Ac transposase molecular marker, primer, kit and application for identifying fruit anthracnose fungi

Abstract

The present invention discloses an Ac transposase molecular marker, primer, kit and application for identifying anthracnose of fruit. The whole genome sequence information of several anthracnose fungi closely related to oil-tea anthracnose is used to perform comparative genome analysis, obtain the chromosome sequence and candidate gene specific to anthracnose of fruit, and further select the candidate gene that can be used for specific identification of anthracnose of fruit as a molecular marker according to the possible gene function of the candidate gene and whether it contains introns and other characteristics, and use the marker to specifically detect anthracnose of oil-tea fruit. The present invention can be used for the diagnosis and prediction of anthracnose of oil-tea, and can also be used for the specific detection of anthracnose of fruit.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant anthracnose detection, and in particular relates to an Ac transposase molecular marker, primers, a kit and applications for identifying fruit anthracnose fungi. Background Art

[0002] Camellia oleifera, an evergreen shrub or tree in the Theaceae family, is native to China and a long-established woody oilseed species. It is considered one of the world's four major woody oil plants, along with olive, oil palm, and coconut. Camellia oil, extracted from camellia seeds, is rich in polyphenols and various unsaturated fatty acids. As an edible oil, it has health benefits, including cardiovascular protection and the prevention of arteriosclerosis. Furthermore, recent research suggests that camellia oil also has anti-melanin and antioxidant properties, making it a widely used functional oil in the health, food, and cosmetics industries (Chaikul, Sripisut, Chanpirom, Sathirachawan, & Ditthawuthikul, 2017; Xiao et al., 2017). Camellia oleifera is highly adaptable and grows in a wide range of habitats. In addition to its primary production areas south of the Yangtze River and the Qinling Mountains, it is also found in parts of the region north of the Yangtze River. Camellia oleifera tolerates poor and acidic soils, is easy to cultivate, and requires low maintenance. Therefore, vigorously developing camellia oleifera cultivation on sloping forest land, where cultivation is difficult, not only improves the environment, conserves soil and water resources, and regulates the climate, but also plays a significant role in increasing my country's oil crop yields and safeguarding edible oil safety ("To Turn Barren Mountains into Gold Vaults, Plant Camellia Oil Trees," 2020; Zuo Jing & Zhu Meixuan, 2020). However, camellia oleifera production and camellia oil quality have long been severely hampered by diseases such as camellia root rot, white rot, anthracnose, soft rot, bud disease, leaf blight, and sooty mold. As the area of ​​camellia oleifera cultivation continues to expand, the problem of camellia oleifera diseases has become increasingly prominent.

[0003] Camellia anthracnose is a major leaf and fruit disease that poses a serious threat to tea production, causing symptoms such as fruit drop, bud drop, and branch dieback. This disease consistently reduces tea yields by 10%-30% across the country, and in severely affected areas, yield reductions can exceed 50%, resulting in significant economic losses (Liu et al., 2018). Through the isolation and identification of the pathogens from the fruits and leaves of anthracnose-infected tea plants from different production areas, four species of the genus Colletotrichum—Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense, and Colletotrichum fructicola—as well as three genera of plant disease-related fungi, Neopestalotiopsis, Pestalotiopsis, and Alternaria—were isolated. Pathogenicity testing further confirmed Colletotrichum fructicola as the primary causative agent of anthracnose in tea (Wang et al., 2020). The four anthracnose fungi isolated from oil-tea camellia are closely related, belonging to the Colletotrichum gloeosporioides species complex. Currently, there is a lack of simple and effective methods for identifying, detecting, and quantifying fruit anthracnose fungi. Identification of fruit anthracnose fungi in oil-tea camellias relies solely on conventional pathogen isolation and purification, coupled with sequencing and homologous sequence alignment. Summary of the Invention

[0004] The present invention screened 965 Colletotrichum fructificum-specific coding sequences from 16,731 coding sequences in the genome of Colletotrichum fructificum by comparing the whole genome sequences of four Colletotrichum species, Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense and Colletotrichum fructicola, which were isolated from the anthracnose lesions of Camellia oleifera. Figure 1 Based on the sequence annotations and function predictions provided by NCBI, 115 gene coding sequences with important functions were screened, of which 22 intron-free gene sequences were selected as candidate molecular markers. Ultimately, one of these was selected as the Ac transposase molecular marker for identifying Colletotrichum oleraceus.

[0005] The primary purpose of the present invention is to provide an Ac transposase molecular marker for identifying Colletotrichum oleraceus, which is a segment of the Ac transposase with the gene number CGGC5_v012077, the specific sequence of which is:

[0006] >ANPB02000007.1_cds_KAF4479514.1_12077

[0007] ATGGACCATCTTCCTCTTTTTTTCACCAGGGGCCAAGCCTACGTTAAGGCCGAACTTCACAGTGCCCTCACCAAGATCCATATTG

[0008] GGTTTGATCTGTGGACTTCACCCAACAACTACGCCTACCTTGCAGTTACTGCCCACTTCGTCAACAATATGGGCCAGCACAAGTC

[0009] TCGTCTCATCGCCTTCAACCACATGAGTGGCGACCACAGTGGTCTCAACCTATCAAACAACATCTACGAGACTCTTCAGCAGTGG

[0010] GAGATCACTAGCCAAGTGGGTGTGGTGGTCTGTGACAACGCCAGCAATAACGATACCTGTGTCTTCGCCCTCTTCAAGAGACTTA

[0011] ACCCCACGATGAATCAGCTCGACTGTCAGGCAAGGAGAATGCGATGCTACGGCCACATCCTCAACCTGGTAGCACGGGCTCTTCT

[0012] CTTTGGTGCTGATCGCGAAGTCTTTGAGGCTGAGTCACTCTTCTACCAGACTGTCCACCATGAGGAAGAAGATCTGAGACTCTGG

[0013] AGGAAGACTGGGCCAGTTAGCAAGCTTCGCAACATCGTGAAGTTCATCAGGGCTTCCCCTCAGCGATCTGAGCGATTCAGGAAAG

[0014] CAGCCCAGGAAGTTGATGCTGGGTCAGACTTTGAGCTATTCGCCCAAGGGTCTAAGGAGTCACATCTCCTCCTCAACAACGAGAC

[0015] AAGATGGAATTCCACCTACCTCATGATCCATCGAGCTCTTCAGAAGAGGGCAGAGATTGAGACCTACGTCAACTGGGTTCAGGAG

[0016] CAGGATGTTGCCACCAGGAGGATACCTGACGATGACCTCCTTTCTTCAGAAGACTGGAAAGTCTTGGTTGAGATTAGATCTATCC

[0017] TTGAGCCTCTCTACCTGCAGACGAAGAGGACAGAGGGATGGGGTAAAGGGGATGGGCATGGTCGTCTCTGGGAAGTCATGACTGG

[0018] CATGGAGTACCTCCTTGAGCATCTAGAGGAGTGGAAGAGTCTATACAACTCCATACTCCATCCTATTGATTCTCAACAGGAAGAT

[0019] GAGTCGTCTACGATCGATCTGACTGCTGATGAAGAGTCCCTACCATCACAGACTCGATCAGGGCGTCCCATTCGATCTTCAGTCG

[0020] ACAGTCAGACCCAGCCTCTTCAGGAATCTATACTTCCACAACATGTAAGGGAGGACTGGAGCCAACGTACTGCTCGATTCAGGGA

[0021] TCTCTCTTCCTCTTACCAGGAGCATCTTCGTACTTCTGTTGAGTTGGCATGGCAGAAGCTCTCCTCCTATTATACGAAGTTAGAG

[0022] GAGTCCCCTTTGTTTGCTGCTTCTGTTATTCTCCACCCTTCACTTGGTATCTCATACCTTGAGGCAGTCTGGGATGAAGGGGTTC

[0023] AGCTTGAGTGGGTTCGTGATGCAAAGAAGGGGCTTAGGGATTACTTTGACCGCTGGTATAGGTCAGAGGAAGAGTCTGATGACCC

[0024] TACGGCTGTTTTTGAGATCACACTTCCATCCCATGAAGACAGCCACTTCAGGCAATGGGTACAGAGTAAACGTGGTTGTGAGACT

[0025] TCTCGACAGCAGGATGAGCTTGAGACATACCTCAGGCAACCTCCTCAACCCACAGGCGATCCTATTGAGTGGTGGAGAGACCATA

[0026] AGTCAACGTACCCTCTACTTAGTAGACTAGCACTTGATGTGATGGCAACACCAGCTATGGCTACTGACTGTGAGAGGGCATTCAG

[0027] TACTGCGAAGTTGACCTTGACGTCGCAAAGGCACTCAATAAAGCCTCAGACTATGGGTCAATTGCAGCTGACGAAGAATTGGCTAAAGGGCAGAGTTATGCCTGTGGGGAGTGAGGTTAGCTCATTGATGGGATCATGA, see SEQNO.1.

[0028] The second object of the present invention is to provide amplification primers designed based on the specific sequence of the molecular marker.

[0029] The primers, preferably the primer sequences are as follows:

[0030] AcTrans-F: GCGGCCCATTCGATCTTCA; see SEQ NO.2;

[0031] AcTrans-R: AGCAGCAGCAAACAAAGGGGACT; see SEQ NO.3.

[0032] The third object of the present invention is to provide the application of the primers in identifying fruit anthracnose. The specific application steps are as follows:

[0033] (1) Extracting total DNA from fungi or fungus / host plant mixed materials as templates;

[0034] (2) PCR amplification using primers:

[0035] (3) Detect the PCR products using agarose gel electrophoresis and read the bands using a gel imaging system;

[0036] (4) According to the product obtained in step (3), if a specific band with a length of 212 bp appears, it indicates that Colletotrichum fuscae is present in the sample; if no specific amplification with a length of 212 bp is present, it indicates that Colletotrichum fuscae is not present in the sample.

[0037] Furthermore, the PCR reaction system: the total volume was 20 μl, and the specific components were as follows: PCR was performed in a 20 μL reaction system consisting of 1 μl of 20 ng / μl genomic DNA, 10 μl superTaqPCR-Mix, and 10 μmol of each of the forward and reverse primers.

[0038] Furthermore, the PCR reaction amplification program is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing temperature at 69°C for 10 seconds, extension temperature at 72°C for 10 seconds, 35 cycles; then final extension at 72°C for 5 minutes; reaction termination.

[0039] The fourth object of the present invention is to provide a kit for identifying fruit anthracnose, comprising PCR reagents and the primers.

[0040] Advantages of the present invention:

[0041] The present invention can distinguish four species of Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense, and Colletotrichum fructicola, as well as three plant disease-related fungi genera, Neopestalotiopsis, Pestalotiopsis, and Alternaria, with high specificity and sensitivity. The four anthracnose fungi associated with oil tea anthracnose are particularly closely related, belonging to the Colletotrichum gloeosporioides species complex, making them difficult to distinguish. This invention provides a new strategy for the accurate identification of anthracnose fungi in oil tea fruit.

[0042] At the same time, the present invention has advantages in detection sensitivity compared with similar detection methods or probes, and can be used for high-sensitivity detection and identification of fruit anthracnose. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 :Comparison of coding sequence of genome genes of Colletotrichum related to tea anthracnose;

[0044] Figure 2 :The gene encoding the Ac transposase of Colletotrichum fructicola CGGC5_v012077 does not contain introns;

[0045] Figure 3 :The specific primers for the gene encoding the Ac transposase of Colletotrichum oleraceus can amplify specifically in Colletotrichum oleraceus;

[0046] DW stands for Double Distilled Water. Double distilled water was used as a negative control for PCR amplification to demonstrate the specificity of the amplification results.

[0047] Figure 4 :Detection sensitivity of the specific primers encoding the Ac transposase gene of Colletotrichum fuscae for Colletotrichum fuscae spores;

[0048] Figure 5 : Sensitivity of primers specific for the Ac transposase encoding gene of Colletotrichum oleiferum for detecting Colletotrichum oleiferum in tea leaves.

[0049] Mock is a blank control, proving that there is no nonspecific amplification; TUB is Bata-tublin, an internal reference of the plant genome, proving that the four Colletotrichum fruiting fungi gradient diluted mixed Camellia oleifera genomic DNA samples contain equal amounts of Camellia oleifera genomic DNA. DETAILED DESCRIPTION

[0050] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0051] Example: To specifically identify Colletotrichum fructicola, the present invention uses comparative genomics to identify specific sequences that distinguish Colletotrichum fructicola from other fungi as molecular markers. By comparing the whole genome sequences of four Colletotrichum species, Colletotrichum camelliae, Colletotrichum gloeosporioides, Colletotrichum siamense, and Colletotrichum fructicola, isolated from anthracnose lesions on tea oil trees, 965 Colletotrichum fructicola-specific coding sequences were screened from 16,731 coding sequences in the Colletotrichum fructicola genome. Figure 1 Based on the sequence annotation and function prediction provided by NCBI, 115 gene coding sequences with important functions were screened, of which 22 gene sequences without introns (Table 1) were used as candidate molecular markers.

[0052] Table 1 22 Colletotrichum spp.-specific intronless genes obtained by comparative genomic analysis

[0053]

[0054] The NCBI online primer design tool blast primer was used to design primers for the coding sequences of the above 22 intron-free Colletotrichum fructificum-specific genes. The genomic DNA of Colletotrichum fructicola, Colletotrichum cameliae, Colletotrichum gloeosporioides and Colletotrichum siamense was used as templates. The amplification specificity of the designed primers was detected by conventional PCR. Among them, the specific primers designed for the Ac transposase of Colletotrichum fructificum only produced specific amplification products in Colletotrichum fructificum and were used in subsequent experiments.

[0055] Specific primers were designed for the selected candidate molecular markers of fruit anthracnose, and the amplification specificity of the primers was tested in four species of Colletotrichum fructicola, Colletotrichum cameliae, Colletotrichum gloeosporioides and Colletotrichum siamense, and three fungal species related to oil tea anthracnose, Neopestalotiopsis, Pestalotiopsis and Alternaria. Figure 3 Using the genomic DNA of the above fungus as a template, a specific detection experiment was conducted by conventional PCR amplification to find the Ac transposase encoding gene (number CGGC5_v012077, Figure 2 ) designed primers produced specific amplified bands only in Colletotrichum oleraceus, but no bands in other anthracnose-related fungi.

[0056] Using gradient dilution of Colletotrichum conidia genomic DNA as a template, conventional PCR was performed using the specific primers encoding the Ac transposase gene of Colletotrichum acinarum of the present invention to test the detection sensitivity of the primers. Figure 4 The number of conidia of Colletotrichum oleraceus in each PCR reaction system ranged from 1 to 10 5 The results showed that the detection sensitivity of the specific primers for the gene encoding the Ac transposase of Colletotrichum oleraceus in conventional PCR can reach 10 3 spores / μl sample or 5pg genomic DNA sample.

[0057] The gradient dilution of the genomic DNA of the conidia of the fruit anthracnose fungus was mixed with the genomic DNA of the oil-tea camellia leaves, and the mixed DNA was used as a template. The specific primers encoding the gene of the fruit anthracnose fungus Ac transposase of the present invention were used to perform conventional PCR to test the detection sensitivity of the primers in the mixed sample of the fruit anthracnose fungus and the oil-tea camellia. Figure 5The number of conidia of Colletotrichum oleraceus in each PCR reaction system was 10 2 to 10 5 The results showed that the specific primer pair for the gene encoding the Ac transposase of Colletotrichum oleifera could detect the mixed sample of Colletotrichum oleifera with a sensitivity of 10 4 spores / μl sample or 50pg genomic DNA sample.

Claims

1. An Ac transposase molecular marker for identifying fruit anthracnose fungi, characterized in that: It is a segment of the Ac transposase with the gene number CGGC5_v012077, and the specific sequence is shown in SEQ ID NO.

1.

2. Amplification primers designed according to the specific sequence of the molecular marker according to claim 1, wherein the designed primer sequences are shown in SEQ ID NOs. 2 and 3.

3. Use of the primers described in claim 2 in identifying fruit anthracnose.

4. The use according to claim 3, characterized in that: (1) Extracting total DNA from fungi or fungi / host plant mixed materials as templates; (2) PCR amplification using primers: (3) Detect PCR products using agarose gel electrophoresis and read bands using a gel imaging system; (4) According to the product obtained in step (3), if a specific band with a length of 212 bp appears, it indicates that Colletotrichum spp. is present in the test sample; if no specific amplification with a length of 212 bp is present, it indicates that Colletotrichum spp. is not present in the sample.

5. The use according to claim 4, characterized in that , PCR reaction system: The total volume was 20 μl, and the specific components were as follows: PCR was performed in a 20 μL reaction system consisting of 1 μl of 20 ng / μl genomic DNA, 10 μl superTaqPCR‐Mix, and 10 μmol of each forward and reverse primer.

6. The use according to claim 4, characterized in that , The PCR amplification program was as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds, annealing at 69°C for 10 seconds, and extension at 72°C for 10 seconds, for 35 cycles; and a final extension at 72°C for 5 minutes; the reaction was terminated.

7. The use according to claim 4, characterized in that , used to distinguish Colletotrichum camelliae , Colletotrichum gloeosporioides , Colletotrichum siamense Three species of Anthrax and Neopestalotiopsis , Pestalotiopsis and Alternaria.

8. A kit for identifying fruit anthracnose, characterized in that: The method comprises PCR reagents and the primers according to claim 2.

Images