed understanding of the technical solutions of the present invention, but should not be construed as limiting the scope of protection of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. It should be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided by the present invention through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this invention patent should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims. sequence list <110> Wuhan Aimeisen Life Technology Co., Ltd. <120> Biomarkers, nucleic acid products and reagent kits for gastric cancer <141> 2022-03-15 <160> 35 <170> SIP O Sequence Listing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 agacgtggga aattggcg 18 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 tctacaccta aaaaacttac gacga 25 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 gcgttgtttt cgtagttttc g 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <400> 4 tactctcctt ctaccccttc ttca 24 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 gaaagtggtt aggcgtagtt tttag 25 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 gtataaacgc cctccaaacc t 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 ttcgttgcgt ttttttcgtc 20 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <400> 8 gccaaacgct ttctcgaa 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 gaggaggtgc gcggtttt 18 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <400> 10 gcgaaaacga cgaaataaca at 22 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <400> 11 ggggtgatag ttttcgtgta tgaat 25 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <400> 12 tctactccaa acgacccgaa tac 23 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <400> 13 cgtatttttt ttcgttaggc gtt 23 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <400> 14 caaaaaacga acgaaatcca taat 24 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <400> 15 tgtcgatttt gttgtttttt ttgac 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <400> 16 aaaaaaaacg aaacttaaaa aacgc 25 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <400> 17 gtagggggga ttcgttttta agt 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <400> 18 acaaatctcc gcgttatttc cta 23 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <400> 19 agattacgga ttttgtcggg tt 22 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 cgaaacgtaa aaaactaacg aaact 25 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <400> 21 tcggcgtaag gagcgcgaga gt 22 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <400> 22 aggggtagga gatagatttt cgcgt 25 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <400> 23 ttgttagcgg agcgcgcggt a 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <400> 24 tcgggcggtt cgttgggtaa 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <400> 25 tcgtcggggc ggagtttgag g 21 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <400> 26 gcgggggtcg gtcggacg 18 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <400> 27 tcggacgttt tgtttagcgg gtcgt 25 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <400> 28 agagggcgta gcgggttatg gg 22 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 cggaagggga tagaattttt cggga 25 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <400> 30 tgggaggttt gcgacgatgt ttgtt 25 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <400> 31 aaggtggttg ggtggttgtt ttg 23 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <400> 32 aataacaccc ccaccctgc 19 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <400> 33 ggagtggttt ttgggtttg 19 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <400> 34 tggaagaaat tgaaaattat gagg 24 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <400> 35 ggggtttaaa aaacaaattc aac 23

Claims

1. Application of reagents for detecting methylation levels of biomarkers in the preparation of products for diagnosing gastric cancer; The reagents used to detect the methylation level of biomarkers include at least one of the following primer pairs: The following primer pairs are used to detect the positive methylation level in the Chr7 region: 93890057~93890181; the second primer pair is used to detect the positive methylation level in the Chr7 region: 93890190~93890344; the third primer pair is used to detect the positive methylation level in the Chr7 region: 93890354~93890523; the fourth primer pair is used to detect the positive methylation level in the Chr7 region: 93890536~93890731; and the fifth primer pair is used to detect the positive methylation level in the Chr7 region: 93890734~93890871. The following primer pairs are used to detect the methylation level of the negative strand in the region Chr7: 93890860~93890751, 93890744~93890658, 93890653~93890493, 93890468~93890300, and 103890288~93890055.

2. A nucleic acid product, characterized in that, This includes detection primer pairs for detecting methylation levels in the GNGT1 gene; The detection primer pair includes at least one of the following primer pairs: The following primer pairs are used to detect the positive methylation level in the Chr7 region: 93890057~93890181; the second primer pair is used to detect the positive methylation level in the Chr7 region: 93890190~93890344; the third primer pair is used to detect the positive methylation level in the Chr7 region: 93890354~93890523; the fourth primer pair is used to detect the positive methylation level in the Chr7 region: 93890536~93890731; and the fifth primer pair is used to detect the positive methylation level in the Chr7 region: 93890734~93890871. The following primer pairs are used to detect the methylation level of the negative strand in the region Chr7: 93890860~93890751, 93890744~93890658, 93890653~93890493, 93890468~93890300, and 103890288~93890055.

3. The nucleic acid product according to any one of claims 2, characterized in that, The nucleic acid product also includes a detection probe corresponding to the detection primer pair, and the detection probe is attached with a fluorescent group.

4. The nucleic acid product according to claim 2, characterized in that, The nucleotide sequences of the first primer pair are shown in SEQ ID NO: 1 to SEQ ID NO: 2; and / or, the nucleotide sequences of the second primer pair are shown in SEQ ID NO: 3 to SEQ ID NO: 4; and / or, the nucleotide sequences of the third primer pair are shown in SEQ ID NO: 5 to SEQ ID NO: 6; and / or, the nucleotide sequences of the fourth primer pair are shown in SEQ ID NO: 7 to SEQ ID NO: 8; and / or, the nucleotide sequences of the fifth primer pair are shown in SEQ ID NO: 9 to SEQ ID NO: 10; and / or, the nucleotide sequences of the sixth primer pair are shown in SEQ ID NO: 11 to SEQ ID NO: 12; and / or, the nucleotide sequences of the seventh primer pair are shown in SEQ ID NO: 13 to SEQ ID NO: 14; and / or, the nucleotide sequences of the eighth primer pair are shown in SEQ ID NO: 15 to SEQ ID NO: 16; and / or, the nucleotide sequences of the ninth primer pair are shown in SEQ ID NO: 17 to SEQ ID NO:

18. As shown in NO: 18; and / or, the nucleotide sequence of the tenth primer pair is shown in SEQ ID NO: 19 to SEQ ID NO:

20.

5. The nucleic acid product according to claim 4, characterized in that, The nucleotide sequence of the detection probe corresponding to the first primer pair is shown in SEQ ID NO: 21; and / or, the nucleotide sequence of the detection probe corresponding to the second primer pair is shown in SEQ ID NO: 22; and / or, the nucleotide sequence of the detection probe corresponding to the third primer pair is shown in SEQ ID NO: 23; and / or, the nucleotide sequence of the detection probe corresponding to the fourth primer pair is shown in SEQ ID NO: 24; and / or, the nucleotide sequence of the detection probe corresponding to the fifth primer pair is shown in SEQ ID NO: 25; and / or, the nucleotide sequence of the detection probe corresponding to the sixth primer pair is shown in SEQ ID NO: 26; and / or, the nucleotide sequence of the detection probe corresponding to the seventh primer pair is shown in SEQ ID NO: 27; and / or, the nucleotide sequence of the detection probe corresponding to the eighth primer pair is shown in SEQ ID NO: 28; and / or, the nucleotide sequence of the detection probe corresponding to the ninth primer pair is shown in SEQ ID NO: 29; and / or, the nucleotide sequence of the detection probe corresponding to the tenth primer pair is shown in SEQ ID NO:

30.

6. A reagent kit for diagnosing gastric cancer, characterized in that, Includes the nucleic acid product as described in any one of claims 2 to 5.

7. The reagent kit according to claim 6, characterized in that, The kit also includes at least one of the following: nucleic acid extraction reagent, methylation conversion reagent, quality control reagent, PCR reaction reagent, and sequencing reagent.

Images