A micro-translation component library product
Through the micro-translation library construction products and methods, the problems of high sample demand, high cost and high demand for high instruments and equipment in the prior art are solved, and efficient translation library construction for micro-samples and high-quality sequencing data are achieved.
Patent Information
- Application Number
- CN202311183121.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-14
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2043-09-14
AI Technical Summary
The existing translation library methods have high sample demand, high cost, high demand for high instruments and equipment, low sample size and high proportion of non-specific RNA fragments, which are difficult to meet the research needs of precious samples or special source samples.
Provide a micro-translation library product and method, through cell lysis, nuclease treatment, reverse transcription and electrophoretic purification, the translation termination processing of micro-cell samples and the efficient construction of library DNA is achieved, reducing the demand for high instruments and equipment and experimental costs.
The translation group library construction of micro samples was achieved, which reduced the risk of sample depletion and waste, reduced experimental costs, and increased the proportion of reads of RPF-RNA, enhancing the quality and efficiency of sequencing data.
Smart Images

Figure CN116904557B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of biomedicine and molecular biology, and more specifically, relates to a product of a micro-translation assembly library. Background Art
[0002] Translatome research can help researchers discover and identify new proteins, explore the mechanism of gene expression on diseases at the translational level, and explain the inconsistencies between transcriptional and protein-level results. In recent years, the application of the translatome has become increasingly widespread. Researchers have combined translatome and transcriptome data and produced many scientific research results in the fields of exploring the mechanism of tumorigenesis and development, developmental regulation, neuroscience, etc. To study translatome data, it is necessary to obtain the information of mRNA protected by ribosomes that are in the process of translation. Currently, it has been developed to use low-concentration ribonuclease (RNase) to treat cell lysates to degrade mRNA, but the RNA fragments protected by ribosomes are retained. Then, the protected fragments (22-35 nt mRNA fragments, ribosome footprints, RPF) are analyzed by next-generation sequencing (NGS) to obtain the information of mRNA translation. There are many existing methods for constructing a library for translatome analysis, such as Ribo-seq developed by the Weissman research group in 2009, single-cell ribosome sequencing technology (scRibo-seq) developed by Michael in 2021, and ultrasensitive translatome sequencing technology Ribo-lite developed by the Jie Wei research group, etc. However, these methods have the following disadvantages:
[0003] 1. Existing conventional Ribo-seq requires expensive kits, such as rRNA removal kits, and can only be used for samples from mice and humans. It also requires a large amount of cells. For special clinical samples and special types of cells, such as, but not limited to, the spermatogonial stem cell population in human testis and mouse testis tissues, the sample volume is extremely low, and it cannot meet the requirements for constructing a library by conventional Ribo-seq;
[0004] 2. Existing single-cell and other low-sample-volume translatomes have high requirements for expensive instruments and equipment, high costs for library construction kits, and problems such as low abundance in single-cell sequencing. Summary of the Invention
[0005] In view of the above problems, the present invention provides a micro and low-cost product for constructing a translatome library. The product realizes the translation termination treatment of microcells sorted by magnetic beads or flow cytometry; the cell samples after translation termination treatment are lysed to release RNA and digested with micrococcal nuclease to obtain ribosome-protected RNA fragments; all the procedures for constructing a library for ribosome-protected RNA are completed in 1 PCR tube; the library components with a length of 170-185 bp are selected by TBE gel, and the selected library is purified for further high-throughput sequencing.
[0006] The present invention discloses a micro translation component library product, which includes a cell lysis component, a nuclease and an enzymatic digestion buffer component, a reverse transcription reagent component, and a library DNA purification component;
[0007] The cell lysis component is used to lyse sample cells and extract the RNC (Ribosome Nascent-chain Complex) of the sample cells; the nuclease and enzymatic digestion buffer component is used to perform enzymatic digestion on the RNC to obtain RPF-RNA;
[0008] The reverse transcription reagent is used to reverse transcribe RPF-RNA fragments into corresponding DNA;
[0009] The library DNA purification component includes electrophoresis reagents, a gel crushing device, and a filtration and purification product. The electrophoresis reagents are formulated into a gel for electrophoresis of the DNA generated by reverse transcription. The target region in the gel is cut out and placed into the gel crushing device for gel crushing. The sol obtained by adding nuclease-free water to the crushed gel is purified through the filtration and purification product to obtain library DNA.
[0010] Furthermore, the gel crushing device includes a gel pressing device, a first centrifuge tube, and a second centrifuge tube. The gel pressing device is the inner rod of a syringe with rubber. The bottom of the first centrifuge tube has small holes with a diameter of 0.5 - 1 mm. The second centrifuge tube is located outside the first centrifuge tube. The gel pressing device squeezes the gel in the first centrifuge tube, and the gel flows into the second centrifuge tube through the small holes to obtain crushed gel.
[0011] Furthermore, the product further includes a protein synthesis inhibitor, which is used to add to the obtained sample cells to obtain translation-inhibited cells. The translation-inhibited cells are then lysed. The protein synthesis inhibitor is selected from one or more of the following: chloramphenicol, kanamycin, neomycin, cycloheximide, tetracycline, oxytetracycline, puromycin, diphtheria toxin.
[0012] Furthermore, the cell lysis component lyses cells by using one or a combination of the following methods: chemical method, enzymatic method, physical method.
[0013] Furthermore, the nuclease and enzymatic digestion buffer component includes a nuclease, an enzymatic digestion buffer, and an enzymatic digestion termination buffer;
[0014] The nuclease includes one or more of the following: micrococcal nuclease, RNase I, broad-spectrum non-restrictive nuclease, RNase A, RNase R;
[0015] The enzymatic digestion buffer includes one or more of the following: pH buffer, calcium salt, magnesium salt, enzyme stabilizer;
[0016] The enzyme digestion termination buffer includes one or more of the following: EGTA, EDTA, proteinase K, GuSCN.
[0017] Furthermore, the reverse transcription reagent component includes: 3'-end ligation reaction solution, reverse transcription primer buffer, 5'-end ligation reaction solution, reverse transcription reaction solution, PCR reaction solution.
[0018] Furthermore, the reverse transcription primer buffer contains a reverse transcription primer, and the primer sequence is: ACACGACGCTCTTCCGA;
[0019] The 3'-end ligation reaction solution contains a pre-adenylated 3'-end adapter, and the pre-adenylated 3'-end adapter sequence is: 5rApp / AGAUCGGAAGAGCGUCGUG / 3SpC3;
[0020] The 5'-end ligation reaction solution contains a 5'-end adapter, and the 5'-end adapter sequence is: / 5Phos / NNNNNNNNNNAGATCGGAAGAGCACACGTCTG / 3SpC3.
[0021] Furthermore, the library DNA purification component further includes a cDNA purification product, and the cDNA purification product purifies the reverse-transcribed DNA to obtain purified DNA.
[0022] Furthermore, the filtration purification product includes a gel filtration product and a filter column containing a glass fiber filter membrane.
[0023] The present invention discloses a method for constructing a micro-translation library, including:
[0024] Obtain sample cells, extract the RNC of the sample cells by cell lysis, and the number of the sample cells is 100 - 500;
[0025] Perform enzymatic digestion on the RNC in a nuclease and enzymatic digestion buffer to obtain RPF-RNA;
[0026] Use a reverse transcription reagent to reverse-transcribe the RPF-RNA fragment into the corresponding DNA;
[0027] Perform gel electrophoresis on the reverse-transcribed DNA, select the target region in the gel, cut the gel, place it in a gel fragmentation device to fragment the gel, add nuclease-free water to the fragmented gel to obtain a sol solution, and purify the sol solution through a filtration purification product to obtain library DNA.
[0028] Advantages of the present invention:
[0029] 1. The traditional method for constructing a translation library requires a large number of RPF-RNA samples. The products and methods provided by the present invention have less demand for samples and are suitable for precious samples or very limited special source samples. This means that researchers can use this method to obtain sufficient RPF-RNA from a small number of samples for the construction of a translation library without worrying about sample depletion or waste.
[0030] 2. The experimental procedures of the products and methods provided by the present invention can be completed in a conventional laboratory with low demand for high-end instruments and equipment. This enables more laboratories to easily adopt this method for constructing a translation library without investing a large amount of funds in purchasing expensive instruments and equipment.
[0031] 3. Compared with traditional products and methods for constructing a translation library, the products and methods provided by the present invention do not require the use of expensive kits. By optimizing experimental steps and selecting cost-effective reagents, the cost of library construction is significantly reduced, which is an important advantage for research projects or laboratories with tight budgets.
[0032] 4. In traditional products and methods for constructing a translation library, non-specific RNA fragments and rRNA account for a large proportion, resulting in a low proportion of reads of RPF-RNA. However, the products and methods provided by the present invention can increase the proportion of reads of RPF-RNA by adopting specific experimental steps and optimized experimental conditions. This means that the sequencing capacity can be more fully utilized during sequencing, reducing the number of reads of non-specific fragments and thus reducing the sequencing cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0034] Figure 1 is a schematic diagram of the usage process of a micro-translation library construction product provided by an embodiment of the present invention;
[0035] Figure 2 is a schematic diagram of the process of a micro-translation library construction method provided by an embodiment of the present invention;
[0036] Figure 3 、 Figure 4 and Figure 5 is a schematic diagram of the experimental operation process of a micro-translation library construction provided by an embodiment of the present invention;
[0037] Figure 6It is an electrophoresis diagram of library construction with different cell amounts provided by an embodiment of the present invention. The bands in the 1st, 5th, 7th, 9th, and 10th lanes from the left are the bands of the Marker. The band sizes are marked on the far left, with the unit being bp. The bands in the remaining lanes are the bands run out under different cell amounts. There is no band in the 2nd lane from the left because nuclease digestion was not added;
[0038] Figure 7 It is an electrophoresis diagram of library construction with different nuclease digestions provided by an embodiment of the present invention. The bands in the 1st, 5th, 9th, and 10th lanes from the left are the bands of the Marker. The bands in the 2nd, 3rd, and 4th lanes from the left are the electrophoresis bands of the samples digested with RNase I. The concentrations of RNase I are 2U / ul, 2.5U / ul, and 0.5U / ul from left to right. The bands in the 6th, 7th, and 8th lanes from the left are the electrophoresis bands of the samples digested with micrococcal nuclease. The concentrations of micrococcal nuclease are 10U / ul, 5U / ul, and 1.25U / ul from left to right. At the same concentration, the bands using micrococcal nuclease are brighter. Therefore, in the experiment of constructing a library for trace protein components, micrococcal nuclease is preferred;
[0039] Figure 8 It is a box plot of the number of RPF reads after sequencing for two different library construction methods, namely library construction for trace translation and conventional library construction for translation, provided by an embodiment of the present invention. The Y-axis is the number of fragment reads obtained by sequencing, which represents the effective data volume obtained under a sequencing data volume of 30G in this embodiment. The trace method is the method of the present invention, and the conventional method is the general classical method for a large number of cells;
[0040] Figure 9 It is a result diagram of data quality control for library construction of trace translation provided by an embodiment of the present invention. Figure 9 In A, it is the length distribution of reads aligned to the genome after removing adapters by sequencing. Theoretically, the fragments protected by RPF are 24 - 35 nt, and the main peak is around 30 nt. The above results are consistent with the theory. The Y-axis is the number of fragments, and the X-axis is the length of the RNA fragments protected by RPF; Figure 9 In B, it is the main position distribution of reads aligned to the genome on the genome. The ribosome theoretically binds to the CDS region of mRNA. The reads obtained by sequencing the library for translation mainly map to the CDS region and the 5'-UTR, and rarely map to the 3'-UTR; Figure 9 In C and D, they are schematic diagrams of the P-site analysis results, which conform to the classical high-low-low 3 nt rule distribution, indicating that the quality control of this trace library construction method is good and represents the accurate information of the translatome. Detailed implementation manners
[0041] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.
[0042] In some processes described in the specification, claims, and the above-mentioned drawings of the present invention, a plurality of operations appear in a specific order. However, it should be clearly understood that these operations may not be executed in the order in which they appear herein or may be executed in parallel. The serial numbers of the operations, such as S101, S102, etc., are only used to distinguish different operations, and the serial numbers themselves do not represent any execution order. In addition, these processes may include more or fewer operations, and these operations may be executed in sequence or in parallel. It should be noted that the descriptions such as "first", "second", etc. in this article are used to distinguish different messages, devices, modules, etc., do not represent a sequence, and do not limit that "first" and "second" are of different types.
[0043] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work belong to the scope of protection of the present invention.
[0044] Figure 1 is a schematic diagram of the usage process of the micro-translation component library product provided by the embodiment of the present invention. The micro-translation component library product includes: a cell lysis component, a nuclease and enzymatic digestion buffer component, a reverse transcription reagent component, and a library DNA purification component;
[0045] The usage process of the product includes:
[0046] S11: Obtain a cell sample;
[0047] In one embodiment, 100 - 500 spermatogonial stem cells are obtained from the testis tissue of 4-day-old mice by THY1+ magnetic bead sorting.
[0048] THY1 is a cell surface molecule, also known as CD90. It is a highly conserved glycoprotein that is widely expressed in a variety of cell types, including muscle cells, nerve cells, immune cells, and stem cells. In immunology, THY1 is commonly used as a marker to label tumor stem cells, immune stem cells, and other stem cells. By sorting cells using THY1-positive (THY1+) magnetic beads, cell subsets expressing THY1 can be enriched for subsequent experimental research or applications.
[0049] In one embodiment, the product further comprises a protein synthesis inhibitor, which is used to be added to the obtained mouse spermatogonial stem cells to obtain cells with translation inhibition, and the cells with translation inhibition are then subjected to cell lysis. The protein synthesis inhibitor is selected from one or more of the following: chloramphenicol, kanamycin, neomycin, cycloheximide, tetracycline, oxytetracycline, puromycin, diphtheria toxin.
[0050] Chloramphenicol is a broad-spectrum antibiotic that inhibits bacterial growth by inhibiting bacterial protein synthesis. It binds to the ribosomes of bacteria and prevents the linkage of amino acids, thus hindering protein synthesis; Kanamycin is an aminoglycoside antibiotic that inhibits bacterial growth by interfering with bacterial protein synthesis; Neomycin is an aminoglycoside antibiotic that kills bacteria by interfering with bacterial protein synthesis; Streptomycin is an aminoglycoside antibiotic that is used to treat bacterial infections such as tuberculosis; Tetracycline is a class of antibiotics used to treat various bacterial infections. They inhibit protein synthesis by preventing amino acids from binding to RNA on ribosomes; Erythromycin is a macrolide antibiotic used to treat bacterial infections and interferes with protein synthesis by preventing the elongation of the RNA chain on ribosomes; Puromycin is an amino acid analogue that can bind to the growing protein chain, resulting in premature termination of the protein and thus inhibiting protein synthesis; Diphtheria Toxin is a toxin that can bind to the termination factor EF-2 of protein synthesis, resulting in the termination of protein synthesis and causing toxigenic infections.
[0051] S12: Use the cell lysis component to lyse the sample cells and extract the RNC of the sample cells;
[0052] In one embodiment, the cell lysis component lyses cells by using one or a combination of the following methods: chemical method, enzymatic method, physical method.
[0053] Cell lysis is a commonly used experimental operation in the fields of biology and biotechnology, which is used to break the cell membrane and release cell components such as intracellular organelles, proteins, nucleic acids, etc.
[0054] The chemical methods include the surfactant method and the high-permeability method. Among them, the surfactant method uses surfactants (such as Triton X-100, SDS) to destroy the hydrophobic region of the cell membrane, causing cell lysis. It is simple to operate and has good lysis effect, suitable for various cell types. However, surfactants will affect the physical and chemical properties of proteins and nucleic acids, and subsequent experimental treatments are required, increasing experimental operations; the high-permeability method causes the pressure to rupture cells by creating an osmotic pressure difference inside and outside the cell by adding a high-concentration salt solution or glucose solution. It is simple and easy to perform and is suitable for soft cell types, but the lysis effect may be uneven and it is not easy to control the concentration.
[0055] The enzymatic lysis method uses specific enzymes, such as proteases and glucosidases, to destroy the cell membrane structure and cause cell lysis. It is convenient to operate and is suitable for specific cell types, but there is a risk that the enzyme will affect other components of the cell.
[0056] The physical methods include ultrasonic lysis, high-pressure homogenization, and freeze-thaw lysis. Among them, ultrasonic lysis generates alternating fluctuations of high and low pressure under the action of the high-frequency vibration of ultrasonic waves, thereby destroying the cell membrane. It is simple to operate and has good lysis effect, suitable for various cell types. However, ultrasonic lysis easily generates heat, which may cause denaturation of proteins and nucleic acids in the sample; high-pressure homogenization uses a high-speed moving piston to pass the cell sample through a narrow hole, thereby generating high pressure and shear force to break the cells, which is suitable for harder cell types, but the equipment is relatively expensive and the operation is relatively complex; the freeze-thaw method freezes the cell sample to a low temperature and then quickly melts it, using the mechanical pressure and temperature changes generated during the freeze-thaw process to rupture the cells. It is simple and easy to perform and is suitable for soft cell types, but the lysis effect may be uneven.
[0057] S13: Enzymatically treat the RNC using a nuclease and an enzymatic digestion buffer assembly to obtain RPF-RNA;
[0058] In one embodiment, the nuclease and enzymatic digestion buffer assembly includes a nuclease, an enzymatic digestion buffer, and an enzymatic digestion termination buffer;
[0059] The nuclease includes one or more of the following: micrococcal nuclease, RNase I, broad-spectrum non-restrictive nuclease, RNase A, RNase R;
[0060] Micrococcal Nuclease is a non-specific endonuclease that cleaves DNA and RNA, and its activity is stable in a relatively wide pH range and low ionic strength. It is used to lyse cells and release intracellular nucleic acids, remove linear DNA or RNA fragments, and cleave DNA or RNA; RNase I is a specific nuclease that can shear the phosphodiester bonds of RNA molecules to produce short fragments of RNA; Broad-Spectrum Endonuclease is a non-specific endonuclease that cleaves DNA and RNA and has strong enzymatic digestion ability under different pH values and temperature conditions; RNase A is a specific nuclease that enzymatically degrades RNA and is used to remove RNA residues in DNA samples; RNase R is a 3'-5' exonuclease that enzymatically degrades RNA and is used to remove linear RNA and retain circular RNA or non-coding RNA.
[0061] The enzymatic digestion buffer includes one or more of the following: pH buffer, calcium salt, magnesium salt, enzyme stabilizer;
[0062] A pH buffer is a solution that can maintain the stability of the pH value of a solution and is used for enzymatic digestion reactions or other biochemical experiments under specific pH conditions. By adjusting the acid-base ratio in the buffer, the acidity and alkalinity of the solution can be maintained, enabling the enzyme to maintain its optimal activity in a specific acid-base environment. Commonly used buffers include Tris-HCl buffer and PBS buffer; Calcium salts and magnesium salts are commonly used ionic salts that can act as cofactors for enzymatic reactions and promote enzyme activity. In some enzymatic digestion reactions, the presence of calcium salts and magnesium salts can enhance enzyme stability and catalytic efficiency; An enzyme stabilizer is a compound that can enhance enzyme stability and resistance to protein degradation and is used to protect enzyme activity in enzymatic digestion reactions. Commonly used enzyme stabilizers include bovine serum albumin, glucose, glycerol, etc.
[0063] In one embodiment, the composition of the enzymatic digestion buffer is shown in Table 1.
[0064] Table 1. Composition of the lysis buffer
[0065]
[0066] The enzymatic digestion termination buffer includes one or more of the following: EGTA, EDTA, proteinase K, GuSCN.
[0067] EGTA (Ethylene Glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) is a chelating agent commonly used to chelate calcium ions in biochemical and cell biology experiments; EDTA (Ethylenediaminetetraacetic acid) is also a chelating agent widely used in biochemistry, molecular biology, and medical experiments to form stable complexes with metal ions (such as calcium, magnesium, iron, etc.), thereby preventing them from interfering with the experiments; Proteinase K is a proteolytic enzyme with high specificity and can be used for protein cleavage and identification; GuSCN (Guandinium thiocyanate) is a chemical reagent commonly used in nucleic acid extraction and analysis to separate RNA and DNA.
[0068] In one embodiment, the components of the enzyme digestion termination buffer are shown in Table 2.
[0069] Table 2. Components of the enzyme digestion termination buffer
[0070]
[0071] After the sample is treated with the enzyme digestion termination buffer, an RNA end repair buffer, a solution used to repair the ends of RNA molecules in molecular biology, is added. During the preparation and analysis of RNA molecules, due to some experimental steps that may cause damage or incompleteness of the RNA ends, an RNA end repair buffer is needed to repair these damages.
[0072] In one embodiment, the components of the RNA end repair buffer are shown in Table 3.
[0073] Table 3. Components of the RNA end repair buffer
[0074]
[0075] S14: Reverse transcribe the RPF-RNA fragment into the corresponding DNA using reverse transcription reagents;
[0076] In one embodiment, the reverse transcription reagent kit includes: 3'-end ligation reaction solution, reverse transcription primer buffer, 5'-end ligation reaction solution, reverse transcription reaction solution, and PCR reaction solution.
[0077] The 3'-end ligation reaction solution is a reagent used in molecular biology to ligate adapters or primers to DNA or RNA molecules, which plays an important role in subsequent molecular operations such as sequencing and amplification; the reverse transcription primer buffer is a solution used for reverse transcription reaction. Reverse transcription is the process of reverse transcribing RNA into DNA, and the reverse transcription primer is used to initiate this process; the 5'-end ligation reaction solution is similar to the 3'-end ligation reaction solution, but it is used to ligate adapters or primers to the 5'-end of DNA or RNA molecules; the reverse transcription reaction solution contains components such as reverse transcriptase, nucleotides, and buffer, and is used to transcribe RNA templates into corresponding DNA, providing materials for subsequent steps such as PCR amplification; the PCR reaction solution is the solution required for polymerase chain reaction (PCR), which includes DNA template, primers, polymerase, nucleotides, and buffer. PCR is a technique used in molecular biology to amplify DNA fragments.
[0078] The 3'-end ligation reaction solution contains a pre-adenylated 3'-end adapter, and the sequence of the pre-adenylated 3'-end adapter is: 5rApp / AGAUCGGAAGAGCGUCGUG / 3SpC3;
[0079] In one embodiment, the components of the 3'-end ligation reaction solution are shown in Table 4.
[0080] Table 4. Components of 3'-end ligation reaction solution
[0081]
[0082] The reverse transcription primer buffer contains a reverse transcription primer, and the primer sequence is: ACACGACGCTCTTCCGA;
[0083] In one embodiment, the components of the reverse transcription primer buffer are shown in Table 5.
[0084] Table 5. Components of reverse transcription primer buffer
[0085]
[0086] The 5'-end ligation reaction solution contains a 5'-end adapter, and the sequence of the 5'-end adapter is: / 5Phos / NNNNNNNNNNAGATCGGAAGAGCACACGTCTG / 3SpC3.
[0087] In one embodiment, the components of the 5'-end ligation reaction solution are shown in Table 6.
[0088] Table 6. Components of 5'-end ligation reaction solution
[0089]
[0090] In one embodiment, the components of the reverse transcription reaction solution are shown in Table 7.
[0091] Table 7. Components of Reverse Transcription Reaction Solution
[0092]
[0093] In one embodiment, the components of the PCR reaction solution are shown in Table 8.
[0094] Table 8. Components of PCR Reaction Solution
[0095]
[0096] S15: The library DNA purification product includes electrophoresis reagents, a gel crushing device, and a filtration purification product. The electrophoresis reagents are formulated into a gel for electrophoresis of the DNA generated by reverse transcription. The target region in the gel is cut out and placed into the gel crushing device for crushing. The sol solution obtained by adding nuclease-free water to the crushed gel is purified through the filtration purification product to obtain library DNA;
[0097] In one embodiment, the gel crushing device includes a gel pressing device, a first centrifuge tube, and a second centrifuge tube. The gel pressing device is the inner rod of a syringe with rubber. The bottom of the first centrifuge tube has small holes with a diameter of 0.5 - 1 mm. The second centrifuge tube is located outside the first centrifuge tube. The gel pressing device squeezes the gel in the first centrifuge tube, and the gel flows into the second centrifuge tube through the small holes to obtain crushed gel.
[0098] In one embodiment, the library DNA purification component further includes a cDNA purification product, and the cDNA purification product purifies the DNA obtained by reverse transcription to obtain purified DNA.
[0099] In one embodiment, the filtration purification product includes a gel filtration product and a filtration column containing a glass fiber filter membrane.
[0100] S16: Send the obtained library DNA to a sequencing company for sequencing.
[0101] Figure 2 It is a flowchart of the method for constructing a micro-translation library provided by an embodiment of the present invention. The method for constructing a micro-translation library includes:
[0102] S21: Obtain sample cells, and extract the RNC of the sample cells through cell lysis. The number of the sample cells is 100 - 500;
[0103] S22: Perform enzymatic digestion on the RNC in a nuclease and enzymatic digestion buffer to obtain RPF-RNA;
[0104] S23: Use reverse transcription reagents to reverse transcribe RPF-RNA fragments into corresponding DNA;
[0105] S24: The DNA generated by reverse transcription is subjected to gel electrophoresis, the target area in the gel is selected for cutting, and the gel is placed in a gel fragmentation device for fragmentation. Nuclease-free water is added to the fragmented gel to obtain a sol solution, which is purified by filtering the purification product to obtain a library DNA.
[0106] In one embodiment, the experimental steps of the micro-translation library construction method include: Figure 3 , Figure 4 and Figure 5 :
[0107] Step 1: Obtain 100-500 cells, preferably, place the cells in DMEM medium containing 10% fetal bovine serum or a known culture medium suitable for tissue-derived cells, add actinomycin D (CHX) to a final concentration of 100ug / ML~200ug / ML, and incubate at 37 degrees Celsius for 5min~15min.
[0108] Step 2: Centrifuge the cells at 300g~500g for 3~5min and wash the cells once with PBS.
[0109] Step 3: Centrifuge the cells at 300g~500g for 3~5min, carefully remove the PBS, add 10~20ul lysis buffer to the bottom of the tube, resuspend the cells, and incubate on ice for 20~30min.
[0110] Step 4: Take three portions of 2-5ul lysate and place them in low-absorption PCR tubes. Store them at -80 for use in micro-transcriptome analysis. Take 1ul of cell lysate for translation and library construction.
[0111] Step 5: Take a low-adsorption PCR tube, add 5-10ul mineral oil into the tube, and centrifuge instantly.
[0112] Step 6: Add 0.5~1ul cell lysis buffer to the PCR tube containing mineral oil in step 5, centrifuge briefly, and small round droplets of oil and water separation can be seen at the bottom of the tube. The remaining lysis buffer -80 is stored for backup and repetition.
[0113] Step 7: Add 1 ul of freshly prepared microsphere nuclease lysis buffer to step 6, centrifuge briefly, and place in a PCR instrument at 37°C to digest RNA for 30 minutes.
[0114] Step 8: Add 0.5~1ul of freshly prepared termination reaction solution to step 7, centrifuge briefly, place in a PCR instrument at 37℃ for 30~40min and 55℃ for 5~10min, hold at 4℃ to terminate nuclease digestion.
[0115] Step 9: Add 0.5 - 1 μl of freshly prepared RNA end repair buffer to Step 8, centrifuge briefly, place it in a PCR instrument and react at 37 °C for 1 h. After the reaction, place it on ice.
[0116] Step 10: Add 4 - 6 μl of freshly prepared 3'-end ligation reaction solution to Step 9, centrifuge briefly, and incubate overnight at 4 °C for about 16 h.
[0117] Step 11: Add 0.5 - 1 μl of freshly prepared reverse transcription primer buffer to Step 10, centrifuge briefly, place it in a PCR instrument and react at 65 °C for 1 min, 37 °C for 2 min, and 25 °C for 2 min. After the reaction, place it on ice.
[0118] Step 12: Add 3 - 4 μl of freshly prepared 5'-end ligation reaction solution to Step 11, centrifuge briefly, place it in a PCR instrument and react at 37 °C for 2 h. After the reaction, place it on ice.
[0119] Step 13: Add 15 - 18 μl of reverse transcription reaction solution to Step 12, centrifuge briefly, place it in a PCR instrument and react at 50 °C for 1 h, then terminate the reaction at 70 °C for 15 min. After the reaction, place it on ice.
[0120] Step 14: Add 60 - 70 μl of PCR reaction solution to Step 13, centrifuge briefly, place it in a PCR instrument and perform PCR amplification reaction according to the following program: ① React at 98 °C for 30 s; ② React at 98 °C for 15 s, 65 °C for 30 s, 72 °C for 30 s, and perform 10 cycles of reaction ②; ③ React at 72 °C for 5 min; After the reaction, place it on ice, or store it at -20 °C.
[0121] Step 15: Place the PCR tube in a 1.5 ml centrifuge tube, centrifuge at 2000 g for 2 min in a centrifuge at 4 °C. After centrifugation, collect the lower aqueous phase in the PCR tube.
[0122] Step 16: Purify the library DNA using the ZYMO DNA Clean & Concentrator-5 column (DNA-5) #D4014 kit. The steps are carried out according to the kit instructions. The specific steps are as follows: ① Transfer the aqueous phase in 15 to a 1.5 ml low-binding centrifuge tube, add DNA binding buffer with a volume 5 times that of the aqueous phase, and vortex for 10 - 20 s. ② Add the binding buffer in Step 16-① to the adsorption column and centrifuge at 10,000 g for 30 s. ③ Remove the centrifugate, add 500 μl of wash buffer to the adsorption column in Step 16-② and centrifuge at 10,000 g for 30 s; then wash once more with 200 μl of wash buffer and centrifuge at 10,000 g for 30 s. ④ Transfer the adsorption column in Step 16-③ to a new low-binding centrifuge tube, add 6 μl of nuclease-free water, incubate at room temperature for 2 - 5 min, centrifuge at 10,000 g for 30 s - 60 s, and then repeat the elution once with 6 - 8 μl of nuclease-free water. Combine the two eluates.
[0123] Step 17: Separate the library DNA using an 8% TBE gel. The specific steps are as follows: ① Prepare an 8% TBE gel (precast gels have a short shelf life and are expensive). ② Pre-electrophorese at 160 V for 10 min; take 10 μl of the sample in 16, add 5 μl of 6x loading buffer and mix well; load the samples in the order of loading marker, loading sample, loading marker, and perform electrophoresis at 160 V for 60 min. The blue band is around 200 bp. Stop the electrophoresis according to the band position. ③ Add 2 μl of SYBR gold nucleic acid dye to 1X TBE buffer, mix well and transfer it to a 10 cm cell culture dish; place the electrophoresed gel block in it and incubate in the dark for 10 min. ④ Place a disposable PE glove on the agarose imager, place the stained gel in the imager for imaging, and cut the gel according to the marker band under ultraviolet light. The RPF range: 170 - 185 bp.
[0124] Step 18: Prepare a 500 μl centrifuge tube and pre-punch holes at the bottom of the centrifuge tube with a syringe needle. Place the gel cut in Step 17 in the 500 μl centrifuge tube, and place the 500 μl centrifuge tube in a 1.5 ml centrifuge tube. Use the push rod of a 1 ml syringe to squeeze the gel block from the bottom of the 500 μl centrifuge tube into the 1.5 ml centrifuge tube.
[0125] Step 19: Add 300 μl of nuclease-free water to the gel in the 1.5 ml centrifuge tube in Step 18, and incubate overnight at 37°C in a shaking incubator at a speed of 1300 rpm.
[0126] Step 20: Transfer the sol solution in Step 19 to a centrifuge column containing a filter membrane. The structure of the centrifuge column containing the filter membrane is shown in Figure 5 , centrifuge at 13,200 rpm for 2 min at room temperature, collect the filtrate, add 200 μl of nuclease-free water to the gel in the centrifuge column again, centrifuge again to collect the filtrate, and transfer the combined two filtrates to a new low-binding centrifuge tube.
[0127] Step 21: Transfer the filtrate in Step 20 to a 500-μl volume 10 KDa ultrafiltration tube, centrifuge at 13,500 g at room temperature for 5 min to concentrate the library DNA, gently pipette the remaining liquid in the ultrafiltration tube, then invert the ultrafiltration tube onto a new centrifuge tube, and centrifuge at 2,000 g at room temperature for 2 min to collect the filtrate, with a final volume of approximately 70 μl to 80 μl.
[0128] Step 22: Purify and recover the filtrate in Step 21 using the ZYMO DNA Clean & Concentrator-5 column kit. The procedure is the same as in Step 16, with the only difference being that finally, 8 μl of nuclease-free water is used to elute the library DNA twice, and the library DNA is combined, approximately 15 μl. Store at -80 °C.
[0129] Step 23: Send the library in Step 22 to a sequencing company for paired-end sequencing, with a sequencing data volume of 30 G.
[0130] Step 24: Analyze the sequencing data in Step 23.
[0131] In the above experimental procedures, the preferred options for experimental consumables are:
[0132] Large centrifuge tube (1.5 ml - protein low-binding tube; preferably epprnforf catalog number 0030108116); medium centrifuge tube (0.5 ml - protein low-binding tube; preferably epprnforf catalog number 0030108094); low-binding PCR tube (nucleic acid low-binding PCR tube - 200 μl, preferably Axygen PCR-02-L-C); DNA purification adsorption column (preferably zymo catalog number D4014), gel crushing device (inner rod of a 1-ml insulin syringe, medium centrifuge tube (with a hole opened at the bottom of the tube using a syringe needle, with a hole diameter of 0.5 - 1 mm), large centrifuge tube), gel filtration column (large centrifuge tube, with an inner tube containing a 0.45-μm pore size cellulose acetate membrane, sterilized; preferably Corning catalog number 8162), glass fiber filter membrane (inner diameter 10 mm, preferably GE 1823-010), 10K ultrafiltration tube (preferably Millipore Amicon UFC5010BK), library gel TBE gel).
[0133] In the above experimental procedures, the preferred options for experimental reagents are:
[0134] Actinomycin D: Cell Signaling Technology #2112, Mineral oil: sigma, RNaseINPlus: Promega, Micrococcal nuclease: New England Biolabs, Thermolabile Proteinase K: New England Biolabs, EGTA: Sigma-Aldrich, EDTA: Ambion, guanidium thiocyanate (GuSCN): Sigma-Aldrich, T4 Polynucleotide Kinase: New England Biolabs, T4 RNA Ligase 2 Truncated KQ: New England Biolabs, Q5 Hot Start High-Fidelity 2× Master Mix: New England Biolabs, SuperScript III: invitrogen, T4 RNA Ligase 1: New England Biolabs.
[0135] The TBE gel formulation for a 10 ml system is 8.0% acrylamide, which is prepared from 2.666 ml of 30% acrylamide, 1 ml of 10×TBE, 6.334 ml of ddH 2 O, 5 μl of TEMED, and 50 μl of 10% ammonium persulfate.
[0136] Among the reagents involved in the above experimental steps, 30% acrylamide is 29:1 (mass ratio, acrylamide: bisacrylamide) (preferably sigma#A3574); TEMED can be added to 1 μl / ml (preferably sigma#T9281); 10% APS (ammonium persulfate): ultrapure ammonium persulfate, 1 g; ultrapure water, 9 ml. After dissolution, store at -20°C (preferably sigma#AA3678); all reagents are stored in aliquots from the original packaging, following the RNase free principle, and 10X TBE is preferably invitrogen#AM9863.
[0137] The PCR primers used in the above experimental steps include any one or more of the following pairs:
[0138] The first pair:
[0139] PCR-R1# (SEQ ID NO:1) AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
[0140] PCR-F1# (SEQ ID NO:2) CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
[0141] Pair 2:
[0142] PCR-R2# (SEQ ID NO:3) AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGATCT
[0143] PCR-F2# (SEQ ID NO:4) CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
[0144] Pair 3:
[0145] PCR-R3# (SEQ ID NO:5) AATGATACGGCGACCACCGAGATCTACACTAGATCTCACACTCTTTCCCTACACGACGCTCTTCCGATCT
[0146] PCR-F3# (SEQ ID NO:6) CAAGCAGAAGACGGCATACGAGATCATGCCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
[0147] Pair 4:
[0148] PCR-R4# (SEQ ID NO:7) AATGATACGGCGACCACCGAGATCTACACTATCCTCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
[0149] PCR-F4# (SEQ ID NO:8) CAAGCAGAAGACGGCATACGAGATGATCATGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
[0150] Pair 5:
[0151] PCR-R5# (SEQ ID NO:9) AATGATACGGCGACCACCGAGATCTACACAGAGTAGAACACTCTTTCCCTACACGACGCTCTTCCGATCT
[0152] PCR-F5# (SEQ ID NO:10) CAAGCAGAAGACGGCATACGAGATACCTCAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
[0153] In one embodiment, different cell numbers (cells) were selected for library construction through the above experimental operations. The cells still selected spermatogonial stem cells in the testis tissue of 4-day-old mice. Four different cell numbers, 100, 1000, 3000, and 5000, were selected. The electrophoresis results are shown in Figure 6 , and it can be found that when 100 cells were selected, the target DNA fragment could be obtained. When the number of cells was greater than or equal to 1000, the trailing was obvious and the background noise was large. Therefore, based on the experimental data, the optimal cell number range for this product and method is 100 - 500.
[0154] In one embodiment, different concentrations of RNase I and micrococcal nuclease were selected to construct libraries for samples with the same cell number. After 8 cycles of PCR amplification through the above experimental operations, the electrophoresis results are shown in Figure 7 , and it was found that at the same concentration, the amplification effect of micrococcal nuclease was better. Further, the number of RPF reads after sequencing the library constructed by the conventional translation component was compared with the RPF reads after sequencing the library constructed by the microscale translation component. The difference in the number of target reads is shown in Figure 8 , and obviously, the number of target RPF reads in the microscale translation component library is much higher than that in the conventional translation component library. Figure 9 is the result of data quality control for translation group sequencing using the method of this product, Figure 9 In [A], the length distribution of reads aligned to the genome after removing adapters from sequencing is shown. Theoretically, the fragments protected by RPF are 24 - 35 nt, and the main peak is around 30 nt. The above results are consistent with the theory. The Y-axis is the number of fragments, and the X-axis is the length of the RNA fragment protected by RPF; Figure 9 In [B], the main position distribution of reads aligned to the genome on the genome is shown. Theoretically, ribosomes bind to the CDS (protein-coding) region of mRNA. The distribution characteristics of reads obtained by translation group sequencing are mainly the most in the CDS region and the least in the 3'-UTR region, indicating good quality control; Figure 9C and D in it are schematic diagrams of P-site analysis results. For P-site analysis, the three-base periodicity feature, the two displays respectively show the 3-nt feature of different fragment length distributions and the 3-nt feature of the distance between the fragment and the start codon. During the translation process, the ribosome moves relative to the RNA in units of the codon length (3 nt). Therefore, based on the P-site, the RPF fragments derived from the normal translation process should show a three-base periodic distribution on the RNA. This is direct evidence for determining whether an RNA is translated. In theory, the ribosome moves periodically in units of three bases as a codon, and this is manifested as a high-low-low distribution in the data.
[0155] The above has introduced in detail a micro-translation library construction product and its method provided by the present invention. For those of ordinary skill in the art, according to the idea of the embodiments of the present invention, there will be changes in the specific implementation manners and application scopes. In summary, the content of this specification should not be construed as a limitation of the present invention.
Claims
1. A micro translation library construction product, characterized in that, the product includes a cell lysis component, a nuclease and an enzymatic digestion buffer component, a reverse transcription reagent component, and a library DNA purification component; the cell lysis component is used to lyse sample cells and extract RNC from the sample cells; the nuclease and enzymatic digestion buffer component is used to enzymatically digest the RNC to obtain RPF-RNA; the reverse transcription reagent is used to reverse transcribe RPF-RNA fragments into corresponding DNA; the library DNA purification component includes electrophoresis reagents, a gel crushing device, and a filtration and purification product. The electrophoresis reagents are formulated into a gel for electrophoresis of the DNA generated by reverse transcription. The target area in the gel is cut out and placed into the gel crushing device for gel crushing. The sol solution obtained by adding nuclease-free water to the crushed gel is purified through the filtration and purification product to obtain library DNA; the gel crushing device includes a gel pressing device, a first centrifuge tube, and a second centrifuge tube. The gel pressing device is the inner rod of a syringe with rubber. The bottom of the first centrifuge tube has a small hole with a diameter of 0.5 - 1 mm, and the 0.5 - 1 mm small hole is opened at the bottom of the first centrifuge tube through a syringe needle; the second centrifuge tube is located outside the first centrifuge tube. The gel pressing device squeezes the gel in the first centrifuge tube, and the gel flows into the second centrifuge tube through the small hole to obtain crushed gel.
2. The micro translation library construction product according to claim 1, characterized in that, the product further includes a protein synthesis inhibitor, which is used to add to the obtained sample cells to obtain translation-inhibited cells. The translation-inhibited cells are then lysed. The protein synthesis inhibitor is selected from one or more of the following: chloramphenicol, kanamycin, neomycin, cycloheximide, tetracycline, oxytetracycline, puromycin, and diphtheria toxin.
3. The micro translation library construction product according to claim 1, characterized in that, the cell lysis component lyses cells by using one or a combination of the following methods: chemical method, enzymatic method, and physical method.
4. The micro translation library construction product according to claim 1, characterized in that, the nuclease and enzymatic digestion buffer component includes a nuclease, an enzymatic digestion buffer, and an enzymatic digestion termination buffer; the nuclease includes one or more of the following: micrococcal nuclease, RNase I, broad-spectrum non-restrictive nuclease, RNase A, and RNase R; the enzymatic digestion buffer includes one or more of the following: pH buffer, calcium salt, magnesium salt, and enzyme stabilizer; the enzymatic digestion termination buffer includes one or more of the following: EGTA, EDTA, proteinase K, and GuSCN.
5. The micro translation library construction product according to claim 1, characterized in that, the reverse transcription reagent component includes: 3'-end ligation reaction solution, reverse transcription primer buffer solution, 5'-end ligation reaction solution, reverse transcription reaction solution, and PCR reaction solution.
6. The micro translation library construction product according to claim 5, characterized in that, the reverse transcription primer buffer solution contains a reverse transcription primer, and the sequence of the reverse transcription primer is: ACACGACGCTCTTCCGA; The 3'-end ligation reaction solution contains a pre-adenylated 3'-end adapter, and the sequence of the pre-adenylated 3'-end adapter is: 5rApp / AGAUCGGAAGAGCGUCGUG / 3SpC3; The 5'-end ligation reaction solution contains a 5'-end adapter, and the sequence of the 5'-end adapter is: / 5Phos / NNNNNNNNNNAGATCGGAAGAGCACACGTCTG / 3SpC3.
7. The micro-translation library construction product according to claim 1, characterized in that, the library DNA purification component further includes a cDNA purification product, and the cDNA purification product purifies the reverse-transcribed DNA to obtain purified DNA.
8. The micro-translation library construction product according to claim 1, characterized in that, the filtration purification product includes a gel filtration product and a filtration column containing a glass fiber filter membrane.
9. A method for constructing a micro-translation library, characterized in that, the method includes: obtaining sample cells, extracting RNCs of the sample cells by cell lysis, and the number of the sample cells is 100-500; performing enzymatic digestion on the RNCs in a nuclease and an enzymatic digestion buffer to obtain RPF-RNA; using a reverse transcription reagent to reverse-transcribe the RPF-RNA fragments into corresponding DNAs; performing gel electrophoresis on the reverse-transcribed DNA, selecting the target region in the gel for gel cutting, placing the cut gel into a gel crushing device for gel crushing, adding nuclease-free water to the crushed gel to obtain a sol solution, and purifying the sol solution through a filtration purification product to obtain library DNA; the gel crushing device includes a gel pressing device, a first centrifuge tube and a second centrifuge tube, the gel pressing device is an inner rod of a syringe with rubber, the bottom of the first centrifuge tube has a small hole with a diameter of 0.5-1 mm, and the 0.5-1 mm small hole is opened at the bottom of the first centrifuge tube through a syringe needle; the second centrifuge tube is located outside the first centrifuge tube, the gel pressing device squeezes the gel in the first centrifuge tube, and the gel flows into the second centrifuge tube through the small hole to obtain crushed gel.
Citation Information
Patent Citations
A method for constructing Ribo-seq sequencing libraries
CN108624651B
Method for sequencing ribosome-protected RNA fragment by extremely small amount of cells
CN112195226A