Methods for establishing a Rag2 gene-edited immunodeficient dog model

By targeting the mutant canine Rag2 gene using gene editing technology, the limitations of Rag2 gene-deficient mouse models in immunodeficiency disease research have been overcome. A heritable and phenotypically stable Rag2 gene-edited immunodeficient canine model has been established, which is suitable for tumor models and the development of drugs for immune diseases.

CN116868959BActive Publication Date: 2026-04-03BEIJING SINOYIN BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-09
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing Rag2 gene-deficient mouse models have limitations in simulating human biological and clinical conditions, making it difficult to meet the long-term translational research needs of immunodeficiency diseases, especially due to limitations in application caused by small size, short lifespan, and differences in the immune system.

Method used

Using gene editing technology, such as BE3 single-base editing, CRISPR, TALEN, and ZFN, exon 2 of the mutant canine Rag2 gene is targeted to obtain canine zygotes or somatic cells with reduced or absent Rag2 gene expression, thus preparing Rag2 gene-edited immunodeficient dog models.

Benefits of technology

A heritable and phenotypically stable Rag2 gene-edited immunodeficient canine model was obtained, which is suitable for tumor model construction and screening and evaluation of drugs for immune diseases. It overcomes the application limitations of mouse models and provides a research platform that is closer to the human immune system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004284009680000051
    Figure BDA0004284009680000051
  • Figure BDA0004284009680000061
    Figure BDA0004284009680000061
  • Figure BDA0004284009680000071
    Figure BDA0004284009680000071
Patent Text Reader

Abstract

This invention relates to a method for establishing a Rag2 gene-edited immunodeficient canine model. The method involves obtaining canine zygotes or canine somatic cells with reduced or absent Rag2 gene expression using gene editing technology. The method of this invention yields a heritable and phenotypically stable Rag2 gene-edited immunodeficient canine model, which has considerable application potential in future tumor model development, evaluation of the efficacy of drugs for immune diseases, and other fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for establishing a Rag2 gene-edited immunodeficient canine model using gene editing technology. Background Technology

[0002] Omenn syndrome (OS) is a rare immunodeficiency disease, belonging to the category of severe combined immune deficiency (SCID). It is primarily caused by mutations in the Rag1 or Rag2 genes, leading to abnormalities in part of the V(D)J recombination process. The disease is characterized by severe early-onset erythroderma, intestinal inflammation, and extensive tissue infiltration of activated T cells. Recent studies have found that OS mouse models exhibit impaired epidermal barrier function, dysbiosis of the skin microbiota, and increased skin infiltration of activated T cells. Induced intestinal inflammation in mice can exacerbate skin inflammation. Furthermore, enhanced skin homing phenotype of T cells can also be observed in OS patients. The clinical manifestations of Omenn syndrome are quite distinctive, with early symptoms including erythroderma with epidermal peeling, chronic diarrhea, lymphadenopathy, hepatosplenomegaly, and recurrent severe infections. Laboratory tests show very few or no B lymphocytes in the peripheral blood of affected children, increased eosinophils, and elevated serum IgE levels.

[0003] Rag2 gene-deficient mice lack T and B cells in their spleen, thymus, and peripheral blood, but appear normally developed. Because they cannot produce T and B lymphocytes, they cannot reject cells of their own origin, making them suitable as vectors for models of xenografts, stem cells, and specific infections, thus meeting some basic research needs. However, due to several genetic differences between mice and humans, such as small size, short lifespan, and innate and acquired immunity, mouse models have significant limitations in simulating human biological and clinical conditions, hindering long-term evaluation of translational research outcomes.

[0004] Therefore, considering the high similarity between dogs and humans in terms of immune system structure and immune response process, it is suggested that dogs have great potential development value as large animal experimental models for the development of immunization and related drug treatments. Obtaining heritable and phenotypically stable gene-edited immunodeficient dog models has considerable application and translation prospects.

[0005] Therefore, there is an urgent need to construct a Rag2 gene-edited immunodeficiency model dog to provide a high-quality animal model for the study of immunodeficiency diseases. Summary of the Invention

[0006] This invention provides a method for establishing a Rag2 gene-edited immunodeficient canine model using gene editing technology, thereby obtaining a heritable and phenotypically stable Rag2 gene-edited immunodeficient canine model.

[0007] One aspect of the present invention provides a method for establishing a Rag2 gene-edited immunodeficient canine model, the method comprising using gene editing technology to obtain canine fertilized eggs or canine somatic cells with reduced or absent Rag2 gene expression.

[0008] In some embodiments, the gene editing technology is selected from BE3 single-base editing technology, CRISPR, TALEN, and ZFN, preferably CRISPR / Cas9.

[0009] In some embodiments, the method includes targeted mutation of exon 2 of the Rag2 gene, preferably including nucleotide insertion, substitution or deletion.

[0010] In some embodiments, the method includes the following steps:

[0011] (1) Determine the target site based on the sequence of exon 2 of the canine Rag2 gene;

[0012] (2) Synthesize sgRNA sequences according to the target sites determined in step (1), and then connect the synthesized sequences with the backbone vector to construct sgRNA target vectors.

[0013] (3) In vitro transcription products of sgRNA and CRISPR / Cas9 were obtained by in vitro transcription;

[0014] (4) Introduce the sgRNA and CRISPR / Cas9 in vitro transcription products obtained in step (3) into canine zygotes or canine somatic cells to obtain canine zygotes or canine somatic cells with reduced or absent Rag2 gene expression.

[0015] In some implementations, in step (1), three sgRNAs are determined based on the sequence of exon 2 of the canine Rag2 gene.

[0016] Preferably, the sequence of the sgRNA and its complementary sequence include the following sequences:

[0017] sgRNA1: GGTAACAGTCAGTAATAACGTGG (SEQ ID NO: 2),

[0018] The complementary sequence of sgRNA1 is: CCACGTTATTACTGACTGTTACC (SEQ ID NO:3).

[0019] sgRNA2: GTGGCCGGGTAACGAAGAGGAGG (SEQ ID NO: 4),

[0020] The complementary sequence of sgRNA2 is: CCTCCTCTTCGTTACCCGGCCAC (SEQ ID NO:5).

[0021] sgRNA3: CCGGCCACTTGCATATTCAGAGG (SEQ ID NO: 6),

[0022] The complementary sequence of sgRNA3 is: CCTCTGAATATGCAAGTGGCCGG (SEQ ID NO:7).

[0023] In some embodiments, the method further includes transplanting canine zygotes with reduced or absent Rag2 gene expression into the oviduct of a recipient female dog to create a Rag2 gene-edited immunodeficient model dog.

[0024] In other embodiments, the method further includes transplanting the nucleus of a canine somatic cell with reduced or absent Rag2 gene expression into a canine enucleated oocyte, and then transplanting the enucleated canine oocyte after nuclear transfer into the fallopian tube of a recipient female dog, thereby preparing a Rag2 gene-edited immunodeficient dog model.

[0025] In some embodiments, the canine somatic cells are derived from tissues or organs such as fetal tissue, skin, muscle, ear, mammary gland, fallopian tube, ovary, blood, urine, fat, bone marrow, blood vessels, and luminal endothelium.

[0026] In some embodiments, the canine somatic cells are selected from fetal fibroblasts, skin cells, epithelial cells, ear cells, fibroblasts, endothelial cells, muscle cells, mammary gland cells, fallopian tube cells, ovarian cells, cumulus cells, nerve cells, and osteoblasts.

[0027] In some embodiments, the genome of the Rag2 gene-edited immunodeficient model dog contains a nucleotide sequence as shown in SEQ ID NO:10.

[0028] In some embodiments, Rag2 protein expression is absent in the Rag2 gene-edited immunodeficient model dogs.

[0029] In some embodiments, the Rag2 gene-edited immunodeficient dog model has the amino acid sequence shown in SEQ ID NO:11.

[0030] In some implementations, the backbone vectors used may include gene vectors such as lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and non-viral vectors, in addition to eukaryotic vectors.

[0031] In some embodiments, the present invention utilizes gene editing technology to select target site sequences based on the exons of the canine Rag2 gene sequence, and constructs sgRNA targeting vectors and CRISPR / Cas9 expression vectors based on the target site sequences. After the vectors are verified to be effective, they are transcribed into mRNA in vitro, and then the mRNA is injected into canine zygotes by cytosolic injection. The canine zygotes are then transplanted into one fallopian tube of a female dog whose fallopian tubes have both been flushed, thereby preparing a Rag2 gene-edited immunodeficient dog model.

[0032] Another aspect of the present invention also provides canine somatic cells, tissues, or organs of Rag2 gene-edited immunodeficient dogs obtained by the aforementioned establishment method.

[0033] In some embodiments, the canine somatic cells, tissues, or organs of the Rag2 gene-edited immunodeficient model dog contain a nucleotide sequence as shown in SEQ ID NO:10.

[0034] In some embodiments, Rag protein expression is absent in canine somatic cells, tissues, or organs of the Rag2 gene-edited immunodeficient model dogs.

[0035] In some embodiments, the canine somatic cells, tissues, or organs of the Rag2 gene-edited immunodeficient model dog have an amino acid sequence as shown in SEQ ID NO:11.

[0036] Another aspect of the present invention provides canine somatic cells of a Rag2 gene-edited immunodeficient model dog, wherein the Rag protein expression is absent in the canine somatic cells, and / or the genome contains a nucleotide sequence as shown in SEQ ID NO:10.

[0037] Another aspect of the present invention provides a targeting vector for editing the canine Rag2 gene, the targeting vector comprising an sgRNA sequence designed for a targeting site sequence determined by exon 2 of the canine Rag2 gene and a backbone vector;

[0038] Preferably, the sgRNA and its complementary sequence include the following sequences:

[0039] sgRNA1: GGTAACAGTCAGTAATAACGTGG (SEQ ID NO: 2),

[0040] The complementary sequence of sgRNA1 is: CCACGTTATTACTGACTGTTACC (SEQ ID NO:3).

[0041] sgRNA2: GTGGCCGGGTAACGAAGAGGAGG (SEQ ID NO: 4),

[0042] The complementary sequence of sgRNA2 is: CCTCCTCTTCGTTACCCGGCCAC (SEQ ID NO:5).

[0043] sgRNA3: CCGGCCACTTGCATATTCAGAGG (SEQ ID NO: 6),

[0044] The complementary sequence of sgRNA3 is: CCTCTGAATATGCAAGTGGCCGG (SEQ ID NO:7).

[0045] Another aspect of the present invention provides a cell comprising the targeting carrier.

[0046] In some implementations, the cells cannot develop into animals.

[0047] Another aspect of the present invention provides a primer pair comprising the following sequences:

[0048] Forward primer: GCTCTTTGCTTACCTGACTGCC (SEQ ID NO:8),

[0049] Reverse primer: TGGCAAGTGAATGTCCTCCTAAGA (SEQ ID NO:9).

[0050] Another aspect of the invention provides the use of the primer pair in detecting a Rag2 gene-edited immunodeficient model dog containing a genomic sequence shown in SEQ ID NO:10.

[0051] Another aspect of the present invention provides the application of the Rag2 gene-edited immunodeficient canine model obtained by the method in the construction of tumor models, screening and / or evaluation of drugs for immune diseases.

[0052] Recombination-activating genes (Rags) play a crucial role in V(D)J recombination. The rearrangement and recombination of immunoglobulin (Ig) genes and T cell receptor (TCR) genes during V(D)J recombination are essential stages in the maturation of B cells and T lymphocytes. The RAG2 protein, encoded by the recombination-activating gene Rag2, initiates V(D)J recombination by recognizing Ig or TCR genes and binding to the recombination signal sequence (RSS) in gene fragments during the development of pre-mature T cells into mature T cells and pre-mature B cells into mature B cells. Rag2 is indispensable in lymphocyte V(D)J recombination; the absence of either Rag2 or Rag2 will lead to the interruption of T and B lymphocyte development, resulting in the inability to produce mature T and B lymphocytes and causing symptoms similar to severe combined immunodeficiency (SCID).

[0053] Based on the high similarity between dogs and humans in terms of immune system structure and immune response processes, dogs have great potential value as large animal experimental models for the development of immunotherapies and related drug treatments. This invention has obtained a heritable and phenotypically stable Rag2 gene-edited immunodeficient canine model. Rag2 is essential for TCR and Ig gene recombination; gene deletion leads to the inability of T cells and B cells to differentiate normally, making it very suitable for allogeneic and xenogeneic tumor transplantation, especially for transplanting slow-growing, primary, and hematopoietic cancer cells. It has considerable application and translational prospects in future tumor model development and evaluation of the efficacy of immune-related drugs. Attached Figure Description

[0054] Figure 1 The PCR identification results of puppies numbered 220511–220522 are shown. The sampling order is as follows: DL2000 Marker, 220511E, 220511T, 220512E, 220512T, 220513E, 220513T, 220514E, 220514T, 220515E, 220515T, Negative Control (Water), DL2000 Marker, 220516E, 220516T, Negative Control (Water), DL2000 Marker, 220517E, 220517T, 220518E, 220518T, 220519E, 220519T, Negative Control (Water), DL2000 Marker, 220520E, 220520T, 220521E, 220521T, 220522E, 220522T, negative control (water), where E represents ear tissue and T represents tail tissue.

[0055] Figure 2The results of the nucleic acid sequence alignment analysis between puppy number 220516 and the wild type are shown.

[0056] Figure 3 The results of the amino acid sequence alignment analysis between puppy number 220516 and the wild type are shown.

[0057] Figure 4 The comparison of the white pulp region of the spleen between puppy number 220516 and wild-type dog is shown. The black arrow indicates the central artery (CA) of the spleen, WP is the white pulp region, and PLS is the periarterial lymphatic sheath. Detailed Implementation

[0058] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0059] Example 1

[0060] 1. Construction and identification of the target carrier

[0061] Based on the canine Rag2 gene (NC_051822.1) sequence information in Genbank, the target site (SEQ ID NO:1) of exon 2 of the Rag2 gene was determined.

[0062] Three sgRNAs were designed for this target site, and the specific sgRNA sequences are shown in Table 1 below.

[0063] Table 1

[0064]

[0065]

[0066] The vector plasmid px330 was linearized by digestion with BBSI, followed by 1% agarose gel electrophoresis, gel extraction, and concentration determination. Ligation was performed overnight at 16°C using T4 DNA ligase at a molar ratio of 1:3 between the linearized vector and the Rag2 gene-targeting sgRNA. The ligation product was transformed into ampicillin-resistant LB agar plates for screening. Positive clones were identified by colony PCR and inoculated into culture. Plasmids were extracted using a plasmid miniprep kit. 5 μL of the recombinant plasmid was sequenced, and the sequencing results were analyzed and compared using Snapgene. Plasmids with correct sequencing results were stored for later use.

[0067] 2. In vitro transcription

[0068] First, the CRISPR / Cas9 plasmid was linearized using the following reaction system: 30 μg plasmid, 5 μL restriction endonuclease AflII, 10 μL 10× Buffer, and ddH2O, for a total volume of 100 μL. Then, 100 μL of phenol:imex:isoamyl alcohol (25:24:1) was added to purify the linearized plasmid DNA, and the mixture was centrifuged at 12000g for 5 min. 50 μL of the supernatant was transferred to a RNase-free 1.5 ml centrifuge tube, and 1 / 10 volume of sodium acetate and 3 volumes of anhydrous ethanol were added to precipitate the plasmid DNA. The mixture was centrifuged at 12000g for 5 min. The supernatant was discarded, and any remaining supernatant was removed. The plasmid was washed with 150 μL of 70% ethanol and centrifuged at 12000g for 5 min. The plasmid was air-dried for 3-5 min, and the DNA was dissolved in 15 μL of RNase-free ddH2O to determine its concentration.

[0069] In vitro transcription was performed using an in vitro transcription mRNA kit (Thermo Scientific).

[0070] The in vitro transcription system consisted of 1 μg linearized plasmid DNA, 10 μL of 2×NTP / CAP, 2 μL of 10×Buffer, 2 μL of RNA synthetase and ddH2O, for a total volume of 20 μL. After mixing, the mixture was incubated at 37°C for 1 hour. Then, 1 μL of TURBO DNase was added to digest the plasmid template, and the mixture was incubated at 37°C for 30 minutes. Next, 20 μL of the in vitro transcription product, 20 μL of 10×Reaction Buffer, 10 μL of ATP (10 mM), 2.5 μL of RNA inhibitor, 2 μL of Poly(A) polymerase, and nuclease-free ddH2O were mixed to prepare a 100 μL in vitro transcribed mRNA plus polyA system, which was incubated at 37°C for 1 hour. After incubation, add 350 μL of binding buffer to the reaction system and mix by pipetting; then add 250 μL of anhydrous ethanol and mix well; transfer the sample to an mRNA purification column and centrifuge at 10000g at room temperature for 1 min; discard the filtrate, reassemble the column, rinse the column with 500 μL of elution buffer, and centrifuge at 10000g at room temperature for 1 min; repeat the rinsing once, discard the filtrate, and centrifuge the empty column for 1 min to elute proteins and other impurities; then place the column in a new centrifuge tube, add 50 μL of RNA elution buffer to the center of the column, cap it, incubate at 65℃ for 10 min, and centrifuge at 10000g at room temperature for 1 min; detect RNA quality and concentration.

[0071] The CRISPR sgRNA and Cas9 mRNA were mixed to a final concentration of 50 ng / μL for sgRNA and 200 ng / μL for Cas9, and stored at -80°C for cytosolic injection.

[0072] 3. Cytoplasmic injection and embryo transfer and identification

[0073] Cas9 mRNA and 3 sgRNAs were mixed in a 2:1 ratio and injected into the cytoplasm of canine zygotes. A total of 5 embryo transfers were performed, with 32 embryos transferred to 5 recipients. A total of 12 puppies were born, and 1 dog was gene-edited positive (see Table 2 for details).

[0074] The specific procedures included: using five naturally estrus beagle bitches as donors of fertilized eggs and recipients of embryo transfer. Blood samples were collected from all bitches to measure serum progesterone levels. Ovulation was determined when progesterone levels reached 4-7 ng / mL. Natural mating occurred 48 hours after ovulation, and fertilized embryos were collected. A total of 32 fertilized eggs were obtained from the five bitches. After collection, cumulus granulosa cells were removed using TCM199 medium containing 0.1% hyaluronidase. The eggs were then placed in HEPES-buffered TCM199 medium (HM, GIBCO 11150) droplets and placed under an inverted microscope equipped with a micromanipulator. A mixture containing a 4:1 volume ratio of the prepared sgRNA mRNA and Cas9 mRNA was aspirated using a microinjection needle and injected into the cytoplasm of the fertilized eggs. The oviducts were flushed with 10 mL of HEPES-buffered TCM199 medium (HM, GIBCO 11150) containing 10% fetal bovine serum. The flushing fluid was collected in a 10 mL centrifuge tube from the injection needle ligated at the fimbriae. After cytosolic injection, the embryos were loaded into embryo transfer tubes, and the embryos in the transfer tubes were injected from the fimbriae into the oviduct on the side with less bleeding during flushing. A total of 12 puppies were eventually born.

[0075] Table 2. Results of cytosolic injection and embryo transfer

[0076]

[0077]

[0078] Genomes were extracted from ear (E) and tail (T) tissues of newborn puppies (see the steps of Zhiang Biotechnology's Tissue DNA Magnetic Bead Nucleic Acid Extraction Kit). Primer sequences specifically targeting exon 2 of the Rag2 gene were designed and PCR amplification was performed.

[0079] Canine genomic DNA was used as a template for PCR and PCR product sequencing identification. The primer pairs for genotype identification were:

[0080] RAG2JDF (forward primer): GCTCTTTGCTTACCTGACTGCC (SEQ ID NO:8),

[0081] RAG2JDR (reverse primer): TGGCAAGTGAATGTCCTCCTAAGA (SEQ ID NO:9).

[0082] PCR reaction system (30μL): forward primer 1μL, reverse primer 1μL, KODone enzyme 15μL, ddH2O 12μL, template 1μL.

[0083] The PCR reaction conditions were: 95℃ for 3 min, (95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s) for 30 cycles; 72℃ for 3 min; and stored at 4℃.

[0084] The PCR products were gel-purified and recovered, ligated into a T-vector, and transformed into *E. coli*. Fifteen colonies were picked from each plate for sequencing. The sequencing results were compared with wild-type sequences to analyze the monoclonal gene mutations.

[0085] The test results showed that the puppy sample numbered 220516 had a large missing segment. Figure 1 (as shown in the middle of the diagram), the detection results of the remaining samples are consistent with the expected target band size. Figure 1 Further sequencing and sequence alignment revealed the nucleic acid sequence of puppy number 220516 as shown in SEQ ID NO:10, and the corresponding amino acid sequence as shown in SEQ ID NO:11. The nucleic acid sequence alignment results are as follows: Figure 2 As shown, the amino acid sequence alignment results are as follows: Figure 3 As shown, premature termination of amino acid translation results in protein deletion. The wild-type amino acid sequence is shown in SEQ ID NO:12.

[0086] Phenotypic analysis of 4Rag2 gene-edited dogs

[0087] Phenotypic analysis was performed on the Rag2 gene-edited dogs obtained above.

[0088] Prepare paraffin sections of the tissue. Spleens from wild-type dogs and Rag2 gene-edited dogs (Rag2 dogs) were taken and fixed overnight in 4% paraformaldehyde at 4°C. The next day, the tissues were rinsed with running water for 6 hours and dehydrated by a gradient of 50%, 70%, 80%, 95%, and 100% alcohol. The tissues were then cleared in xylene I and xylene II and finally immersed in paraffin at 60°C. After the paraffin blocks cooled overnight, the tissues were placed on a microtome and sectioned into 4μm sections for later use.

[0089] Hematoxylin and eosin (HE) staining was performed on paraffin sections. After baking at 60°C for 3 hours, the sections were rinsed twice with distilled water for 5 minutes each time with a gradient of xylene I, xylene II, 100%, 95%, 80%, 70%, and 50% alcohol. Hematoxylin was then stained for 7 minutes, followed by rinsing with tap water. After differentiation with hydrochloric acid and alcohol, the sections were rinsed with tap water. Ammonia was used for blueing, followed by rinsing with tap water. Eosin was stained for 5 seconds, followed by rinsing with tap water. After dehydration with a gradient of 95% and 100% alcohol, clearing with xylene I and xylene II, the sections were mounted with neutral resin and photographed under a microscope for analysis.

[0090] The white pulp region (WP) of the canine spleen consists of two parts: the periarterial lymphatic sheath (PLS) and lymphoid nodules. The periarterial lymphoid nodules are lymphoid tissue surrounding the central artery of the canine carinatum (CA) and are mainly composed of numerous T-cells. Figure 4 The images show a comparison of the white pulp region of the spleen in wild-type dogs and Rag2 gene-edited dogs. The results indicate that, compared to wild-type dogs, the white pulp region of the spleen in Rag2 gene-edited dogs (dispersed as dark blue clumps of lymphoid tissue) lacks obvious periarterial lymphatic sheath structures, and T cell development is significantly abnormal, suggesting that the Rag2 gene-edited immunodeficient model dog was successfully constructed.

[0091] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A method for establishing a Rag2 gene-edited immunodeficient dog model, the method comprising the following steps: (1) Determine the target site based on the sequence of exon 2 of the canine Rag2 gene; (2) Synthesize sgRNA sequences according to the target sites determined in step (1), and then connect the synthesized sequences with the backbone vector to construct sgRNA target vectors. (3) In vitro transcription products of sgRNA and CRISPR / Cas9 were obtained by in vitro transcription; (4) Introduce the sgRNA and CRISPR / Cas9 in vitro transcription products obtained in step (3) into canine zygotes or canine somatic cells to obtain canine zygotes or canine somatic cells with reduced or absent Rag2 gene expression. in, The sgRNA sequence and its complementary sequence include the following sequences: sgRNA1: GGTAACAGTCAGTAATAACGTGG (SEQ ID NO: 2), The complementary sequence of sgRNA1 is: CCACGTTATTACTGACTGTTACC (SEQ ID NO:3). sgRNA2: GTGGCCGGGTAACGAAGAGGAGG (SEQ ID NO: 4), The complementary sequence of sgRNA2 is: CCTCCTCTTCGTTACCCGGCCAC (SEQ ID NO:5). sgRNA3: CCGGCCACTTGCATATTCAGAGG (SEQ ID NO: 6), The complementary sequence of sgRNA3 is: CCTCTGAATATGCAAGTGGCCGG (SEQ ID NO:7).

2. The method according to claim 1, characterized in that, The method further includes transplanting canine zygotes with reduced or absent Rag2 gene expression into the oviduct of a recipient female dog to create a Rag2 gene-edited immunodeficient model dog; or The method further includes transplanting the nucleus of canine somatic cells with reduced or absent Rag2 gene expression into canine enucleated oocytes, and then transplanting the enucleated canine oocytes after nuclear transfer into the oviduct of a recipient female dog, thereby preparing a Rag2 gene-edited immunodeficient dog model.

3. The method according to claim 1, characterized in that, Rag2 protein expression was absent in the Rag2 gene-edited immunodeficient model dogs, and / or The genome of the Rag2 gene-edited immunodeficient model dog contains the nucleotide sequence shown in SEQ ID NO:

10.

4. Canine somatic cells, tissues, or organs of a Rag2 gene-edited immunodeficient model dog obtained by the method of any one of claims 1-3.

5. The canine somatic cells, tissues, or organs according to claim 4, characterized in that, The canine somatic cells, tissues or organs are devoid of Rag protein expression and / or contain a nucleotide sequence as shown in SEQ ID NO:

10.

6. A targeting vector for canine Rag2 gene editing, wherein the targeting vector consists of an sgRNA sequence designed for a targeting site sequence determined by exon 2 of the canine Rag2 gene and a backbone vector; in, The sgRNA and its complementary sequence include the following sequences: sgRNA1: GGTAACAGTCAGTAATAACGTGG (SEQ ID NO: 2), The complementary sequence of sgRNA1 is: CCACGTTATTACTGACTGTTACC (SEQ ID NO:3). sgRNA2: GTGGCCGGGTAACGAAGAGGAGG (SEQ ID NO: 4), The complementary sequence of sgRNA2 is: CCTCCTCTTCGTTACCCGGCCAC (SEQ ID NO:5). sgRNA3: CCGGCCACTTGCATATTCAGAGG (SEQ ID NO: 6), The complementary sequence of sgRNA3 is: CCTCTGAATATGCAAGTGGCCGG (SEQ ID NO:7).

7. A cell comprising the targeting vector of claim 6.

8. The cell according to claim 7, characterized in that, The cells cannot develop into animals.

9. A primer pair for identifying the genotype of a canine somatic cell, tissue, or organ as described in claim 4 or 5, said primer pair comprising the following sequences: Forward primer: GCTCTTTGCTTACCTGACTGCC (SEQ ID NO:8), Reverse primer: TGGCAAGTGAATGTCCTCCTAAGA (SEQ ID NO:9).

10. The use of the primer pair according to claim 9 in detecting a Rag2 gene-edited immunodeficient model dog containing a genomic sequence shown in SEQ ID NO:

10.

11. The use of the Rag2 gene-edited immunodeficient canine model obtained by the method of any one of claims 1-3 in tumor model construction, screening and / or evaluation of drugs for immune diseases.

Citation Information

Patent Citations

  • Genome editing of immunodeficiency genes in animals

    US20110030072A1