Use of a jak2 inhibitor in the manufacture of a medicament for treating osteoarthritis in an individual

By using the JAK2 inhibitor Fedratinib to inhibit the expression and function of JAK2, the problem of the lack of effective treatments for osteoarthritis has been solved, achieving the effects of slowing the progression of osteoarthritis and improving symptoms, providing a new strategy for the clinical treatment of osteoarthritis.

CN116870161BActive Publication Date: 2025-12-26TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310970166.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-03
Publication Date
2025-12-26
Estimated Expiration
2043-08-03

AI Technical Summary

Technical Problem

Currently, there are no effective drugs to alleviate or reverse the progression of osteoarthritis. Existing treatments mainly rely on symptomatic treatment and late-stage artificial joint replacement, lacking targeted drug intervention.

Method used

Fedratinib, a JAK2 inhibitor, slows the progression of osteoarthritis by inhibiting the expression and function of JAK2. This includes using small molecule drugs such as siRNA, shRNA, or miRNA to affect the gene expression and function of JAK2.

Benefits of technology

It significantly improves osteoarthritis symptoms, slows cartilage degeneration, and reduces the progression of osteoarthritis, providing new therapeutic targets and strategies and laying the foundation for clinical treatment of osteoarthritis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116870161B_ABST
    Figure CN116870161B_ABST
Patent Text Reader

Abstract

The application discloses application of a JAK2 inhibitor in preparation of a medicine for treating osteoarthritis of an individual, and belongs to the technical field of biological medicines. The application finds that JAK2 inhibition can effectively improve osteoarthritis, and further provides a use of a JAK2 inhibitor in preparation of a medicine for treating osteoarthritis, and lays a foundation for development of a novel medicine which can effectively treat osteoarthritis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of drugs for treating osteoarthritis, and particularly relates to application of a JAK2 inhibitor in preparation of a drug for treating osteoarthritis of an individual. BACKGROUND

[0002] Osteoarthritis is a kind of senile degenerative disease characterized by decreased cartilage degeneration, subchondral bone sclerosis and hyperplasia of periarticular bone, and joint stiffness, and the main affected population is the elderly women. Data shows that in the elderly population, half of the population suffers from osteoarthritis, and osteoarthritis has gradually become the fourth largest cause of disability in the world. It is estimated that there are currently about 210 million osteoarthritis patients worldwide. With the continuous progress of population aging, it can be predicted that there will be more osteoarthritis patients in the future. Osteoarthritis often occurs in the hip, knee, elbow and other joints, and the knee joint is the most affected.

[0003] At present, the main treatment for osteoarthritis is symptomatic treatment and late artificial joint replacement, and there is still a lack of effective treatment drugs to relieve or reverse the progression of osteoarthritis. Therefore, it is necessary to further explore the pathogenesis of osteoarthritis, discover new therapeutic targets, and then develop innovative drugs that can effectively treat osteoarthritis.

[0004] Fedratinib (TG101348) is a potent and selective JAK2 inhibitor, and is the first drug approved by the US FDA for the treatment of myelofibrosis in the past decade. However, there is no relevant literature reported on the effect of Fedratinib on the treatment of osteoarthritis. The research group found that Fedratinib can significantly improve osteoarthritis by inhibiting JAK2 in in vivo and in vitro experiments. In view of this, JAK2 has the potential to become a new target for the treatment of osteoarthritis, and Fedratinib as a JAK2 inhibitor is expected to be applied to the clinical treatment of osteoarthritis. SUMMARY

[0005] In order to overcome the deficiencies of the prior art, the purpose of the present application is to provide application of a JAK2 inhibitor in preparation of a drug for treating osteoarthritis of an individual. The present application verifies that the JAK2 inhibitor can significantly improve osteoarthritis by inhibiting JAK2 through experiments, and JAK2 can be used as a new target for the treatment of osteoarthritis and can be applied to clinical guidance for the treatment of osteoarthritis.

[0006] To achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0007] Application of a JAK2 inhibitor in preparation of a drug for treating osteoarthritis of an individual.

[0008] Preferably, the JAK2 inhibitor is used to inhibit the progression of cartilage inflammation, thereby slowing the progression of osteoarthritis.

[0009] Preferably, the JAK2 inhibitor is a substance that affects the expression level and / or function of the JAK2 gene.

[0010] Preferably, the JAK2 inhibitor is a small molecule drug that can inhibit the expression and / or function of JAK2.

[0011] Preferably, the JAK2 inhibitor is at least one of siRNA, shRNA or miRNA targeting JAK2.

[0012] Preferably, the JAK2 inhibitor is selected from Fedratinib.

[0013] Preferably, the osteoarthritis of the individual includes age-related primary osteoarthritis and secondary osteoarthritis caused by injury, inflammation, genetic and metabolic, endocrine and other diseases.

[0014] Preferably, the individual is a mammal.

[0015] Preferably, the individual is a human or a mouse.

[0016] The present application has the following beneficial effects:

[0017] For the current lack of effective treatment for osteoarthritis, the present application provides a new treatment strategy: the present application proves through experiments that JAK2 inhibitors can significantly improve the effect of osteoarthritis by inhibiting JAK2, JAK2 can be used as a new target for the treatment of osteoarthritis, and can be applied to clinical guidance for the treatment of osteoarthritis, and lays a foundation for the development of new drugs that can effectively treat osteoarthritis. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Fedratinib treatment group OA mice and physiological saline control group OA mice knee joint tissue safranin O and fast green staining results figure;

[0019] Figure 2 Fedratinib treatment group OA mice and physiological saline control group OA mice osteoarthritis score figure;

[0020] Figure 3 Western blot results figure for detecting the expression of JAK downstream pathway after Fedratinib intervention of chondrocytes;

[0021] Figure 4Figures of Western blot results for detecting the markers of anabolism, catabolism, and apoptosis and inflammation related molecules after Fedratinib intervention for chondrocytes, wherein Figure 4 A is an inflammation index, Figure 4 B is an anabolism index and a catabolism index, Figure 4 C is an apoptosis index;

[0022] Figure 5 Figures of RT-qPCR results for verifying the knockdown efficiency of JAK2 mRNA and Western blot results for detecting the expression of JAK downstream pathways after transfecting JAK2-siRNA for chondrocytes, wherein Figure 5 A is the knockdown efficiency of JAK2 mRNA level, Figure 5 B is the expression of JAK downstream pathways;

[0023] Figure 6 Figures of Western blot results for detecting the markers of anabolism, catabolism, and apoptosis and inflammation related molecules after transfecting JAK2-siRNA for chondrocytes, wherein Figure 6 A is an inflammation index, Figure 6 B is an anabolism index and a catabolism index, Figure 6 C is an apoptosis index. DETAILED DESCRIPTION

[0024] The present application is further described in greater detail by way of reference to the following drawings and examples. The scope of the present application is, of course, not limited to the following examples. Those skilled in the art will appreciate that various modifications and changes can be made to the present application without departing from its spirit. The materials and methods used in the experiments are described generally and / or specifically. Although many materials and methods used to achieve the purposes of the present application are well known in the art, they are described as much as possible in the present application. The following examples are further to illustrate the present application, but not to limit the present application. Any formal but not substantial equivalent transformation made according to the concept of the present application should be considered as the scope of the technical solutions of the present application.

[0025] The test methods or test methods described in the following examples are all conventional methods unless otherwise specified. The reagents and materials described are obtained from conventional commercial channels or prepared by conventional methods unless otherwise specified.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0027] At present, the treatment of osteoarthritis mainly includes symptomatic treatment and artificial joint replacement in the late stage of the disease. There is still a lack of effective therapeutic drugs to alleviate or reverse the progression of osteoarthritis. Therefore, it is necessary to further explore the pathogenesis of osteoarthritis, discover new therapeutic targets, and then develop innovative drugs that can effectively treat osteoarthritis.

[0028] Definitions and uses of terms

[0029] JAK2 inhibitor: In the present application, the JAK2 inhibitor refers to: 1) a substance that inhibits the expression of JAK2, which can include siRNA, shRNA and miRNA capable of inhibiting the expression of JAK2, a vector containing the above siRNA, shRNA and / or miRNA, and a host cell containing the above vector, but the present application is not limited to this;

[0030] 2) a substance that reduces or inactivates the activity of JAK2;

[0031] 3) a substance that promotes the degradation of JAK2, such as a JAK2 antibody that causes degradation.

[0032] Individual: In the present application, the term "individual" refers to a mammal, including but not limited to rats, mice, non-human primates, humans, dogs, cats, horses, cows, sheep, pigs, goats. Preferably, it is a human or a mouse.

[0033] Treatment:

[0034] The "treatment" described in the present application refers to reducing the degree of cartilage degeneration in osteoarthritis, or curing osteoarthritis to normalize it, or slowing down the progression of osteoarthritis.

[0035] The present application demonstrates that by inhibiting the expression of JAK2 in chondrocytes, the cartilage degeneration in osteoarthritis can be significantly alleviated.

[0036] In order to better explain the present application, the following will be described in detail in combination with specific examples.

[0037] Example 1: Effect of Fedratinib injected into the knee joint cavity on the progression of osteoarthritis in mice:

[0038] Experimental animals and materials:

[0039] 1. Experimental animals:

[0040] Strain, strain: wild-type mice (WT, C57BL / 6) bred in the animal house of Tongji Hospital;

[0041] Reproductive age: 8-10 weeks old;

[0042] 2. Experimental materials:

[0043] Sodium pentobarbital: Selleck; Fedratinib: MCE (MedChemExpress)

[0044] 3. Experimental method:

[0045] Sodium pentobarbital (35 mg / kg) was intraperitoneally injected to anesthetize the mice, and then the medial meniscus instability (DMM) operation was performed to establish the mouse osteoarthritis model. After 1 week of modeling, the knee joint cavity was injected with JAK2 inhibitor Fedratinib 0.1 mg / kg or 1 mg / kg, once a week for 7 weeks, and the mice were sacrificed after 8 weeks of modeling. The knee joint was removed and fixed in the tissue fixing solution. The fixed knee joint specimens were decalcified and sectioned. The tissue sections were subjected to safranin O and fast green staining experiment to detect the cartilage damage. Two pathologists independently evaluated the severity of osteoarthritis of each safranin O and fast green staining section using the osteoarthritis scoring system in a blinded manner.

[0046] 4. Experimental results:

[0047] Specifically, the safranin O and fast green staining results of the knee joint tissues of the Fedratinib-treated OA mice and the saline control OA mice are shown in Figure 1 , and it can be seen from Figure 1 that compared with the saline control group, the degree of knee joint cartilage degeneration in the Fedratinib-treated OA mice was significantly reduced after the DMM operation.

[0048] The osteoarthritis scoring results are shown in Figure 2 , and it can be seen from Figure 2 that the osteoarthritis score of the Fedratinib-treated OA mice was lower than that of the saline control OA mice, indicating that the degree of cartilage degeneration was greatly reduced.

[0049] Example 2: Effect of Fedratinib intervention on JAK downstream pathways, anabolism, catabolism, apoptosis, and inflammation of chondrocytes:

[0050] This example explores the therapeutic effect of Fedratinib on osteoarthritis in vitro experiments. The inventors induced an inflammatory OA phenotype by stimulating chondrocytes with IL-1β for 24 h, and added different concentrations of Fedratinib to the culture medium. Western blot was used to detect the expression of JAK downstream pathways, anabolism, catabolism, apoptosis, and inflammation-related molecular markers after Fedratinib intervention.

[0051] Specifically, 2.5 uM, 5 uM and 10 uM of Fedratinib were added to the mouse primary chondrocyte culture medium, and IL-1β was used for stimulation and induction of OA. The chondrocytes were collected, and total protein was extracted for Western blot detection.

[0052] In combination Figure 3 and Figure 4 It can be seen that, compared with the control group, after the addition of Fedratinib, the expressions of JAK downstream pathways p-STAT3 and SOCS3 were significantly reduced, the expression of COL2A1, a synthetic metabolism indicator, was increased, the expressions of MMP13 and MMP3, decomposition metabolism markers, were significantly reduced, the expression of Cleaved Caspase-3, a key apoptosis protein, was significantly reduced, and the expressions of INOS and COX2, inflammation indicators, were reduced, which indicates that the IL-1β-induced chondrocyte degeneration is greatly reduced after Fedratinib intervention.

[0053] Example 3 Influence of JAK2 knockdown on JAK downstream pathways, synthetic metabolism, decomposition metabolism, apoptosis and inflammation of chondrocytes

[0054] To further evaluate the role of inhibiting JAK2 in the progression of osteoarthritis, the present application detects the expressions of chondrocyte JAK downstream pathways, synthetic metabolism, decomposition metabolism, apoptosis and inflammation-related molecular markers of chondrocytes after transfection of JAK2-siRNA and stimulation with IL-1β for 24 hours by western blot.

[0055] Specifically, the knockdown efficiency of siRNA is first verified by RT-qPCR technology. The RNA of chondrocytes is extracted by Trizol reagent, cDNA synthesis is performed using PrimeScript TM RT reagent Kit, and then the cDNA obtained by reverse transcription is used for subsequent qPCR reaction, and β-actin is used as an internal reference to standardize the relative expression of JAK2 gene. The results are shown in Figure 5 Table 1 below lists the primers corresponding to JAK2 and β-actin.

[0056] Table 1

[0057] Primer Forward Primer Reverse Primer Actb GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT JAK2 GTGTCGCCGGCCAATGTT CCTGATTCGCTTCCGGGTTA

[0058] The siRNA sequence with the highest knockdown efficiency verified in the previous step is selected to transfect chondrocytes for 24 hours, and then IL-1β is used for stimulation and induction of OA. The chondrocytes are collected, and total protein is extracted for Western blot detection.

[0059] In combination Figure 5 and Figure 6It can be known that compared with the control group, after knocking down JAK2, the expression of p-STAT3 and SOCS3 in the downstream pathway of JAK was obviously reduced, the expression of COL2A1, a synthetic metabolism index, was increased, the expression of ADAMTS5, a decomposition metabolism index, was obviously reduced, the expression of Cleaved Caspase-3, a key protein of apoptosis, was significantly reduced, and the expression of INOS and IL6, inflammation indexes, was reduced, which indicates that IL-1β-induced cartilage cell degeneration is greatly reduced after knocking down JAK2.

[0060] In summary, the above experimental data show that JAK2 can inhibit cartilage cell degeneration and thus slow down the progression of osteoarthritis.

[0061] Therefore, the JAK2 inhibitor researched in the present application provides a new treatment strategy for osteoarthritis disease which currently lacks effective treatment methods.

[0062] The above is only the preferred embodiment of the present application, and it should be pointed out that the above preferred embodiment should not be regarded as a limitation of the present application, and the protection scope of the present application should be limited by the scope defined in the claims. For ordinary skilled persons in the art, several improvements and refinements can be made without departing from the spirit and scope of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application.

Claims

1. Use of a JAK2 inhibitor selected from Fedratinib in the manufacture of a medicament for treating osteoarthritis in an individual, the JAK2 inhibitor being used to inhibit progression of inflammation in the cartilage, thereby slowing progression of osteoarthritis.

2. Use according to claim 1, characterized in that: The JAK2 inhibitor is a substance that affects the expression level and / or function of a JAK2 gene.

3. Use according to claim 1, characterized in that: The individual is a mammal.

4. Use according to claim 3, characterized in that: The individual is a human or a mouse.

Citation Information

Patent Citations

  • Application of feideratinib in preparation of medicine for treating KRT18 low-expression head and neck squamous cell carcinoma

    CN115105508A