Application of CHR-6494 in the preparation of drugs for preventing and treating porcine pseudorabies

By using the drugs prepared by the Haspin kinase inhibitor CHR-6494, the replication of PRV in pig cells was inhibited, and the problem of lack of effective drug treatment for pseudorabies in the prior art was solved, and the significant inhibitory effect on PRV was achieved.

CN116832039BActive Publication Date: 2025-07-29YUNNAN ANIMAL SCI & VETERINARY INST +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310605257.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-26
Publication Date
2025-07-29
Estimated Expiration
2043-05-26

AI Technical Summary

Technical Problem

Currently, there is a lack of effective drugs for treating pseudorabies in pigs. The existing prevention and control methods mainly rely on vaccine immunity and improving biosafety levels, and cannot effectively treat PRV infection.

Method used

The Haspin kinase-specific inhibitor CHR-6494 was used to treat infected PRV cell lines by inhibiting PRV replication, including dosage forms such as powder injections, capsules, tablets and suspensions. The concentration of 100 nM-2.0uM was treated with infected PRV cell lines.

Benefits of technology

It significantly inhibits the replication of PRV on pig alveolar macrophages, reduces the intensity of virus fluorescence, gene transcription level and structural protein expression, and effectively prevents and treats pseudorabies from pigs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116832039B_ABST
    Figure CN116832039B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of CHR-6494 in the preparation of a medicament for preventing and treating porcine pseudorabies. The structural formula of CHR-6494 is as follows: In the present invention, it is determined that the inhibitor CHR-6494 has an obvious inhibitory effect on the proliferation of PRV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of animal disease prevention and control, and particularly relates to the application of CHR-6494 in the preparation of a drug for preventing and treating porcine pseudorabies. Background Art

[0002] Porcine pseudorabies virus (PRV) belongs to the genus Alphaherpesvirus and is a linear double-stranded DNA virus. PRV can infect a variety of mammals, including canids (dogs, foxes, wolves, etc.), felids (cats, lions, etc.), ruminants (sheep, cattle, etc.), rodents (rats), and pigs, etc. However, pigs are the only natural host of PRV. PRV infection can cause fever, itching, and neurological symptoms in non-natural infected hosts; it can cause diarrhea, neurological symptoms in piglets, and reproductive disorders in pregnant sows. In addition, in recent years, a large number of cases have confirmed that PRV can infect humans and can cause encephalitis and even death in patients. Moreover, most of the patients involved in the cases are related to the pig industry, indicating that the prevalence of PRV not only seriously endangers the healthy development of the breeding industry, but also poses a great threat to national health. At present, the prevention and control of PRV mainly rely on vaccination and improving the level of biosecurity, and there is no specific therapeutic drug for the time being, which is not conducive to the treatment of PRV infection.

[0003] CHR-6494, 3-(1H-indazol-5-yl)-N-propyl-imidazo[1,2-b]pyridazin-6-amine, is a Haspin inhibitor, and it shows anti-proliferative activity in a variety of tumor cell lines. Existing technologies have demonstrated that CHR-6494 has the effect of anti-tumor angiogenesis; in vivo experiments in mice also show its anti-tumor potential and no obvious toxicity to normal tissues. At the same time, CHR-6494 shows good effects in anti-breast cancer, colon cancer, and cervical cancer. CHR-6494 alone can inhibit the growth of several types of melanoma cell lines in a dose-dependent manner, and when used in combination with a MEK inhibitor (trametinib, GSK-1120212), it also has an additive effect in inhibiting the activity of wild-type mutant and BRAFV600E mutant melanoma cells. Summary of the Invention

[0004] The present invention aims to provide the application of CHR-6494 in the preparation of a drug for preventing and treating porcine pseudorabies.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] The application of CHR-6494 or its pharmaceutically acceptable salt in the preparation of a drug for preventing and treating porcine pseudorabies, and the structural formula of CHR-6494 is as follows:

[0007]

[0008] In one preferred embodiment, the CHR-6494 or a pharmaceutically acceptable salt thereof is combined with a pharmaceutically acceptable carrier and / or excipient to form any pharmaceutically acceptable dosage form.

[0009] In one preferred embodiment, the dosage form includes freeze-dried powder for injection, capsules, tablets, and suspensions.

[0010] In one preferred embodiment, the CHR-6494 or a pharmaceutically acceptable salt thereof prevents and treats pseudorabies in pigs by inhibiting PRV replication.

[0011] Based on the same inventive concept, the present invention also provides a medicament for preventing and treating pseudorabies in pigs, which comprises CHR-6494 or a pharmaceutically acceptable salt thereof.

[0012] A method for preventing and treating pseudorabies in pigs, comprising: treating PRV-infected cell lines with CHR-6494, with the dosage of CHR-6494 being 100 nM - 2.0 μM, and preferably the concentration being 100 - 500 nM.

[0013] The present invention uses techniques such as cell biology and virology to discover that the Haspin kinase specific inhibitor CHR-6494 has an obvious interfering effect on PRV proliferation in in vitro tests. First, cytotoxicity detection is performed using CHR-6494, and concentrations with less impact on cell viability are screened for subsequent tests; then, techniques such as indirect immunofluorescence, fluorescence quantitative PCR, and Western blotting are used to evaluate the effect of CHR-6494 on PRV proliferation in in vitro tests, and it is found that this compound can significantly inhibit the PRV proliferation efficiency.

[0014] Using the method of the present invention can significantly inhibit the replication efficiency of PRV on porcine alveolar macrophages (3D4 / 21). When the inhibitor treatment concentration is higher than 12.5 nM, compared with the control group, the fluorescence intensity, viral gene transcription level, and structural protein expression level of PRV all decrease significantly, indicating that CHR-6494 can effectively inhibit PRV proliferation. Description of the Drawings

[0015] Figure 1 Results of cytotoxicity detection of different concentrations of CHR-6494 on 3D4 / 21 cells.

[0016] Figure 2 Inhibitory effect of treatment with different concentrations of CHR-6494 on rPRVHuN-EGFP strain infecting 3D4 / 21 cells.

[0017] Among them, rPRVHuN-EGFP-infected cells can express green fluorescence, and the greater the fluorescence intensity, the more virus proliferation indicates;

[0018] The results showed that when the concentration of CHR-6494 was higher than XX nM, the proportion of cells expressing green fluorescence decreased by more than 50% compared with the untreated group.

[0019] Figure 3 This is the effect of CHR-6494 treatment on the cytopathic effect of PRV infection.

[0020] Figure 4 This is the inhibitory effect of different concentrations of CHR-6494 treatment on the infection of PRV variant strains and classical strains; among them, A: the transcriptional levels of PRV gE and gB genes; B: the relative expression of PRV gB protein.

[0021] Figure 5 This is the inhibitory effect of different treatment times of CHR-6494 on PRV-infected cells; among them, NC is the control group; CHR-6494 is the inhibitor treatment group. Specific implementation manners

[0022] The present invention will be described in detail below with reference to the accompanying drawings and in conjunction with embodiments. It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other.

[0023] 1 Materials

[0024] 1.1 Compounds, plasmids, viruses and cell lines

[0025] The 3D4 / 21 cells are preserved in our laboratory; the rPRVHuN-EGFP recombinant virus, PRV variant (HuN-LD-2019) and PRV classical strain (HuN-XT-2020) are constructed or isolated in our laboratory (constructed or isolated in the manner described in the literature [1] Tan L, Shu X, Xu K, et al., Homologous recombination technology generated recombinant pseudorabies virus expressing EGFP facilitates to evaluate its susceptibility to different cells and screen antiviral compounds [J]. Res Vet Sci, 2022, 145: 125-134. and [2] Lin Y, Tan L, Wang C, et al., Serological Investigation and Genetic Characteristics of Pseudorabies Virus in Hunan Province of China From 2016 to 2020 [J]. Front Vet Sci, 2021, 8: 762326.), and preserved; the Haspin kinase inhibitor (CHR-6494) is purchased from Nanjing BioDee Biotechnology Co., Ltd.;

[0026] 1.2 Main reagents

[0027] The PRV-gB monoclonal antibody is kindly donated by Professor Jiang Ping of Nanjing Agricultural University; the anti-β-actin rabbit monoclonal antibody is purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; in addition, fluorescence quantitative reagent SYBR Green (Novoprotein), cDNA reverse transcription kit (Novoprotein), ECL hypersensitive chemiluminescence solution (Xinsaimi Co., Ltd.) and fetal bovine serum (GBICO), etc. are conventional reagents and are purchased on the market.

[0028] Example 1

[0029] Cytotoxicity test of CHR-6494 on 3D4 / 21 cells

[0030] Seed 3D4 / 21 cells in a 96-well plate. When the cell density reaches 50 - 60%, discard the supernatant, and add cell maintenance medium (DMEM 1640 medium supplemented with 2% FBS and 1% double antibody solution) containing different concentrations of CHR-6494 (0.1 μM, 0.25 μM, 0.5 μM, 1.0 μM, 2.0 μM, and 4.0 μM), with the DMSO group as the control group. After culturing the cells for 36 h, detect the corresponding OD490 values of the cells in each group by the MTT method.

[0031] The results are as Figure 1 shown. Low concentrations of CHR-6494 (0.1 - 0.5 μM) have little effect on the activity of 3D4 / 21 cells, but CHR-6494 with a concentration exceeding 1.0 μM has a slightly greater effect on cell activity. Therefore, 0 - 0.5 μM CHR-6494 was selected for subsequent cell experiments.

[0032] Example 2

[0033] Preliminary determination of the half-maximal effective inhibitory concentration of CHR-6494 against rPRVHuN-EGFP

[0034] Infect 3D4 / 21 cells (with a density of approximately 80%) in a 12-well plate with 1000 TCID50 of rPRVHuN-EGFP. After adsorbing at 37 °C for 2 h, discard the supernatant and wash 3 times with PBS. Dilute the CHR-6494 inhibitor with cell maintenance medium to a final concentration of 1.95 nM, 3.90 nM, 7.80 nM, 15.62 nM, 31.25 nM, 62.50 nM, 125 nM, 250 nM, and 500 nM, and add them to different cell wells, with 3 replicates in each group. After 24 h, discard the supernatant, wash 3 times with PBS, add an appropriate amount of PBS solution, and observe the proportion of EGFP-expressing cells in each group under a fluorescence microscope. The results are as Figure 2 shown.

[0035] As Figure 2 can be seen, CHR-6494 can effectively reduce the proportion of rPRVHuN-EGFP-infected positive cells, and to a certain extent, it shows concentration dependence ( Figure 2 -A). Further analysis shows that compared with the DMSO group, the decline rate of the proportion of EGFP-positive cells in the CHR-6494 concentration group higher than 12.5 nM exceeds 50%. If a 50% decrease in the proportion of EGFP-expressing cells is regarded as a 50% decrease in virus titer, the CC50 of CHR-6494 for cells is 1.0 - 2.0 μM. Therefore, the therapeutic index (TI) of CHR-6494 against rPRVHuN-EGFP should be higher than 40, belonging to low toxicity and high efficiency ( Figure 2 -B).

[0036] Infect 3D4 / 21 cells (at a density of approximately 80%) in a 6-well plate with 5000 TCID50 of the PRV variant strain. After adsorption at 37°C for 2 h, discard the supernatant and wash the cells 3 times with PBS. Dilute the CHR-6494 inhibitor with cell maintenance medium to final concentrations of 0 nM (DMSO), 50 nM, 100 nM, 200 nM, and 400 nM, and add them to different cell wells respectively; at the same time, set up a virus-free group (NC). After 24 h, discard the supernatant and wash the cells 3 times with PBS, and observe the cytopathic effects of each group of cells.

[0037] The results are as Figure 3 shown. Obvious cytopathic effects were visible in the cells of the DMSO treatment group 24 h after infection with the PRV variant strain, and large "lesion cavities" appeared; while there were basically no cytopathic effects in the cells of the 400 nM and 200 nM CHR-6494 treatment groups after virus infection. Although there were cytopathic effects in the cells of the 100 nM and 50 nM inhibitor treatment groups, they were significantly milder than those in the DMSO treatment group. The above results indicate that treatment with CHR-6494 can effectively alleviate the cytopathic effects caused by PRV infection, suggesting that this compound has an anti-PRV infection effect.

[0038] Example 3

[0039] Preliminary exploration of the effect of CHR-6496 treatment on the infection of PRV variant and classical strains

[0040] 1) Seed 3D4 / 21 cells in a 6-well plate. When the cell density reaches about 80%, discard the supernatant and add DMEM medium; 2) Infect each well with 5000 TCID50 of the PRV variant strain or classical strain. After adsorption at 37°C for 2 h, discard the supernatant and wash the cells 3 times with PBS solution; 3) Dilute the CHR-6494 inhibitor with cell maintenance medium to final concentrations of 400 nM, 200 nM, 100 nM, and 50 nM, and add them to different cell wells respectively; 4) After 36 h, collect the cells of each group and use them to extract total cellular RNA and proteins for subsequent RT-qPCR and Western blot assays.

[0041] The main steps for extracting proteins and detecting the relative expression level of PRV gB protein by Western Blot are as follows: 1) Taking the cells in a 6-well plate as an example, after washing twice with PBS, add RIPA buffer containing 1% PMSF and incubate on ice for 15 min; 2) Scrape the cells into a 1.5 mL centrifuge tube, centrifuge at a high speed (12,000 r / min) at low temperature (4 °C) for 15 min, and take the supernatant and place it in a clean 1.5 mL centrifuge tube; 3) Determine the protein concentration by the BCA method, add 5×SDS buffer (containing 6% mercaptoethanol) to the remaining supernatant, and boil for 5 min; 4) Take about 25.0 μg of protein and add it into the polyacrylamide gel wells, set the voltage to 85 V for 30 min; 120 V for 70 min; 5) Transfer the membrane by semi-dry method, and the transfer conditions are 85 V for 80 min; after the transfer is completed, place the PVDF membrane in 5% skim milk powder and block it at room temperature for 1 h or at 4 °C overnight; 6) Rinse with TBST three times, add the primary antibody (anti-PRV-gB / β-actin) and incubate at room temperature for 4 h, wash with TBST five times, 6 min each time; 7) Add the secondary antibody labeled with HRP (corresponding to the property of the primary antibody) and incubate at room temperature for 45 min, wash the membrane with PBST five times, 6 min each time; 8) Prepare the color development solution immediately before use and detect whether the target protein is expressed by chemiluminescence method in the imaging system.

[0042] The method for extracting total cellular RNA is as follows:

[0043] Extract total cellular RNA by the Trizol method, and the steps are as follows:

[0044] 1) After rinsing the monolayer cells with PBS, add 400 μL of Trizol Reagent, mix well and let it stand on ice for 5 min; scrape the mixture with a RNase-free pipette tip into a RNase-free 1.5 mL centrifuge tube;

[0045] 2) Add 100 μL of chloroform to the centrifuge tube, vortex for 15 s on a vortex mixer, and let it stand on ice for 2 min; centrifuge at 12,000 r / min in a 4 °C centrifuge for 15 min;

[0046] 3) Pipette the upper clear aqueous phase into a new RNase-free centrifuge tube, add 200 μL of isopropanol, invert 10 times up and down, and let it stand on ice for 10 min; centrifuge at 12,000 r / min in a 4 °C centrifuge for 10 min;

[0047] 4) Discard the liquid after centrifugation, add 500 μL of pre-cooled 75% ethanol solution to wash the precipitate, invert several times up and down, and centrifuge at 7,500 r / min in a 4 °C centrifuge for 5 min;

[0048] 5) Repeat step 4) once, discard the supernatant; centrifuge at 8,000 r / min for 1 min to centrifuge the liquid on the tube wall to the bottom;

[0049] 6) Aspirate the supernatant. A small amount of white precipitate can be seen at the bottom. Place the centrifuge tube in a laminar flow hood, open the centrifuge tube cap, and allow the ethanol in the tube to evaporate. After 4 - 5 minutes, 30 - 50 μL of RNase-free water can be added to the centrifuge tube. Place the centrifuge tube in a water bath (about 60 °C) for 5 minutes to promote RNA dissolution. Subsequently, reverse transcribe the RNA into cDNA, or store the RNA at -80 °C.

[0050] The main steps for determining the transcriptional levels of PRV gE and gB genes (RT-qPCR) are as follows: 1) After the cells are infected with the virus, total RNA is extracted by the Trizol method. The concentration of the extracted total RNA is measured, and 1.0 μg of RNA is taken for reverse transcription. This process is divided into 2 steps:

[0051] A) Add 1.0 μL of 1.0 μg RNA, 10 mM dNTP, and random primer (Random primer) each to a 12 μL system, and fill the rest with RNase-free water; after mixing, centrifuge briefly, and the reaction conditions are 65 °C for 10 minutes;

[0052] B) Prepare a mixture of an 8 μL system, which includes 4.0 μL of 5×MLV buffer, 2.0 μL of 0.1 M DTT solution, 1.5 μL of RNase-free water, and 0.5 μL of 1 M M-MLV reverse transcriptase; after mixing, add it to the reaction system of the previous step, for a total of 20 μL system. The reaction conditions are 37 °C for 60 minutes and 70 °C for 15 minutes.

[0053] Reverse transcription reaction-related reagents such as random primer (random primer) (product number: 48190011), M-MLV reverse transcriptase (product number: 28025013), dNTP (product number: R0194), MLV buffer (product number: D1532), M DTT solution (product number: D1532), etc. are all purchased from Thermo Fisher Scientific.

[0054] Use the online software Primer-Blast to design RT-qPCR primers for the target genes (Table 1). The primers are all synthesized by Changsha Qingke Biotechnology Co., Ltd. Using the GAPDH gene as an internal reference, the relative expression of each detected gene in the cells is verified by qPCR. The qPCR reaction system includes 5.0 μL of 2×SYBR Green premix, 0.2 μL of each upstream / downstream primer, 1.0 μL of cDNA template, and 3.6 μL of RNase-free water; the reaction conditions are 95 °C for 5 minutes; 95 °C for 10 seconds, 60 °C for 30 seconds, and a total of 40 cycles are set. After the reaction is completed, according to the corresponding Ct values of each group's target gene and GAPDH gene, analyze the relative expression levels of each gene by the 2-ΔΔct method, and use GraphPad Prism 9.0 software to statistically analyze the results and draw graphs.

[0055] RT-qPCR primers for the genes in Table 1

[0056] Primer Name Primer Sequence (5’-3’) qPCR-PRV-gE-F (Forward Primer) GACCCCGAGGACGAGTTCA qPCR-PRV-gE-R (Reverse Primer) ACGCCATAGTTGGGTCCATT qPCR-PRV-gB-F (Forward Primer) CAGACGTAGAAGCGGTCCC qPCR-PRV-gB-R (Reverse Primer) AGTCCCTCGAGGAGATCGAC

[0057] The results were as Figure 4 shown. Treatments with different concentrations of CHR-6494 could significantly inhibit the transcriptional levels of PRV gE and gB genes and the expression level of gB protein, and showed a dose-dependent manner.

[0058] Example 4

[0059] Investigation on the effects of CHR-6496 treatment on different stages of PRV infection

[0060] Investigation on the direct killing effect of CHR-6496 on PRV: 1) Place 1000 TCID50 of rPRVHuN-EGFP and CHR-6494 (200 nM) in a 1.5 mL centrifuge tube (treatment group), mix well and incubate in a 37°C incubator for 2 h; use the DMEM solution containing 1000 TCID50 of rPRVHuN-EGFP as the control group; 2) Infect 3D4 / 21 cells in a 6-well plate (density about 80%) with the two mixtures respectively. After 2 h, discard the supernatant, wash 3 times with PBS and then change to cell maintenance medium; 3) After 24 h, discard the supernatant, add an appropriate amount of PBS, and observe the proportion of EGFP-expressing cells in each group under a fluorescence microscope.

[0061] Effect of CHR-6496 on the stage of PRV adsorbing to cells: 1) Plate 3D4 / 21 cells in a 6-well plate and wait until the cell density reaches about 80%; 2) Discard the supernatant. Add the DMEM solution containing 200 nM CHR-6496 compound and 1000 TCID50 of rPRVHuN-EGFP to the experimental group cells; add an equal volume of DMEM solution and 1000 TCID50 of rPRVHuN-EGFP to the control group cells; 3) Place the cell plate in a 4°C refrigerator for 1 h for virus adsorption, discard the supernatant, wash 3 times with PBS and then add cell maintenance medium; 4) After 24 h, discard the supernatant, add an appropriate amount of PBS, and observe the proportion of EGFP-expressing cells in each group under a fluorescence microscope.

[0062] Effect of CHR-6496 on the cell entry stage of PRV: 1) Seed 3D4 / 21 cells in a 6-well plate and wait until the cell density reaches approximately 80%; 2) Add 1000 TCID50 of rPRVHuN-EGFP to the cell wells of the control group and the experimental group, and place them in a refrigerator at 4°C for 1 h for virus adsorption; 3) Discard the supernatant, wash 3 times with PBS, and then add cell maintenance medium containing 200 nM CHR-6496 compound (experimental group) and cell maintenance medium without the compound (control group), and place them in an incubator for 2 h for virus entry into the cells; 4) Discard the supernatant, wash 3 times with PBS solution, and add an appropriate amount of cell maintenance medium to each group; 5) After 24 h, discard the supernatant, add an appropriate amount of PBS solution, and observe the proportion of EGFP-expressing cells in each group under a fluorescence microscope.

[0063] Effect of CHR-6496 on the replication stage of PRV: 1) Seed 3D4 / 21 cells in a 6-well plate and perform subsequent experiments after the cell density reaches approximately 80%; 2) Add 1000 TCID50 of rPRVHuN-EGFP to the cell wells of the experimental group and the control group respectively, and place them in an incubator for 2 h for virus entry; 3) Discard the supernatant, wash 3 times with PBS, and then add cell maintenance medium containing 200 nM CHR-6496 compound (experimental group) and cell maintenance medium without the compound (control group), and culture them in an incubator for 24 h; 4) Discard the supernatant, add an appropriate amount of PBS solution, and observe the proportion of EGFP-expressing cells in each group under a fluorescence microscope.

[0064] The proliferation of rPRVHuN-EGFP strain in cells under each treatment method can be preliminarily evaluated by observing the proportion of EGFP-expressing cells. As Figure 5 shown, compared with the control group, adding CHR-6494 during the virus replication stage can effectively reduce the proportion of EGFP-expressing cells, while the difference in the proportion of EGFP-expressing cells in other treatment groups is relatively small. Therefore, this compound mainly exerts its antiviral infection effect by inhibiting the PRV replication stage.

[0065] In summary, taking 3D4 / 21 cells as an example, the embodiment of the present invention proves that the compound CHR-6494 can effectively inhibit the proliferation efficiency of PRV in host cells.

[0066] The content clarified in the above embodiments should be understood that these embodiments are only used to illustrate the present invention more clearly, rather than to limit the scope of the present invention. After reading the present invention, various equivalent forms of modification of the present embodiment by those skilled in the art fall within the scope defined by the appended claims of the present invention.

Claims

1. Use of CHR-6494 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and treating porcine pseudorabies, characterized in that, The structural formula of CHR-6494 is as follows: 。 2. The application according to claim 1, wherein The CHR-6494 or its pharmaceutically acceptable salt is added with a pharmaceutically acceptable carrier and / or excipient to form any pharmaceutically acceptable dosage form.

3. The application according to claim 2, characterized in that The dosage forms include powder for injection, capsules, tablets, and suspensions.

4. The application according to claim 1, wherein The CHR-6494 or its pharmaceutically acceptable salt prevents and treats porcine pseudorabies by inhibiting PRV replication.

Citation Information

Patent Citations

  • Colon cancer therapeutic agent and male hypogonadism therapeutic agent

    JP2021050185A