Chlorogenic acid synthesis key enzyme gene 4CL-27987 and its application

Abstract

This invention belongs to the field of biotechnology, specifically relating to the chlorogenic acid synthesis key enzyme gene 4CL-27987 and its applications. This invention discloses a novel chlorogenic acid synthesis key enzyme gene 4CL-27987, a gene expression cassette containing the chlorogenic acid synthesis key enzyme gene 4CL-27987, and a plant expression vector containing the chlorogenic acid synthesis key enzyme gene 4CL-27987. It was found that transgenic tobacco plants transformed with the chlorogenic acid synthesis key enzyme gene 4CL-27987 showed a 28%-102% increase in chlorogenic acid content. RT-qPCR comparison of gene expression levels between transgenic and non-transgenic tobacco plants revealed that the gene expression level of tobacco plants transformed with the target fragment of the chlorogenic acid synthesis key enzyme gene 4CL-27987 was significantly higher than that of non-transgenic tobacco.

Description

Technical Field

[0001] The present invention belongs to the technical field of biotechnology, and specifically relates to a key enzyme gene 4CL-27987 for chlorogenic acid synthesis and an application thereof. Background Art

[0002] Chlorogenic acid (CGA), also known as coffee tannic acid or coffee tannic acid, is a phenolic acid composed of caffeic acid and quinic acid. It is produced by plants through the shikimic acid pathway during aerobic respiration. It is widely present in plants, with the highest content in honeysuckle and eucommia bark. It has a wide range of pharmacological effects. Chlorogenic acid substances have biological activities such as antibacterial and anti-inflammatory, scavenging free radicals, and regulating blood sugar and blood lipids, and are widely used in many fields.

[0003] The chlorogenic acid content of sagebrush is high, and its medicinal value is high. The whole plant can be used as medicine. It is also easy to cultivate and plant, easy to reproduce, and widely distributed. It has unique advantages. Therefore, it is of great significance to study the key enzyme gene 4CL-27987 of chlorogenic acid in sagebrush. 4CL plays a key role in guiding carbon flow into different branch pathways of phenylpropanoid metabolism. 4CL can be divided into two major categories. The first category can participate in the formation of lignin and the synthesis of other phenylpropanoid derivatives. The second category may participate in the pathway leading to flavonoid biosynthesis. In 1987, Douglas et al. cloned the 4CL gene from parsley for the first time and analyzed its structure. Subsequently, Shen Guifang et al. cloned 4CL from rice and found that the rice 4CL gene contains 5 exons. In the coding region, the GC content of the coding sequence of the rice 4CL gene is high. At present, the 4CL gene has been cloned in many plants such as honeysuckle, sword-leaved dracaena, and wild rose, but it has not been reported in sagebrush.

[0004] For a long time, the research on chlorogenic acid from sambucus has mostly focused on the extraction process, with fewer studies on the molecular level of sambucus and almost no research on the key enzyme genes for chlorogenic acid synthesis in sambucus. Summary of the invention

[0005] In order to obtain a new gene that can increase the content of chlorogenic acid in plants, the present invention provides the following technical solutions:

[0006] A key enzyme gene for chlorogenic acid synthesis 4CL-27987, the nucleotide sequence of the key enzyme gene for chlorogenic acid synthesis 4CL-27987 is shown in SEQ ID NO:1.

[0007] A gene expression cassette contains the key enzyme gene 4CL-27987 for chlorogenic acid synthesis.

[0008] A plant expression vector contains a chlorogenic acid synthesis key enzyme gene 4CL-27987 or a gene expression box containing the chlorogenic acid synthesis key enzyme gene 4CL-27987.

[0009] A use of a chlorogenic acid synthesis key enzyme gene 4CL-27987 or a gene expression box containing the chlorogenic acid synthesis key enzyme gene 4CL-27987 or a plant expression vector containing the chlorogenic acid synthesis key enzyme gene 4CL-27987 in increasing the chlorogenic acid content in plants.

[0010] A chlorogenic acid synthesis key enzyme gene 4CL-27987 or a gene expression box containing the chlorogenic acid synthesis key enzyme gene 4CL-27987 or a plant expression vector containing the chlorogenic acid synthesis key enzyme gene 4CL-27987 is used in cultivating new plant varieties with high chlorogenic acid content.

[0011] Preferably, the plant is tobacco.

[0012] A method for increasing the chlorogenic acid content of plants, the method comprising: constructing an expression vector containing the chlorogenic acid synthesis key enzyme gene 4CL-27987 or a gene expression cassette containing the chlorogenic acid synthesis key enzyme gene 4CL-27987, transforming the plant expression cassette or the plant expression vector into plants, and screening and identifying.

[0013] Beneficial effects of the present invention:

[0014] The present invention discloses a novel chlorogenic acid synthesis key enzyme gene 4CL-27987, a gene expression cassette containing the chlorogenic acid synthesis key enzyme gene 4CL-27987, and a plant expression vector containing the chlorogenic acid synthesis key enzyme gene 4CL-27987. It is found that the chlorogenic acid content of the transgenic tobacco plant into which the chlorogenic acid synthesis key enzyme gene 4CL-27987 is transferred is increased by 28%-102%. By comparing the gene expression levels of the transgenic tobacco and the non-transgenic tobacco through RT-qPCR, it is found that the gene expression levels of the tobacco into which the target fragment of the chlorogenic acid synthesis key enzyme gene 4CL-27987 is transferred are significantly higher than those of the non-transgenic tobacco. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Colony PCR detection after transformation of Agrobacterium with pFGC5941-4CL-27987 vector;

[0016] Figure 2 This is a picture of genetically modified tobacco detection;

[0017] Figure 3 Chlorogenic acid content in GM and non-GM tobacco;

[0018] Figure 4Relative expression levels of 4CL-27987 gene in transgenic tobacco and non-transgenic tobacco. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] The nucleotide sequence of the key enzyme gene 4CL-27987 for chlorogenic acid synthesis of the present invention is as follows:

[0021] ATGAATGCGCTCATTGAGCATGAGGTTACGTTTGCACCAATTGTGCCCCGATTATTTTGGGGTTGGTGAAGGATCCAATTGTGAATGAGTTTGATTTGGGTAAGCTTAAGCTTAGGTCCATCATGACGGCCGCGGCTCCGCTTGCTCCGGAGATATTT AGTGAATTTGAGAAGAAGTTCCCCGGAGTCGATGTCCAAGAGGTGAGTTTGTGCTTAAATTTATTATTACTGGACGCCAAGCAACAATGTTTTGGCGCATTACCATGTAAGAAAATAAATTGTGTCCTCTTAGAATTACTCATAATTGTTATGTGA(SEQ ID NO:1).

[0022] Example 1

[0023] The pFGC5941-4CL-27987 overexpression vector was synthesized by Wuhan Jinkairui Bioengineering Co., Ltd., and pFGC5941-4CL-27987 was transferred into GV3101 Agrobacterium tumefaciens competent cells. The specific steps are as follows:

[0024] 1) Pipette 3 μL of pFGC5941-4CL-27987 recombinant plasmid and add it to a centrifuge tube containing 50 μL of Agrobacterium competent cells. Gently tap the bottom of the tube to mix well. Quickly place it on ice for 5 minutes, then freeze it in liquid nitrogen for 5 minutes, then place it in a 37°C water bath for 5 minutes, and then place it on ice for 5 minutes.

[0025] 2) In a clean bench, add 700 μL of LB liquid culture medium (without antibiotics) to the centrifuge tube containing the competent Agrobacterium and plasmid, place in a constant temperature incubator, and culture for 3 h at a temperature of 28°C and a rotation speed of 220 rpm.

[0026] 3) Use a pipette to draw 200 μL of the bacterial solution cultured for 3 hours into LB solid medium containing antibiotics (kanamycin, rifampicin, gentamicin), and spread it with a sterile spreader. After the spread is dry, seal the plate and place it upside down in a 28°C constant temperature incubator for 2 to 3 days.

[0027] 4) After multiple single colonies grow on the plate, pick a single colony and perform PCR detection. Figure 1 , Lane 1 is the PCR of the recombinant plasmid of pFGC5941-4CL-27987, and lanes 2-4 are the colony PCR after the pFGC5941-4CL-27987 vector was transformed into Agrobacterium.

[0028] PCR detection primers:

[0029] 35sF825:ATCCCACTATCCTTCGCAAGACCCTT(SEQ ID NO:2)

[0030] PolyAR: CTCAGGTTTTTTTACAACGTGCACAA (SEQ ID NO: 2)

[0031] The reaction system is as follows:

[0032]

[0033] The reaction procedure is as follows:

[0034]

[0035] Example 2 Transformation of tobacco

[0036] Pick the bacteria identified as positive by colony PCR, inoculate them in liquid LB medium containing rifampicin, gentamicin and kanamycin, and shake the bacteria at 28℃ and 220rpm for 36-48h. Take 0.5-1mL of activated Agrobacterium bacterial solution, dilute it into 25mL of LB liquid medium containing antibiotics, and culture it at 28℃ and 220rpm until the OD600 value is 0.35-0.45, centrifuge it at 3000g for 5min, discard the supernatant, pour in MS liquid containing 200uM AS, and culture it at 28℃ and 220rpm for 1-1.5h to obtain the impregnation solution. Remove the main veins of the tobacco leaves that have been cultured for about four weeks, cut them into pieces of about 0.8cm×0.8cm in size, and place them in a sterile triangular flask. Infect them with the prepared impregnation solution for 25-30min, and shake the triangular flask several times during the infection. After the impregnation is completed, place the leaves on a sterile filter paper to absorb the excess bacterial solution, and culture them on the co-culture medium for 48h. After the co-cultivation, wash the leaves with 500 mg / L cefotaxime for 10 minutes, place them on filter paper to absorb the liquid, and then culture them on a resistant seedling screening medium containing 5 mg / L glyphosate (PPT). When 2 cm resistant buds grow, cut off the resistant buds and inoculate them in a rooting medium for culture. When the tobacco root system is well developed, wash the culture medium on the roots, move them into a small pot filled with sterilized vermiculite, and culture them at 24°C. When the tobacco grows new leaves, cut the new leaves to extract DNA, and perform PCR on the DNA to detect tobacco with the key enzyme gene 4CL-2798 for chlorogenic acid synthesis and tobacco without the key enzyme gene 4CL-27987 for chlorogenic acid synthesis. The results are as follows: Figure 2 As shown, transgenic tobacco detection (lane 1 is a negative control with wild-type K326 DNA as template, lane 2 is a positive control, lane 3 is a negative control without template, and lanes 4-8 are transgenic tobacco identification)

[0037] Ultrasonic-assisted extraction was used to extract chlorogenic acid from transgenic tobacco and non-transgenic tobacco. It was found that the chlorogenic acid content of transgenic tobacco plants with the key enzyme gene 4CL-27987 for chlorogenic acid synthesis increased by 28%-102% ( Figure 3 ). By comparing the gene expression levels of transgenic tobacco and non-transgenic tobacco through RT-qPCR, it was found that the gene expression levels of tobacco transformed with the 4CL-27987 target fragment were significantly higher than those of non-transgenic tobacco ( Figure 4 ).

Claims

1. A chlorogenic acid synthesis key enzyme gene 4CL-27987, characterized in that: The nucleotide sequence of the key enzyme gene 4CL-27987 for chlorogenic acid synthesis is shown in SEQ ID NO:

1.

2. A gene expression cassette, characterized in that: The gene expression cassette contains the chlorogenic acid synthesis key enzyme gene 4CL-27987 according to claim 1.

3. A plant expression vector, characterized in that: The plant expression vector contains the chlorogenic acid synthesis key enzyme gene 4CL-27987 according to claim 1 or the gene expression cassette according to claim 2.

4. Use of the chlorogenic acid synthesis key enzyme gene 4CL-27987 according to claim 1, the gene expression cassette according to claim 2, or the plant expression vector according to claim 3 in increasing the chlorogenic acid content in tobacco.

5. Use of the chlorogenic acid synthesis key enzyme gene 4CL-27987 according to claim 1, the gene expression cassette according to claim 2, or the plant expression vector according to claim 3 in cultivating new tobacco varieties with high chlorogenic acid content.

6. A method for increasing the content of chlorogenic acid in tobacco, characterized in that: The method comprises: constructing the plant expression cassette of claim 2 or the plant expression vector of claim 3, transforming tobacco with the plant expression cassette or the plant expression vector, and screening and identifying.

Images