KASP Markers Related to the Length of the Lower Internode of Wheat Ears and Their Applications

By developing the KASP marker primer group FSI-6B, the genotype at the 610799456bp position of wheat 6B chromosome was detected, and the problem of controlling the length of the wheat ears was solved, and the wheat plant height and yield was improved.

CN116855626BActive Publication Date: 2025-06-10XUZHOU INST OF AGRI SCI IN JIANGSU XUHUAI DISTRICT (JIANGSU XUZHOU SWEETPOTATO CENT)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310839214.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-10
Publication Date
2025-06-10
Estimated Expiration
2043-07-10

AI Technical Summary

Technical Problem

The prior art is difficult to effectively control the length of the lower section of wheat ears, which affects the plant height and yield of wheat.

Method used

A KASP marker primer group FSI-6B was developed. Through PCR amplification and fluorescence signal scanning, the genotype of wheat 6B chromosome 6B can be detected, so as to determine the genotype of the length of the lower spike segment is AA, GG or AG.

Benefits of technology

Effective screening and selection of the length of the lower section of wheat ears is achieved, reasonable length of the lower section of wheat can be obtained, and the plant height and yield of wheat can be increased.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116855626B_ABST
    Figure CN116855626B_ABST
Patent Text Reader

Abstract

The present invention discloses a KASP marker related to the length of the internode below the wheat ear and its application in assisted breeding, belonging to the technical field of crop seed selection and cultivation. Among them, the KASP marker primer set FSI-6B includes the upstream primer F1 shown in SEQ ID NO:1, the upstream primer F2 shown in SEQ ID NO:2, and the downstream primer R shown in SEQ ID NO:3. The KASP marker primer set FSI-6B provided by the present invention can be used to detect the variation of base A or G at the position of 610799456 bp on chromosome 6B of wheat. The variation of base A or G at this position is significantly related to the internode below the wheat ear. When the genotype at this position in the wheat genome is GG, the wheat shows a long internode below the ear; when the genotype is AA, the wheat shows a short internode below the ear; when the genotype is AG, the length of the internode below the wheat ear is between the two.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a KASP marker and its application, specifically to a KASP marker related to the length of the internode below the spike of wheat and its application in assisted breeding, belonging to the technical field of crop seed selection and cultivation. Background Art

[0002] A reasonable plant type is the basis for high and stable yields of wheat. The internode below the spike accounts for about 30%-50% of the total stem length, connecting the spike, which is the organ for yield formation, and the flag leaf, which is an important carbon source synthesis organ, and is an important trait determining the plant height and even the plant type of wheat, and also plays an important role in yield formation. The rapid elongation period of the two internodes below the spike of the wheat stem is coordinated with the floret development. Excessive elongation of the two internodes below the spike results in a reduction in the assimilates allocated to the young spike, affecting the number of grains per spike. The length of the internode below the spike is also of great significance for the formation of wheat grain weight. In the middle and late stages of grain filling, due to the weakening of leaf photosynthesis, the soluble sugars stored in the wheat stem become an important carbon source for yield formation. Therefore, excavating the loci controlling the length of the internode below the spike of wheat and developing molecular markers are of great significance for the establishment of a reasonable internode length below the spike and the breeding of high-yield varieties during the breeding process. Summary of the Invention

[0003] The purpose of the present invention is to provide a KASP marker related to the length of the internode below the spike of wheat, and the application of this KASP marker in assisting to obtain excellent plant lines with a reasonable length of the internode below the spike.

[0004] To achieve the above object, the present invention adopts the following technical solutions:

[0005] A KASP marker primer set FSI-6B, the KASP marker primer set FSI-6B includes an upstream primer F1, an upstream primer F2 and a downstream primer R. Among them, the sequence of the upstream primer F1 is as shown in SEQ ID NO:1, the sequence of the upstream primer F2 is as shown in SEQ ID NO:2, and the sequence of the downstream primer R is as shown in SEQ ID NO:3.

[0006] A method for breeding excellent wheat plant lines with a reasonable length of the internode below the spike by using the aforementioned KASP marker primer set FSI-6B, which is characterized by including the following steps:

[0007] Step 1: Extract the genomic DNA of the wheat variety or line to be tested;

[0008] Step 2: Using the genomic DNA of the wheat variety or line to be tested as a template, perform PCR amplification with the upstream primer F1 shown in SEQ ID NO:1, the upstream primer F2 shown in SEQ ID NO:2 and the downstream primer R shown in SEQ ID NO:3 to obtain a PCR amplification product;

[0009] Step 3: Perform fluorescence signal scanning on the obtained PCR amplification product, and determine whether the genotype at the 610799456 bp position of the 6B chromosome of the wheat to be tested is AA, GG or AG according to the obtained fluorescence signal. Specifically:

[0010] (i) If the fluorescence signal data of the PCR amplification product shows blue after being analyzed by the KlusterCaller TM software, the genotype of the wheat to be tested is AA, showing a short lower internode;

[0011] (ii) If the fluorescence signal data of the PCR amplification product shows red after being analyzed by the KlusterCaller TM software, the genotype of the wheat to be tested is GG, showing a long lower internode;

[0012] (iii) If the fluorescence signal data of the PCR amplification product shows green after being analyzed by the KlusterCaller TM software, the genotype of the wheat to be tested is AG, and the length of the lower internode is of an intermediate type.

[0013] Preferably, in Step 2, when performing PCR amplification, the PCR amplification reaction system specifically includes:

[0014] 2.5 μL of DNA template with a concentration of 50 - 80 ng / μL;

[0015] 2.5 μL of 2×KASP Mastermix;

[0016] 0.07 μL of KASP Assay mix;

[0017] Among them, KASP Assay mix is prepared by mixing the upstream primer F1 with a concentration of 100 μM, the upstream primer F2 with a concentration of 100 μM, the downstream primer R with a concentration of 100 μM and sterile water in a volume ratio of 6:6:15:23.

[0018] Preferably, in Step 2, when performing PCR amplification, the PCR amplification reaction program is specifically as follows:

[0019] Pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing and extension at 61°C for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, 30 cycles, and incubation at 10°C.

[0020] Preferably, in Step 3, use the KlusterCaller TM software to analyze the fluorescence signal of the collected PCR amplification product.

[0021] The advantages of the present invention are as follows: The present invention provides a KASP marker primer set FSI-6B, which can be used to detect the variation of base A or G at the position of 610799456 bp (IWGSC RefSeq v1.0) on chromosome 6B of wheat. The variation of base A or G at this position is significantly correlated with the length of the internode below the spike of wheat. When the genotype at this position in the wheat genome is GG, the wheat shows a long internode below the spike; when the genotype at this position in the wheat genome is AA, the wheat shows a short internode below the spike; when the genotype at this position in the wheat genome is AG, the length of the internode below the spike of wheat is between the two. Brief Description of the Drawings

[0022] Figure 1 It is a KASP marker genotype typing map. Detailed Embodiments

[0023] The present invention will be specifically introduced below in conjunction with the drawings and specific embodiments.

[0024] I. Discovery of SNP Loci Related to the Length of the Internode below the Spike of Wheat

[0025] Collect the main cultivated varieties (a total of 132) in the Huanghuai wheat region in the past 30 years, and extract the genomic DNA of this population using the plant genomic DNA extraction kit produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0026] Use the wheat 55K SNP chip to perform genotype scanning on 132 natural populations collected in the Huanghuai wheat region. At the same time, count the phenotypic data of the length of the internode below the spike of this population in 2021 and 2022.

[0027] The genotype analysis results of 132 natural populations in the Huanghuai wheat region and the corresponding lengths of the internodes below the spike are shown in Table 1.

[0028] Table 1 Genotype Analysis Results and Corresponding Phenotypes of 132 Natural Populations in the Huanghuai Wheat Region

[0029]

[0030]

[0031]

[0032]

[0033]

[0034] The genotypes of this population were combined with the phenotypes of the internode lengths below the spike in 2021 and 2022, and MLM analysis was carried out using Tassel5 software. The analysis results showed that the base variations of A or G in the AX-110539376 marker were extremely significantly correlated with the internode lengths below the spike in two environments, and the P-value was 2.5×10 -7 , and the phenotypic contribution rate was 21.6%.

[0035] Furthermore, the average values of the internode lengths below the spike of wheat with AA genotype, GG genotype, and AG genotype were obtained, and the genotyping and corresponding phenotypic statistical results are shown in Table 2.

[0036] Table 2 Genotyping and corresponding phenotypic statistical results of 132 natural populations in the Huanghuai wheat region

[0037] Genotype Average value of the internode below the ear (cm) Standard deviation AA 22.7 3.8 GG 27.3 3.5 AG 25.5 4.5

[0038] The results showed that wheat varieties (lines) with AA genotype showed short internodes below the spike; wheat varieties (lines) with GG genotype showed long internodes below the spike, and wheat varieties (lines) with AG genotype had intermediate internode lengths below the spike.

[0039] By aligning with the reference genome sequence (IWGSC RefSeq v1.0), it was determined that the base variations of A and G in the AX-110539376 marker were located at the position of 610799456 bp on chromosome 6B of wheat.

[0040] II. Design and development of the KASP marker primer set FSI-6B

[0041] The base variations of A or G at the position of 610799456 bp on chromosome 6B of wheat (IWGSC RefSeq v1.0) were converted into the KASP marker primer set FSI-6B. Using this KASP marker primer set FSI-6B, it was possible to distinguish whether the base at this position was A or G.

[0042] Specifically, this KASP marker primer set FSI-6B includes upstream primer F1, upstream primer F2, and downstream primer R, where:

[0043] (1) The sequence of upstream primer F1 (SEQ ID NO:1) is: 5’- GAAGGTGACCAAGTTCATGCT AGGAGGGCCAGGGCGTCA-3’

[0044] The underlined part is the fluorescence group FAM tag sequence.

[0045] (2) The sequence of upstream primer F2 (SEQ ID NO:2) is: 5’- GAAGGTCGGAGTCAACGGATT AGGAGGGCCAGGGCGTCG-3’

[0046] The underlined part is the fluorescent group HEX tag sequence.

[0047] (3) The sequence of the downstream primer R (SEQ ID NO: 3) is: ACCGCATCAAGCCCCAACA.

[0048] The upstream primer F1, the upstream primer F2 and the downstream primer R were all synthesized by Invitrogen Biotechnology Co., Ltd. Shanghai.

[0049] III. Genotyping the genotype at the 610799456bp position of wheat chromosome 6B using the KASP marker primer set FSI-6B

[0050] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was carried out using the KASP marker primer set FSI-6B. The obtained PCR amplification products were subjected to fluorescence signal scanning, and the genotype at the 610799456bp position of the wheat chromosome 6B to be tested was judged as AA, GG or AG according to the obtained fluorescence signals. No DNA template was added to the control.

[0051] (1) PCR amplification reaction system

[0052] Reagent Dosage DNA template (concentration 50 - 80 ng / μL) 2.5 μL 2×KASP Master mix 2.5 μL KASP Assay mix 0.07 μL

[0053] Among them:

[0054] The 2×KASP Master mix was purchased from Agrigenomics Technology (Shanghai) Co., Ltd. (product number KBS-1016-001), and it contains: fluorescent probe A, fluorescent probe B, quenching probe A, quenching probe B, high-fidelity Taq enzyme, and dNTP. Among them, fluorescent probe A consists of the sequence shown in SEQ ID NO:4 (5′-GAAGGTGACCAAGTTCATGCT-3′) and one fluorescent group FAM, and this fluorescent group FAM is connected to the 5′ end of the sequence shown in SEQ ID NO:4; fluorescent probe B consists of the sequence shown in SEQ ID NO:5 (5′-GAAGGTCGGAGTCAACGGATT-3′) and one fluorescent group HEX, and this fluorescent group HEX is connected to the 5′ end of the sequence shown in SEQ ID NO:5; quenching probe A consists of the sequence shown in SEQ ID NO:6 (5′-AGCATGAACTTGGTCACCTTC-3′) and one quenching group BHQ, and this quenching group BHQ is connected to the 3′ end of the sequence shown in SEQ ID NO:6; quenching probe B consists of the sequence shown in SEQ ID NO:7 (5′-AATCCGTTGACTCCGACCTTC-3′) and one quenching group BHQ, and this quenching group BHQ is connected to the 3′ end of the sequence shown in SEQ ID NO:7.

[0055] The KASP Assay mix is composed of upstream primer F1 with a concentration of 100 μM, upstream primer F2 with a concentration of 100 μM, downstream primer R with a concentration of 100 μM, and sterile water mixed in a volume ratio of 6:6:15:23.

[0056] (2) PCR amplification reaction program

[0057] The specific PCR amplification reaction program is as follows:

[0058] Pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing and extension at 61°C for 40 s, 10 cycles, and the annealing and extension temperature decreases by 0.6°C for each cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, 30 cycles, and incubation at 10°C.

[0059] (3) Fluorescent signal scanning

[0060] Using KlusterCaller TM software, collect the fluorescent signals of the PCR amplification products of the wheat to be tested, and judge the genotype of the wheat to be tested according to the fluorescent signals ( Figure 1 ), specifically:

[0061] (i) If the fluorescent signal data of the PCR amplification products of the wheat to be tested are processed by KlusterCallerTM If the software analysis shows blue, the genotype of the wheat to be tested is AA (showing short internode below the spike);

[0062] (ii) If the fluorescence signal data of the PCR amplification product of the wheat to be tested is analyzed by KlusterCaller TM and shows red, the genotype of the wheat to be tested is GG (showing long internode below the spike);

[0063] (iii) If the fluorescence signal data of the PCR amplification product of the wheat to be tested is analyzed by KlusterCaller TM and shows green, the genotype of the wheat to be tested is AG (the internode length below the spike is of intermediate type).

[0064] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, rather than limitations on the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to enumerate all the implementation manners here. Any obvious changes or modifications derived from the technical solution of the present invention still fall within the protection scope of the present invention.

Claims

1. Method for breeding excellent wheat lines with reasonable length of the internode below the ear using the KASP marker primer set FSI-6B, characterized in that, the KASP marker primer set FSI-6B includes upstream primer F1, upstream primer F2 and downstream primer R. The sequence of upstream primer F1 is as shown in SEQ ID NO: 1, the sequence of upstream primer F2 is as shown in SEQ ID NO: 2, and the sequence of downstream primer R is as shown in SEQ ID NO:

3. The method for breeding excellent wheat lines with reasonable length of the internode below the ear using the KASP marker primer set FSI-6B specifically includes the following steps: Step 1: Extract the genomic DNA of the wheat variety or line to be tested; Step 2: Using the genomic DNA of the wheat variety or line to be tested as a template, perform PCR amplification with upstream primer F1, upstream primer F2 and downstream primer R to obtain a PCR amplification product; Step 3: Perform fluorescence signal scanning on the obtained PCR amplification product, and judge whether the genotype at the 610799456bp position of chromosome 6B of the wheat to be tested is AA, GG or AG according to the obtained fluorescence signal. This position is determined by alignment with the reference genome sequence IWGSCRefSeq v1.

0. Specifically: (i)If the fluorescence signal data of the PCR amplification product shows blue after analysis by the KlusterCaller TM software, the genotype of the wheat to be tested is AA, showing short rachis internodes; (ii)If the fluorescence signal data of the PCR amplification product shows red after analysis by the KlusterCaller TM software, the genotype of the wheat to be tested is GG, showing long rachis lower node; (iii)If the fluorescence signal data of the PCR amplification product shows green after being analyzed by KlusterCaller TM software, the genotype of the wheat to be tested is AG, and the length of the internode below the ear is of the intermediate type.

2. The method according to claim 1, characterized in that, in Step 2, when performing PCR amplification, the PCR amplification reaction system specifically includes: 2.5 μL of DNA template with a concentration of 50 - 80 ng / μL; 2.5 μL of 2×KASP Master mix; 0.07 μL of KASP Assay mix; wherein, KASP Assay mix is composed of upstream primer F1 with a concentration of 100 μM, upstream primer F2 with a concentration of 100 μM, downstream primer R with a concentration of 100 μM and sterile water mixed in a volume ratio of 6:6:15:

23.

3. The method according to claim 1, characterized in that, in Step 2, when performing PCR amplification, the PCR amplification reaction procedure is specifically as follows: Pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s, annealing and extension at 61°C for 40 s, cycle 10 times, and the annealing and extension temperature decreases by 0.6°C each time; denaturation at 95°C for 20 s, annealing and extension at 55°C for 40 s, cycle 30 times, and hold at 10°C.

4. The method according to claim 1, characterized in that, In step 3, the KlusterCaller TM software is used to analyze the fluorescence patterns of the collected PCR amplification products.